ID: 969143301

View in Genome Browser
Species Human (GRCh38)
Location 4:5099071-5099093
Sequence CTAGGGGAGAACCTATTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969143301 Original CRISPR CTAGGGGAGAACCTATTCAT TGG Intronic
903257312 1:22111498-22111520 ATGGGGGAGCAACTATTCATTGG + Intergenic
904210636 1:28884818-28884840 CCAGGGGACAACCTGTTTATAGG + Intergenic
905583856 1:39102408-39102430 GTAGAGGAGGACCTATTAATTGG + Intronic
908137262 1:61146079-61146101 CCAGGGGAGAACCTGTTCCTTGG + Intronic
914708511 1:150191388-150191410 CTAGGGGAGAATCTGTTCTTTGG - Intergenic
916189027 1:162160934-162160956 CTAGAGGAGAATCTGTTCCTTGG + Intronic
918563805 1:185901752-185901774 TTTGGGGAGAACTTATTCTTTGG - Intronic
919322965 1:196066030-196066052 CTAAGGGAGAACTTAATCATGGG + Intergenic
921613831 1:217243492-217243514 CTAGGGGAGAGTCTGTTCTTTGG + Intergenic
1063175704 10:3549181-3549203 CTAGGAGAGAATCTCTTTATTGG + Intergenic
1063302043 10:4858700-4858722 CTAGGGGAGTAGCAATTCGTCGG + Intergenic
1068002211 10:51348911-51348933 CTAGGGAAAAATCTACTCATTGG + Intronic
1071528063 10:86369464-86369486 TTAGGGGTGAACTTGTTCATTGG - Intergenic
1075643223 10:124080275-124080297 CAAGGGGAGAACCTGTTGATGGG - Intronic
1077288142 11:1776663-1776685 CCAGGGGTGAACCTGTTCCTTGG + Intergenic
1078089304 11:8254457-8254479 CCAGGTGAGAATCAATTCATTGG - Intronic
1089736497 11:120553424-120553446 CAAGGGGAGAACATTTTCAGAGG + Intronic
1095194928 12:39303020-39303042 CAAGGGGATAACCTATTTAGTGG - Exonic
1099382681 12:81974944-81974966 CTAGGGGAGAATCTATTTCCTGG + Intergenic
1107803401 13:44131653-44131675 CTAGGGGAGAAGCTTCTCAAAGG + Intergenic
1107884176 13:44860694-44860716 CTAAGGGAGAATCTATTCCCTGG + Intergenic
1109795964 13:67313321-67313343 CCAGGGGCAAACCTAGTCATAGG - Intergenic
1114835581 14:26199443-26199465 CTGGGGAAGAAACTATTCCTTGG - Intergenic
1115912367 14:38270612-38270634 CTGGGGGAGAGACTATTCAGTGG - Intergenic
1116603182 14:46954512-46954534 CCAGGGGAGAATATATTCCTTGG + Intronic
1126242415 15:46460382-46460404 CTAAAGAAGAACCAATTCATTGG - Intergenic
1128790314 15:70428449-70428471 CCAGAGGAGAACCTGTTCCTTGG - Intergenic
1137737408 16:50735263-50735285 CTAGGGGAGAATCTATTTCTTGG - Intergenic
1138701079 16:58864259-58864281 CTAGGGGAGAAACTAATGAAAGG - Intergenic
1146727340 17:35166990-35167012 CTAGGGGAGAATCTCTGCGTGGG - Intronic
1146912037 17:36654729-36654751 CTTGGGTAGAACATAGTCATAGG + Intergenic
1150152149 17:62818929-62818951 CTAGTGGGGAACCTTCTCATGGG - Intergenic
1153125385 18:1784650-1784672 CTGGGGGGAAACCCATTCATCGG - Intergenic
1161226897 19:3150983-3151005 CTAGGGGTGATCCTGTTCCTGGG + Intronic
1161638975 19:5407750-5407772 CTAGGGGAGAAGCTGTTCCCTGG + Intergenic
1163016829 19:14461455-14461477 CCAGGGGAGAACCTCTGCTTAGG - Intronic
927238192 2:20897379-20897401 CTAGGGAAGGAACTATCCATAGG - Intergenic
934072084 2:88393713-88393735 CTAGGGCATAACCAATTCAAGGG - Intergenic
