ID: 969150907

View in Genome Browser
Species Human (GRCh38)
Location 4:5167674-5167696
Sequence CTTGCCCGTCACCTGGGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969150907_969150916 17 Left 969150907 4:5167674-5167696 CCTCATCCCAGGTGACGGGCAAG 0: 1
1: 0
2: 0
3: 12
4: 138
Right 969150916 4:5167714-5167736 ACTCCCGTTTCTAACAGTCGTGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969150907 Original CRISPR CTTGCCCGTCACCTGGGATG AGG (reversed) Intronic
900362944 1:2298692-2298714 TCTGCACCTCACCTGGGATGTGG - Intronic
901181571 1:7345678-7345700 CTTCCCAGCCACCTGGCATGGGG - Intronic
902477473 1:16695922-16695944 CCTGCCCAGCACCTGGGATCTGG - Intergenic
902921440 1:19668055-19668077 CCTGCCTATCACCTGGGGTGGGG + Intronic
903066754 1:20703995-20704017 TTTGCCTGTCACCTGGCAGGTGG - Intronic
903795189 1:25923189-25923211 CTGGCCCTTAACCGGGGATGGGG - Intergenic
903971882 1:27124162-27124184 TTTGCCCCACACCTGGGGTGGGG + Intronic
904833879 1:33322570-33322592 TTTGTCTGTCACCTGGGTTGGGG + Intergenic
904941200 1:34165830-34165852 CACGCCCCTCTCCTGGGATGGGG - Intronic
909492468 1:76240598-76240620 CCTTCCAGACACCTGGGATGGGG + Intronic
912358343 1:109073819-109073841 GCTGCCCATCCCCTGGGATGTGG + Intronic
915528633 1:156490770-156490792 CTGGCAAGTCTCCTGGGATGGGG + Intronic
917096563 1:171404349-171404371 CTCTCCCTTCTCCTGGGATGGGG - Intergenic
917538936 1:175895071-175895093 CTTGCCCCTCTCCAGAGATGTGG + Intergenic
919924085 1:202183313-202183335 ACTGCCCCTCACCTGGCATGGGG + Intergenic
920026920 1:203005825-203005847 CGTGCAAGTCACCAGGGATGCGG + Intergenic
920365259 1:205444896-205444918 TTTGCCCTTTACCTGGGGTGGGG - Intronic
921933379 1:220773556-220773578 CTTGGCTGGCATCTGGGATGGGG + Intronic
923043433 1:230336706-230336728 CTTGCCTGTCTCCTGGGAAGGGG + Intronic
1063453497 10:6167045-6167067 CGGGCCCATCACCTGAGATGGGG - Intronic
1065027781 10:21555252-21555274 CTTGCCTGTCACCCAGGCTGCGG + Intronic
1071294295 10:84208163-84208185 CATTTCAGTCACCTGGGATGGGG - Exonic
1072510998 10:96124676-96124698 CTTGCCTGCCACCTTGGAGGAGG + Intergenic
1074900621 10:117813394-117813416 CTTGACCCTCATCTGGGAAGTGG + Intergenic
1075923064 10:126229148-126229170 CCTGCCCGCCTCCTGGGAAGGGG - Intronic
1076587701 10:131560701-131560723 CTTGCCTGTGAGCTGGGGTGGGG + Intergenic
1076683912 10:132188119-132188141 CTTGCCAGTCAGCTGGCATGTGG + Intronic
1076882878 10:133248089-133248111 CTGGCCCGGGAGCTGGGATGGGG + Intergenic
1077180062 11:1208338-1208360 CCTGCCCCACATCTGGGATGAGG - Intergenic
1077514877 11:2995419-2995441 CATGCCCTTCACCTGTGGTGGGG + Intergenic
1077839625 11:5960833-5960855 GCTGCCCATCATCTGGGATGTGG + Intergenic
1078334877 11:10455552-10455574 CTTCGCAGTCACCTGTGATGTGG + Intronic
1078680348 11:13469842-13469864 CTCACCCGTAACTTGGGATGAGG - Intergenic
