ID: 969157653

View in Genome Browser
Species Human (GRCh38)
Location 4:5225596-5225618
Sequence TGACAGGTTCAGAACCTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969157649_969157653 -10 Left 969157649 4:5225583-5225605 CCCTCCCGGTGGCTGACAGGTTC 0: 1
1: 0
2: 1
3: 4
4: 90
Right 969157653 4:5225596-5225618 TGACAGGTTCAGAACCTTAGAGG 0: 1
1: 0
2: 0
3: 8
4: 159
969157639_969157653 28 Left 969157639 4:5225545-5225567 CCCGTCTTTATCTTCTGGTTGGG 0: 1
1: 0
2: 2
3: 19
4: 411
Right 969157653 4:5225596-5225618 TGACAGGTTCAGAACCTTAGAGG 0: 1
1: 0
2: 0
3: 8
4: 159
969157641_969157653 27 Left 969157641 4:5225546-5225568 CCGTCTTTATCTTCTGGTTGGGA 0: 1
1: 0
2: 3
3: 26
4: 574
Right 969157653 4:5225596-5225618 TGACAGGTTCAGAACCTTAGAGG 0: 1
1: 0
2: 0
3: 8
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969157653 Original CRISPR TGACAGGTTCAGAACCTTAG AGG Intronic
902290488 1:15431766-15431788 TGACAGGCTGAGACCCTTGGTGG - Intergenic
903527618 1:24004024-24004046 TGACAAGCTCAAAAGCTTAGAGG + Intergenic
908132342 1:61085748-61085770 TGGCAGGTTCTTAACCTTTGGGG + Intronic
909405227 1:75281586-75281608 TCACAGGCTCAGAACCTAAGAGG + Intronic
911537315 1:99116032-99116054 GGACAGGTGCAGAACTGTAGGGG - Intergenic
913384299 1:118242462-118242484 TGACATTTTCAAATCCTTAGGGG + Intergenic
915033293 1:152902303-152902325 AGACAGGTGCAGAAACTGAGAGG - Intergenic
915247251 1:154565222-154565244 GGACAGGTCCAGAACCACAGAGG - Intergenic
916338942 1:163706664-163706686 TATCAGGTTCAGAAGATTAGGGG - Intergenic
916799827 1:168206210-168206232 TGAGAGGTTCAGGACTTCAGTGG - Intergenic
917265184 1:173213344-173213366 TGACAGATTCTAAAACTTAGTGG + Intergenic
917950996 1:180036071-180036093 TGAGGGGTTCAGAACTTCAGTGG + Intronic
918236753 1:182588644-182588666 TGACAGTTTCAAAGCCTCAGAGG + Intronic
918670494 1:187208906-187208928 AGACAGGGTGAGAACCTTACAGG - Intergenic
919184917 1:194133282-194133304 TGAGGGGTTCAGAACTTCAGTGG - Intergenic
921618039 1:217294945-217294967 TGATAGGTTCAGTCACTTAGAGG + Intergenic
921738797 1:218659517-218659539 TGGAAGGTTCAGAAACTTATGGG - Intergenic
1063851606 10:10198562-10198584 TGACAGCTACAGAACATTTGAGG - Intergenic
1066609770 10:37230304-37230326 AGACAGGTTCACAACATCAGTGG + Intronic
1067907490 10:50308884-50308906 TGACAGGTTCAGACTTTTATTGG + Intronic
1068831049 10:61495269-61495291 TAACAGGTTCATAATCTTACAGG - Intergenic
1069392579 10:67951944-67951966 AGACAGGTCCAGAAACTGAGAGG - Intronic
1070620045 10:78002431-78002453 TAAATGTTTCAGAACCTTAGAGG + Intronic
1071012021 10:80950773-80950795 TGATTGGTTCAGCTCCTTAGGGG - Intergenic
1071495379 10:86164282-86164304 AGAGAGGTTCAGAACCATGGAGG + Intronic
1071871689 10:89802409-89802431 TGACAGGTTCAAGACTTCAGTGG - Intergenic
1077030534 11:463947-463969 TAACAGGTTCCCCACCTTAGGGG + Intronic
1077981126 11:7301912-7301934 TGAAATGTTTTGAACCTTAGGGG + Intronic
1079325772 11:19490643-19490665 TGAGAGGTTCAAGACCTCAGTGG - Intronic
1080143849 11:28955440-28955462 TGAGAGATTCAAAACTTTAGTGG + Intergenic
1080276688 11:30511129-30511151 TGAGAGAGTCAGAAGCTTAGTGG - Intronic
1080425878 11:32153894-32153916 TTACAGATTCAGAAACTTGGAGG - Intergenic
