ID: 969151818

View in Genome Browser
Species Human (GRCh38)
Location 4:5176201-5176223
Sequence CCTTTCCCAGACAAAGAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5029
Summary {0: 1, 1: 77, 2: 2871, 3: 1231, 4: 849}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969151818_969151825 11 Left 969151818 4:5176201-5176223 CCCCTTTCTTTGTCTGGGAAAGG 0: 1
1: 77
2: 2871
3: 1231
4: 849
Right 969151825 4:5176235-5176257 CCCGTTGCACTTCCCAGGTGAGG 0: 2
1: 375
2: 1479
3: 2207
4: 2263
969151818_969151823 6 Left 969151818 4:5176201-5176223 CCCCTTTCTTTGTCTGGGAAAGG 0: 1
1: 77
2: 2871
3: 1231
4: 849
Right 969151823 4:5176230-5176252 TCTGACCCGTTGCACTTCCCAGG 0: 1
1: 32
2: 517
3: 1519
4: 1459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969151818 Original CRISPR CCTTTCCCAGACAAAGAAAG GGG (reversed) Intronic
Too many off-targets to display for this crispr