1080675707 11:34424444-34424466 CTTGCCTCACACCTGGGATGGGG + Intergenic
1083291109 11:61690732-61690754 CATTCCCCTCACCTGGCATGGGG + Intronic
1085822134 11:79804467-79804489 GCTGCCCATCATCTGGGATGTGG + Intergenic
1090397066 11:126425884-126425906 CTTCCCTGTCTCCTAGGATGGGG - Intronic
1091708652 12:2719741-2719763 CTTGCCTTTCACCTTGGATGGGG - Intergenic
1092010891 12:5111723-5111745 CTTGCCCTTCACCTGGCAAGAGG + Intergenic
1095950584 12:47779743-47779765 CTTGCCCCTCACCTGCTGTGTGG - Intronic
1096215708 12:49796561-49796583 CTTGCTTTTCACCTGAGATGAGG + Exonic
1097285244 12:57872232-57872254 CTTTCCCATCCCCTGGGATGGGG + Intergenic
1099228541 12:79996697-79996719 CTTTCCTGTTACCTGGGATGTGG + Intergenic
1101486362 12:105166015-105166037 TTTCCCAGTCACCTGGGCTGGGG - Intronic
1101938871 12:109084002-109084024 CTTCCCCATCTCCTGGGCTGGGG + Intronic
1105292272 13:19060735-19060757 CGTGCGCGTCACTTGGGAAGAGG - Intergenic
1112936332 13:104804259-104804281 CTTGCCTGGAATCTGGGATGAGG - Intergenic
1118442492 14:65824481-65824503 CATGCCTGTGACCTTGGATGAGG - Intergenic
1119480698 14:74955862-74955884 CAGGGCGGTCACCTGGGATGGGG + Intergenic
1119868565 14:77993911-77993933 GCTGCCCATCATCTGGGATGTGG - Intergenic
1120207335 14:81600701-81600723 CTGGCCCGTCCCATGGAATGTGG - Intergenic
1127310222 15:57745636-57745658 CTTGCCCGTCATCTGCAAAGAGG - Intronic
1127496005 15:59512797-59512819 CTTCCCAGTCACCTGGGACAGGG + Intronic
1127978620 15:64017511-64017533 CCTGCCCGTGTCCTGGAATGCGG - Intronic
1128112539 15:65085779-65085801 CTGGCCCCTCACTTGGGAGGGGG - Intergenic
1128399861 15:67267246-67267268 CTTATGTGTCACCTGGGATGTGG + Intronic
1130939895 15:88498686-88498708 TTAGCCAGTCACCTAGGATGAGG + Intergenic
1135818326 16:25656363-25656385 CTTGGCCTTCTCATGGGATGTGG - Intergenic
1138563479 16:57815982-57816004 CTTGAACTTCACCTGGGGTGAGG + Intronic
1140477239 16:75245144-75245166 CTTGCTGGCCGCCTGGGATGGGG - Intronic
1142489221 17:267049-267071 CTCTCACGTCACCTGTGATGAGG + Intronic
1143972560 17:10806080-10806102 CTGGCCAGTCACCTGGAGTGGGG - Intergenic
1145941299 17:28744526-28744548 CTTCCCCGTCACCTGAGAGCCGG + Intronic
1146473740 17:33145173-33145195 CCTGCCAGTCTCCTGGGAAGAGG - Intronic
1147999543 17:44379808-44379830 CTTGCCCCTGTCCTAGGATGAGG - Exonic
1148632823 17:49125598-49125620 GCTGCCCGTCGTCTGGGATGTGG + Intergenic
1148697598 17:49570518-49570540 CCTGCCCGCCTCCTGGGGTGAGG - Intergenic
1150006155 17:61470213-61470235 CCTGCTCATCTCCTGGGATGAGG - Intronic
1150591461 17:66566236-66566258 TCTGCCCGTTCCCTGGGATGGGG - Intronic
1155582487 18:27324894-27324916 CTTCCCTGACACCTGTGATGAGG - Intergenic
1159567458 18:70068572-70068594 CTCCTCCTTCACCTGGGATGGGG - Intronic
1162561246 19:11419197-11419219 CCTGCGGGTCACCAGGGATGCGG + Intronic