1080955354 11:37087393-37087415 TGACAGGTTCAGGGATTTAGAGG - Intergenic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1091894967 12:4094764-4094786 TGTCAGGTTCCCAAACTTAGAGG - Intergenic
1095351960 12:41223906-41223928 GGAAAGGTACAGAATCTTAGTGG + Intronic
1096505257 12:52088516-52088538 TGGCAGGTTCTGCATCTTAGAGG + Intergenic
1096744334 12:53715677-53715699 AGAGGGGTTGAGAACCTTAGAGG - Intronic
1097334512 12:58366994-58367016 AGACAGGTTCTGTACCTTTGTGG + Intergenic
1097659425 12:62412781-62412803 TGAGAAGTTCAAAACCTCAGTGG - Intronic
1098972958 12:76875066-76875088 TGACAGGCACAGAACATTAAGGG + Intronic
1099162095 12:79254776-79254798 TGAGAGGTTCAGAACTTCAGTGG + Intronic
1099393702 12:82111863-82111885 TGACGGGTTCAGTACTTCAGTGG + Intergenic
1106881889 13:34140484-34140506 TGAGAGGTTAATATCCTTAGAGG + Intergenic
1109067272 13:57713523-57713545 TCACAGTTTCAGCAGCTTAGTGG + Intronic
1109080606 13:57895116-57895138 TGAGAGGTTCAAGACTTTAGTGG + Intergenic
1111278335 13:85983246-85983268 TGAATGGTTCAGAACTTCAGTGG - Intergenic
1115247273 14:31308895-31308917 TTACAAGTTTACAACCTTAGGGG - Intronic
1115884940 14:37960748-37960770 TGACAGACTCACAACCTCAGAGG + Intronic
1117959550 14:61149165-61149187 AAACAGGTTCAGAACCCTATAGG + Intergenic
1120430788 14:84411772-84411794 TGAGGGGTTCAAAACTTTAGTGG + Intergenic
1122269691 14:100563056-100563078 GGACAGGGTCAGGACCTTCGAGG + Intronic
1127705048 15:61538592-61538614 TGAGAGGTTCAGGACGTCAGAGG - Intergenic
1128345904 15:66852327-66852349 TTACAGGTGCAGAATCTGAGAGG - Intergenic
1129100104 15:73253791-73253813 TTAACTGTTCAGAACCTTAGTGG + Intronic
1133638539 16:7694749-7694771 TAACATTTTCAGAGCCTTAGTGG + Intronic
1137584588 16:49656902-49656924 TGACAGGCTCAGGGCCTTACAGG + Intronic
1137778212 16:51074160-51074182 GGCCAGATTCAGAACCTTGGAGG - Intergenic
1142788049 17:2240661-2240683 CGAGAGGTTCAGAGCTTTAGAGG - Intronic
1155480572 18:26283040-26283062 TGAGGGGTTCAGAACTTCAGTGG - Intronic
1156658557 18:39317867-39317889 TGACAGGTTCAGACCCCTGAAGG + Intergenic
1156933996 18:42680438-42680460 TGACAAGTTCAGAAAAGTAGAGG - Intergenic
1157489350 18:48111509-48111531 TGACAGGTTCAGAACAGTCCTGG - Intronic
1157575841 18:48742433-48742455 TGGCAGGTTCAGCCTCTTAGAGG - Intronic
1158239180 18:55357860-55357882 TTACAGGTTCAGATTGTTAGCGG - Intronic
1164129082 19:22345769-22345791 TGTCAGATTCAGAACCTCAAAGG - Intergenic
1164170285 19:22718930-22718952 TGTCAGATTCAGAACCTCAAAGG + Intergenic
1164171546 19:22729758-22729780 TGGGAGATTCAGAACCTTAACGG - Intergenic
1164296943 19:23919712-23919734 TGGTAATTTCAGAACCTTAGTGG + Intronic
1167453994 19:49588994-49589016 TAACAGGTGCAGCACCTGAGTGG + Intronic
926367893 2:12150329-12150351 CGACAGATTCAGAATCTAAGAGG - Intergenic
927193432 2:20532411-20532433 TGACAGTTTCAGAATTTCAGAGG + Intergenic
928371527 2:30743366-30743388 TGACAGGTACAGAACCCTCTGGG - Exonic
928932201 2:36636352-36636374 TGACAGGGACAGCACCATAGAGG + Intronic
929529604 2:42739975-42739997 TGAAAGGTTCAGGACTTCAGTGG - Intronic
929815758 2:45230068-45230090 TGAAAGTCTCAGAACCTTATAGG + Intergenic
929973555 2:46608399-46608421 TGAGAGGTTCAGGACTTCAGTGG - Intronic
