ID: 969145947

View in Genome Browser
Species Human (GRCh38)
Location 4:5124219-5124241
Sequence TTAGAACAGCCGGAGATTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969145947_969145950 6 Left 969145947 4:5124219-5124241 CCCGAAATCTCCGGCTGTTCTAA 0: 1
1: 0
2: 1
3: 3
4: 70
Right 969145950 4:5124248-5124270 CAGATGTCCGAGTGAGCAAAAGG No data
969145947_969145953 16 Left 969145947 4:5124219-5124241 CCCGAAATCTCCGGCTGTTCTAA 0: 1
1: 0
2: 1
3: 3
4: 70
Right 969145953 4:5124258-5124280 AGTGAGCAAAAGGTTTCACTGGG 0: 1
1: 0
2: 1
3: 16
4: 189
969145947_969145952 15 Left 969145947 4:5124219-5124241 CCCGAAATCTCCGGCTGTTCTAA 0: 1
1: 0
2: 1
3: 3
4: 70
Right 969145952 4:5124257-5124279 GAGTGAGCAAAAGGTTTCACTGG 0: 1
1: 1
2: 0
3: 6
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969145947 Original CRISPR TTAGAACAGCCGGAGATTTC GGG (reversed) Intronic
903536851 1:24072474-24072496 CTAGAACAGTCTGAGACTTCTGG - Intronic
904505906 1:30953753-30953775 TTACAACTGCGGGAGATTGCTGG - Exonic
905930244 1:41781865-41781887 TTAGAACAGCAGGAGGTGACAGG - Intronic
906924244 1:50097443-50097465 TTAGAACTGGCAGAGACTTCAGG + Intronic
908682418 1:66677009-66677031 TTAGATCAGCCTGAGATATGGGG + Exonic
911209949 1:95128559-95128581 TTGGAACAGCAGGAATTTTCAGG + Intronic
912680825 1:111727686-111727708 CTGGAACAGCTGGAGATCTCTGG - Exonic
914204012 1:145511202-145511224 TTTGACCAGTTGGAGATTTCTGG - Intergenic
914483136 1:148084356-148084378 TTTGACCAGTTGGAGATTTCTGG - Intergenic
915871312 1:159562526-159562548 TTAGAAAAGCCAAAGTTTTCTGG + Intergenic
917454254 1:175172226-175172248 TTAGTACAGCTGGAATTTTCAGG - Intronic
1078489271 11:11754316-11754338 TTAACACAGCCTGATATTTCAGG + Intergenic
1083697644 11:64453425-64453447 TTAGAAAAGCAGGGGATTTATGG + Intergenic
1093089926 12:14909663-14909685 TTTGAGCAGAGGGAGATTTCTGG - Intergenic
1093488908 12:19682401-19682423 TGAGAACAGTTGGAGATTTTAGG - Intronic
1104747452 12:131219387-131219409 TTAGAACAGCCGGTGACCACGGG + Intergenic
1105457872 13:20558010-20558032 TTAGAACAGACTGAAATTGCTGG + Intergenic
1108466856 13:50725300-50725322 TTAGAGCAGAAAGAGATTTCAGG - Intronic
1112005421 13:95249514-95249536 TTGGATCAGCAGGAGGTTTCCGG - Intronic
1112807847 13:103182721-103182743 ATAAAACTGCAGGAGATTTCAGG + Intergenic
1117372811 14:55094216-55094238 TTAGCACAGCCAGAGGCTTCTGG + Intergenic
1118514256 14:66508735-66508757 TGAGAACCGCCGGAGATTGGGGG + Intronic
1118729295 14:68655346-68655368 TTGGAACAGCCCCAGGTTTCAGG + Intronic
1128193844 15:65732559-65732581 TAAGAAAAGCAGGAGATGTCTGG + Intronic
1128673859 15:69594734-69594756 TTAGAACAGCCTGTGATAACCGG - Intergenic
1129032772 15:72630408-72630430 TTACAGCAGCTGCAGATTTCTGG - Intergenic
1129217114 15:74106829-74106851 TTACAGCAGCTGCAGATTTCTGG + Intronic
1129470733 15:75752028-75752050 TTACAGCAGCTGCAGATTTCTGG - Intergenic
1129812444 15:78521601-78521623 ATAGAAAAGCCGGAGAAGTCAGG + Intronic
1133635019 16:7656968-7656990 TTAGAAAAGATGGAGATTGCTGG - Intronic
1138895664 16:61200906-61200928 TTAGTACATCCAGAGATTTGAGG + Intergenic