1163008680 19:14411587-14411609 CAGGACCGTCACCTGGGAAGTGG + Exonic
1163376819 19:16938264-16938286 CCTGCCCTTCCCCTGGGAAGGGG - Intronic
1164750690 19:30652798-30652820 CTTGACCTTCACCTGGGGCGTGG + Intronic
1165203463 19:34164172-34164194 CTTGCCAGTCAATTAGGATGAGG - Intergenic
1165704580 19:37966606-37966628 CCTGCCAGCCATCTGGGATGGGG + Intronic
1167055965 19:47111995-47112017 CTTGCCCGTCGCCTGGCTTCGGG - Intronic
1168384036 19:55948106-55948128 CATGCCCATCACCTGGGACCAGG + Exonic
1168540494 19:57205778-57205800 CTTGCCAGTCACCTGCTGTGTGG + Intronic
1202711493 1_KI270714v1_random:21748-21770 CCTGCCCAGCACCTGGGATCTGG - Intergenic
925994027 2:9277123-9277145 ATGGCCCCTCTCCTGGGATGGGG + Intronic
926700578 2:15800625-15800647 CCTGCTATTCACCTGGGATGGGG - Intergenic
927200542 2:20575584-20575606 CTGGCTCCTCACCTGGCATGTGG - Intronic
927917168 2:26944763-26944785 CCGGCCCGTCACCCGGCATGGGG + Exonic
927960558 2:27238463-27238485 CTTGCCAGTGACCTGCGAGGTGG + Exonic
928089836 2:28367254-28367276 CTTTCCAGTCACCTGTGATATGG - Intergenic
930008931 2:46919904-46919926 CTCCCCTGTCAGCTGGGATGGGG + Intronic
932666841 2:73705066-73705088 CTTCTCTGTCACCTGGAATGTGG - Intergenic
932756659 2:74414500-74414522 CTTCCACATCACCTGGGAAGTGG + Exonic
937290508 2:120778920-120778942 CTTGCCCGGCAAATGGGATTGGG + Intronic
937528324 2:122798001-122798023 CATGCCTGTCACCAGGGATGAGG - Intergenic
943323401 2:186472859-186472881 GCTGCCCATCATCTGGGATGTGG + Intergenic
944511718 2:200472140-200472162 CTTGCCTGTAACCTTGGAAGTGG + Intronic
945314836 2:208360362-208360384 CTTCCCTGGCAGCTGGGATGAGG + Intronic
948845079 2:240679240-240679262 CTGGGCTGTCTCCTGGGATGTGG - Intronic
948848781 2:240695639-240695661 CTGGGCTGTCTCCTGGGATGTGG + Intronic
1170169188 20:13392667-13392689 CTTCACCTTCACCAGGGATGTGG - Intronic
1175579629 20:60088412-60088434 CTCTCCCGTGGCCTGGGATGGGG + Intergenic
1181306871 22:21921955-21921977 CCTGCCAGTCACCTGGGCAGCGG + Exonic
1182867067 22:33613102-33613124 CTTGGTTGTCACCTGGGCTGAGG - Intronic
950749938 3:15120510-15120532 CTTGCCTGCCTCCAGGGATGGGG - Intergenic
951093203 3:18598931-18598953 CTTGCTCCTCCCCAGGGATGTGG - Intergenic
951996074 3:28730729-28730751 CTTGTTCTTCTCCTGGGATGTGG - Intergenic
952875453 3:37941029-37941051 CTTGCCCCTCCCATGGGCTGGGG - Intronic
956930983 3:74042696-74042718 CTTGCCAGCCACCAGGGTTGAGG - Intergenic
961454417 3:127017070-127017092 CCAGGCCTTCACCTGGGATGGGG + Intronic
961819840 3:129570416-129570438 CTTGCATGTCTCCTGGGATGGGG - Intronic
966026436 3:175288688-175288710 CTTGTCCGTTCCATGGGATGCGG + Intronic
969150907 4:5167674-5167696 CTTGCCCGTCACCTGGGATGAGG - Intronic
969258951 4:6021742-6021764 CTTGCCCCTGACCAGGGAAGGGG + Intergenic
969479673 4:7441275-7441297 GCTGCCCCTCACCTGGGGTGCGG - Intronic