933066129 2:77799466-77799488 TGACTGGTTCTCAATCTTAGAGG - Intergenic
934689088 2:96344259-96344281 TGACTAATTCAGAACCTTAGGGG + Intronic
938200334 2:129367413-129367435 TGGCACATTCAGAACCTTTGGGG + Intergenic
938311401 2:130291087-130291109 TGAGAGGTTCAGGACTTCAGTGG - Intergenic
939546817 2:143564980-143565002 TGACAGGTACACAAAGTTAGAGG + Intronic
940185952 2:150985145-150985167 TGAAAGGATCATAACCTTAGGGG + Intergenic
941209086 2:162612963-162612985 TGACAGTTTAAGGAACTTAGAGG + Intronic
941740171 2:169027667-169027689 TGACAGCCTCAGGACCTTTGTGG - Intronic
941912100 2:170773611-170773633 TGAGAAGTTCAGAATCTTATAGG - Intergenic
941983243 2:171483312-171483334 TGACAGGTACAAAACATTATGGG + Exonic
944440036 2:199733053-199733075 TGACAGGTACAGACTATTAGAGG + Intergenic
944609631 2:201389186-201389208 TGACAGTTCCAGAACCTTCTTGG + Intronic
945799916 2:214415478-214415500 TGAGGTGCTCAGAACCTTAGAGG + Intronic
945830106 2:214774169-214774191 TGAGAGGTTCAGAACTTAAGTGG - Intronic
949077995 2:242073588-242073610 TGACAGGAGCAGAACCTCTGCGG + Intergenic
1168936617 20:1671262-1671284 TGACATGTTAAGAACCTTCATGG + Intergenic
1169654467 20:7907682-7907704 AGCCAGCTTCAGAATCTTAGAGG - Intronic
1172626795 20:36352042-36352064 TGACAGCTACAGAAGCTCAGGGG + Intronic
1173179638 20:40795663-40795685 CGACATGTTCAGAAACTTAGAGG - Intergenic
1174428975 20:50453953-50453975 TGACCATTTCAGAACCTAAGAGG - Intergenic
1174491273 20:50897965-50897987 TGGCATGTTGAGAACCCTAGGGG - Intronic
1175732834 20:61365707-61365729 AGAGAGGCTCAGAACATTAGTGG + Intronic
1177310629 21:19387509-19387531 TCACAAATTCATAACCTTAGTGG - Intergenic
1178130387 21:29565400-29565422 AGACAGCTTCAGCACCTTAAAGG + Intronic
1178967629 21:37137432-37137454 TGAGGGGTTCAGGACATTAGTGG + Intronic
1180751228 22:18125769-18125791 TGAGAGTTTCAGAACCACAGTGG - Intronic
1184280037 22:43432177-43432199 TGACATCTTCAAAACCTCAGAGG + Intronic
949916207 3:8966593-8966615 TGACAGGGACTGAACCTTGGTGG + Intergenic
950945119 3:16937365-16937387 GGACAGGTTGAGAACCTGGGAGG + Intronic
952278990 3:31904776-31904798 TGACAGGTTCAGACCCAGATTGG - Intronic
956244610 3:67168395-67168417 TGACAAATTCAGAAACTTGGAGG - Intergenic
958411274 3:93819250-93819272 TGCCAGTTTCAGAAGTTTAGAGG - Intergenic
959793656 3:110395591-110395613 TGAAGGGTTCAAAACTTTAGTGG - Intergenic
963183691 3:142389354-142389376 TGAGAGGTTCAAAACTTCAGTGG - Intronic
963403126 3:144826856-144826878 TTACAGGGTGAGAACCATAGAGG - Intergenic
965388743 3:168077593-168077615 TGTCAATTTCAGAATCTTAGTGG - Intronic
965595640 3:170408208-170408230 TGAGGGATTCAAAACCTTAGTGG + Intergenic
966216881 3:177513021-177513043 TGGGAAGTTCAGAACCTGAGTGG + Intergenic
966282470 3:178248468-178248490 TGAGAGGTTCAAAAATTTAGTGG - Intergenic
966301166 3:178480941-178480963 TCACTGATTCAGAACCTTGGGGG + Intronic
966848387 3:184148148-184148170 TAAAAGGTTCAGCACCTCAGAGG + Intronic
967492250 3:190106408-190106430 TAACAGGTACAGAACACTAGGGG - Intronic
969152534 4:5182238-5182260 TGACAGGTTCAAGACTTCAGTGG - Intronic
969157653 4:5225596-5225618 TGACAGGTTCAGAACCTTAGAGG + Intronic
974911023 4:68120015-68120037 TGAGGGGTTCAAAACTTTAGTGG + Intronic
975711868 4:77168909-77168931 TGACAGGATCAAAACCTGAAAGG - Exonic