1143821304 17:9565890-9565912 TAAGAACAGGCAAAGATTTCAGG + Intronic
1146627156 17:34443467-34443489 TCAGCACAGGCGGAGATTTATGG + Intergenic
1149534719 17:57424118-57424140 TGAGAACATTCGGAGAGTTCAGG - Intronic
1153142934 18:1995505-1995527 ATAGAAAAGGAGGAGATTTCAGG + Intergenic
1155565167 18:27126576-27126598 TTAGGACAGCTGGAGGTTTAGGG + Intronic
1157655909 18:49387960-49387982 TTAGAATAGCTGTAGATTTATGG - Intronic
1158008926 18:52706252-52706274 TAAGCACAGCCAGATATTTCTGG + Intronic
1158933721 18:62345846-62345868 TTAGGACAGCTGGTCATTTCTGG + Intronic
1159168210 18:64728540-64728562 TTAGAACAGTAGTAGATTTTGGG - Intergenic
1161518878 19:4712645-4712667 TGAGAACAGCCAAAGATGTCAGG + Intronic
1163261070 19:16190399-16190421 TTAGAACAGCTGGAGGTTTCAGG - Intronic
926349698 2:11983717-11983739 TGGGAACAGCCGCTGATTTCAGG + Intergenic
932591767 2:73071717-73071739 TTAAAAGGGCCGGAGATTGCGGG - Exonic
940485083 2:154287926-154287948 TTAGTATAGCCGGAGATTCTAGG + Intronic
945958686 2:216109619-216109641 TGAGAAAAGCTGGAGATTTGGGG + Intronic
946533722 2:220604494-220604516 TTAGAACAGAAGGAGACATCAGG - Intergenic
1170790153 20:19501747-19501769 TCAGAACAGTGGGAGATTACAGG - Intronic
1171504038 20:25618767-25618789 TGTGAGCAGCTGGAGATTTCTGG - Intronic
1172057771 20:32166172-32166194 TCAGAGCAGCCGGAGTTTGCTGG + Exonic
1175676695 20:60952281-60952303 TTTGAAAATCCTGAGATTTCTGG + Intergenic
1176942758 21:14943832-14943854 TTGGAAAAGGCTGAGATTTCAGG - Intergenic
1177299878 21:19229355-19229377 TTAAAAGAGCAGGAGATTACTGG - Intergenic
951525239 3:23646916-23646938 TTAGAGCAGCTGGAGACTGCAGG - Intergenic
953010218 3:39018331-39018353 TAAAAACACCCGGAGTTTTCAGG - Intergenic
961379893 3:126490236-126490258 TCTGAGCAGCCGGAGATTCCTGG - Intronic
964225182 3:154390095-154390117 TCAGACCAGCCAGAGATTCCAGG - Intronic
965919663 3:173896746-173896768 TTGAGACAGCTGGAGATTTCAGG - Intronic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
967526020 3:190493622-190493644 TTAGAACAGCTTGATATTTTCGG + Intergenic
968850756 4:3075706-3075728 TTAAAACAGCCTGAGATTTGAGG + Intronic
969145947 4:5124219-5124241 TTAGAACAGCCGGAGATTTCGGG - Intronic
975770683 4:77718794-77718816 ATAAAACAGCCGAAGATGTCAGG + Exonic
978703650 4:111678884-111678906 TAAGAACAGCCACAGATTACTGG - Intergenic
1001459313 5:171895636-171895658 TTATAACAGCCCTAGAGTTCTGG - Intronic
1009011892 6:57853076-57853098 TTAAAAAAGCAGTAGATTTCAGG - Intergenic
1030162662 7:106524964-106524986 TCAGAACACCAGGAGATTTCAGG - Intergenic
1031025118 7:116671931-116671953 TTAGCACAGCCGGAGATAAGCGG - Intergenic
1031598544 7:123675378-123675400 TTAGAACAGCCCCAGATTTTTGG - Intergenic
1031663052 7:124451206-124451228 TTAGAACATCCCGAGATAGCTGG - Intergenic
1033029297 7:137809475-137809497 TTAGGACAGCCCGAGACTGCAGG - Intronic
1046347134 8:112945078-112945100 TGTGAACATCCAGAGATTTCTGG - Intronic
1050601014 9:7251190-7251212 TTAGAACAACCTTATATTTCTGG + Intergenic
1198448779 X:136745189-136745211 TTAAAACAGACGGAGAATTGGGG + Intronic
1198985728 X:142450749-142450771 TTAGAAGAGCCAGACATTTGTGG - Intergenic