ID: 969156533

View in Genome Browser
Species Human (GRCh38)
Location 4:5215872-5215894
Sequence GAAGATGGACCTCCACAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969156527_969156533 20 Left 969156527 4:5215829-5215851 CCAGTGTTCAAGTCAATATCCAT 0: 1
1: 0
2: 1
3: 8
4: 210
Right 969156533 4:5215872-5215894 GAAGATGGACCTCCACAATTAGG No data
969156525_969156533 27 Left 969156525 4:5215822-5215844 CCCTTCTCCAGTGTTCAAGTCAA 0: 1
1: 0
2: 1
3: 26
4: 211
Right 969156533 4:5215872-5215894 GAAGATGGACCTCCACAATTAGG No data
969156529_969156533 1 Left 969156529 4:5215848-5215870 CCATTGAGTGCTGCCTCTTGGCC 0: 1
1: 1
2: 5
3: 31
4: 175
Right 969156533 4:5215872-5215894 GAAGATGGACCTCCACAATTAGG No data
969156526_969156533 26 Left 969156526 4:5215823-5215845 CCTTCTCCAGTGTTCAAGTCAAT 0: 1
1: 0
2: 2
3: 153
4: 4314
Right 969156533 4:5215872-5215894 GAAGATGGACCTCCACAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969156533 Original CRISPR GAAGATGGACCTCCACAATT AGG Intronic
No off target data available for this crispr