976893831 4:90083609-90083631 AGACAGCTTCAGAATCATAGAGG + Intergenic
977032080 4:91896131-91896153 TAACGTGTTCAGAACCATAGAGG - Intergenic
980653609 4:135753612-135753634 AGACAGGTTCAGAACCTGCGTGG + Intergenic
982265603 4:153535733-153535755 TCACAGGTTCAGAACCATTTTGG + Intronic
983073027 4:163292170-163292192 TTACTGGTTCAAATCCTTAGTGG + Intergenic
984854364 4:184181123-184181145 TAACAGCTTCAGAAGCTTTGGGG - Intronic
987124606 5:14800078-14800100 TGAGGGGTTCAAGACCTTAGTGG + Intronic
991386165 5:66092785-66092807 TGACAAGTTCAAAACCTCGGGGG - Intergenic
991413033 5:66364006-66364028 GGAGGGGTTCAGAACCTCAGTGG - Intergenic
992625130 5:78629978-78630000 TGACAAGTTCAGAAGCTTTAAGG + Intronic
996383213 5:122883591-122883613 TGACAGTTTTAGAAGCTTACTGG - Intronic
1003544442 6:7047088-7047110 TCACAGGCTCAGATGCTTAGGGG - Intergenic
1004586924 6:17011705-17011727 AAGCAGTTTCAGAACCTTAGTGG - Intergenic
1005103694 6:22200672-22200694 TGACAGGGTCAGAACTTCAAGGG - Intergenic
1007684902 6:43660343-43660365 TGACAGGTTCAAGACGTCAGTGG - Intronic
1009395065 6:63190168-63190190 TCACAGGTTCACAGCCATAGAGG - Intergenic
1009461218 6:63915742-63915764 TGAGGGGTTCAGAACTTCAGTGG + Intronic
1011178492 6:84591866-84591888 TGAAAGGTTCAAGACTTTAGTGG - Intergenic
1012137189 6:95572884-95572906 TGAAAGGATCAGAGCATTAGGGG + Intergenic
1012664288 6:101947464-101947486 TTATAGGTTAAGAAACTTAGTGG - Intronic
1021263436 7:18488170-18488192 TCACAGGATCAGAAACTTAATGG - Intronic
1022217379 7:28277911-28277933 TGCTGGGTTAAGAACCTTAGAGG + Intergenic
1025245692 7:57315307-57315329 TGACAATTTCAGAACCCGAGAGG + Intergenic
1026258626 7:68734809-68734831 TGAGTGGTTCAGAAGCGTAGGGG - Intergenic
1026435592 7:70394343-70394365 TGACAGGTTATGCACCATAGTGG + Intronic
1027795287 7:82685368-82685390 TGACATGTTAAGAACCACAGAGG - Intergenic
1034021969 7:147654594-147654616 TGAGAGGTTCAAAACTTCAGTGG - Intronic
1035435793 7:158858171-158858193 TGACAGGGTCAGGAAATTAGTGG - Intronic
1035536532 8:395389-395411 TGACAGGAGCAGAACCTCTGCGG + Intergenic
1036426379 8:8648720-8648742 TGAGACGATCTGAACCTTAGAGG - Intergenic
1036478049 8:9111859-9111881 TGAGAGGGTCAGGACTTTAGTGG - Intronic
1040036993 8:42880064-42880086 TGAGAGGTTCAGGACTTCAGAGG + Intronic
1040705629 8:50123005-50123027 TGACAGATTCAGAAACTAAGCGG + Intronic
1041249821 8:55923220-55923242 AGAAAGGATCAGTACCTTAGAGG - Intronic
1043206674 8:77452730-77452752 TGACAAGAGCAGAACTTTAGGGG - Intergenic
1048546802 8:135395205-135395227 TGGCAGGATCAGAAACTAAGGGG - Intergenic
1051693488 9:19742853-19742875 TGACAGTTTCTCAACATTAGAGG - Intronic
1052043667 9:23769882-23769904 TGGCAGGTTCAAAAGCTTTGAGG + Intronic
1055382552 9:75724677-75724699 GGACAGGTTCAGAGTCTTGGTGG + Intergenic
1056689282 9:88792893-88792915 TGACAGCCTCTGAACATTAGAGG - Intergenic
1056838355 9:89976471-89976493 TGCCAGGTTCAAAACCCAAGTGG - Intergenic
1057196151 9:93116450-93116472 AGACAGGTTCAGAATCTGGGAGG + Intergenic
1193147015 X:78087383-78087405 TGCCATGTTCCCAACCTTAGAGG + Intronic
1194322810 X:92472995-92473017 TAACAGCTTCAGAAGCTTCGGGG + Intronic
1200630964 Y:5586473-5586495 TAACAGCTTCAGAAGCTTCGGGG + Intronic