ID: 969157125

View in Genome Browser
Species Human (GRCh38)
Location 4:5220769-5220791
Sequence CAGAAAGAACAGAGGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969157117_969157125 21 Left 969157117 4:5220725-5220747 CCTTGTTAGCTAGCTCTCCATGG 0: 1
1: 0
2: 0
3: 4
4: 72
Right 969157125 4:5220769-5220791 CAGAAAGAACAGAGGCAGGGAGG No data
969157119_969157125 4 Left 969157119 4:5220742-5220764 CCATGGCAGCACAGAATTGAGTG 0: 1
1: 0
2: 3
3: 9
4: 168
Right 969157125 4:5220769-5220791 CAGAAAGAACAGAGGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969157125 Original CRISPR CAGAAAGAACAGAGGCAGGG AGG Intronic
No off target data available for this crispr