ID: 969153116

View in Genome Browser
Species Human (GRCh38)
Location 4:5187122-5187144
Sequence CAGTAGTCAGAGAAGCCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969153111_969153116 3 Left 969153111 4:5187096-5187118 CCTGCAGGTGAGTGAGGGAATCC 0: 1
1: 3
2: 3
3: 16
4: 170
Right 969153116 4:5187122-5187144 CAGTAGTCAGAGAAGCCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969153116 Original CRISPR CAGTAGTCAGAGAAGCCATG GGG Intronic
No off target data available for this crispr