944522887 2:200589327-200589349 CTATGGCAGAATTTATTCATGGG - Intronic
1177587458 21:23117122-23117144 CTAGGGGAGAATCTATTTCCTGG - Intergenic
951039676 3:17975605-17975627 CTAGGGGAGATGCTAGTCAGAGG - Intronic
951946570 3:28143670-28143692 CTAGGGGAGAAAGTTTTCACAGG + Intergenic
953430429 3:42835248-42835270 CTATGGGAGAGCATCTTCATGGG - Intronic
955335599 3:58083005-58083027 CTAGAGGATATCCTATTCTTAGG - Intronic
962872224 3:139507354-139507376 CAAGGGGAGAATCTGTTCAATGG + Intergenic
963873588 3:150447253-150447275 CTTGGGAAGAAACTATTCTTAGG - Intronic
969143301 4:5099071-5099093 CTAGGGGAGAACCTATTCATTGG + Intronic
970486497 4:16529945-16529967 CTTGGGGTGAGCATATTCATTGG + Intronic
972432763 4:38999708-38999730 CTAGGGAAGAATCTGTTCCTTGG + Intronic
977642835 4:99376740-99376762 GTAGGGGATAACCGAATCATGGG + Intergenic
978510019 4:109507158-109507180 CAGGGGGATATCCTATTCATAGG - Intronic
981679632 4:147381798-147381820 CTAGGGGTGTGCCTATGCATGGG - Intergenic
982719638 4:158846973-158846995 CTTGGGGAGAAACTTTGCATTGG + Intronic
987588909 5:19896538-19896560 CTAGGGAAGAATCTGTTCTTTGG - Intronic
987899980 5:23998825-23998847 GTAGGGGAGAACCCATTCCCTGG + Intronic
990108018 5:52288449-52288471 CCAGGTAAGAACATATTCATAGG - Intergenic
995470872 5:112500910-112500932 CTAAGGGAGAATCTGTTCCTTGG + Intergenic
996308960 5:122080868-122080890 CTAGGGAATAAGCTGTTCATGGG - Intergenic
997494374 5:134309667-134309689 CTAGGGAAGAATTCATTCATGGG - Intronic
998950909 5:147392317-147392339 CTAGGGGAAATCCTGTTCCTTGG + Exonic
1008383926 6:50865587-50865609 CTGGGAGAGAACCTATTCTATGG - Intergenic
1015309824 6:131754551-131754573 AAAGGGGTGCACCTATTCATGGG + Intergenic
1015341092 6:132101798-132101820 CTAGGGGAGAGACTGTTCAGAGG - Intergenic
1021888468 7:25164099-25164121 CTAAGGGGGAATCTATTTATTGG - Intronic
1022521924 7:31013968-31013990 CCAGTGGAGAACCGATGCATGGG - Intergenic
1030316922 7:108125598-108125620 CCAGTGGAGAACCTATTCACAGG + Intronic
1030712677 7:112769617-112769639 GTAGCATAGAACCTATTCATAGG - Intronic
1032691555 7:134292797-134292819 TTAGAAGTGAACCTATTCATAGG - Exonic
1034290704 7:149929021-149929043 TTAAGGGAGAACTTATCCATAGG - Intergenic
1038536357 8:28355965-28355987 CCAGGGAAGAACTTCTTCATTGG - Intronic
1041330668 8:56720152-56720174 CTAGGGCAGAACCTAAGCAAAGG - Intergenic
1055902687 9:81259216-81259238 CTAGGGGAGAATCTTTCCAAGGG - Intergenic
1059296031 9:113271559-113271581 CTAGGGAAGAATCCATTCCTTGG - Intronic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1189620848 X:42835716-42835738 CTATGGGAGACCCTAATCTTTGG - Intergenic
1196750597 X:119113956-119113978 TTAGGGGGGAACCTGTTAATTGG + Intronic
1198692770 X:139302414-139302436 CTAGGGTAGAATCCATTCCTTGG - Intergenic
1199143147 X:144334954-144334976 CTAGGGGAGAAACGTTCCATTGG + Intergenic
1199719865 X:150535316-150535338 TTAGGGGTGAACCAATGCATAGG + Intergenic