969571257 4:8009885-8009907 CTTGCCCGTGACCTTGGGCGAGG - Intronic
976286940 4:83380112-83380134 CTTCCCAGTCTCCTGGGAGGAGG - Intergenic
979941731 4:126771173-126771195 CCCGCCCATCATCTGGGATGTGG + Intergenic
980897129 4:138870560-138870582 CTTCCCTGTTACCTGGGAAGTGG - Intergenic
981171972 4:141636287-141636309 GGTGCCCGTCGCTTGGGATGCGG + Intergenic
984187093 4:176558201-176558223 GTTGCCCGTCATCTGGAATTAGG - Intergenic
991181259 5:63753535-63753557 CTGGCCCATCCCCTGGGATGTGG - Intergenic
991589909 5:68239772-68239794 CTTGCCAGTGACGTGTGATGCGG + Intronic
992092001 5:73325781-73325803 CTTGACCCTCACTTGGGAGGAGG - Intergenic
995689194 5:114804461-114804483 CTTGCCTGGTACCTGGCATGTGG - Intergenic
996900792 5:128538985-128539007 CCGGCCCCTGACCTGGGATGGGG + Intronic
998174717 5:139894736-139894758 CTTACCAGTCACCAGGGATTTGG + Intronic
998236281 5:140401417-140401439 CTTTCCCGTCACCTCAGATGAGG + Intergenic
1003722586 6:8720548-8720570 CTTGCGCGTCACCTGGGAAATGG + Intergenic
1005994616 6:30923696-30923718 CCTGCCTGTCACCTGGGGAGAGG + Intronic
1006299222 6:33185030-33185052 CTTCCTCTTCACCTGGGGTGGGG + Exonic
1006644478 6:35506320-35506342 CTTCCCCGCCTCCAGGGATGCGG - Intronic
1007168267 6:39843811-39843833 CTTTCCTGTGAGCTGGGATGGGG + Intronic
1023158076 7:37271620-37271642 CTTGCCCTTCGCCTGGAATAAGG + Intronic
1023991314 7:45130419-45130441 CTTGCCTGTCATCTGGGTTCAGG + Intergenic
1026370101 7:69690755-69690777 CTTTCTCGTCACCTGCAATGTGG + Intronic
1026679100 7:72451690-72451712 CTTGTCAATCACCGGGGATGGGG - Intergenic
1032476249 7:132213459-132213481 CTTGGCCTTCACCTTGCATGTGG + Intronic
1034986540 7:155519134-155519156 CTTTCCCGGCCCCTGGGGTGTGG - Intronic
1035274668 7:157740551-157740573 CATGGCCATCACCTGGGTTGGGG + Intronic
1039151778 8:34514580-34514602 CTGCCCCCTCACCTGGGATTAGG - Intergenic
1044492547 8:92836375-92836397 CTTGCCTGTCACCTGACAGGTGG - Intergenic
1048216571 8:132501044-132501066 CCTTCTTGTCACCTGGGATGAGG + Intergenic
1049414997 8:142491058-142491080 CCTGCCCATCACCTGGCCTGTGG - Intronic
1049454276 8:142679064-142679086 CCTGCCAGTCAGCTGGGAGGTGG - Intronic
1049534282 8:143170954-143170976 CTTGTGCATAACCTGGGATGGGG + Intergenic
1050093464 9:2039575-2039597 CCTGCGGATCACCTGGGATGAGG - Exonic
1057302955 9:93896968-93896990 CTTGGCCCTCTCCTGGGGTGGGG - Intergenic
1058646582 9:107136489-107136511 CTTGCCCATGAAGTGGGATGGGG + Intergenic
1060198783 9:121639963-121639985 CATTCCAGTCCCCTGGGATGTGG - Intronic
1061566451 9:131443966-131443988 CTTGCAGGTCAGCTGGGAAGGGG + Intronic
1062459833 9:136658405-136658427 CATGCCGGTCCCCTGGGGTGTGG + Intergenic
1062733001 9:138119947-138119969 CTGGCACGACACATGGGATGGGG + Intronic
1199742650 X:150750280-150750302 CTTACCCCCGACCTGGGATGTGG + Intronic