ID: 969158060

View in Genome Browser
Species Human (GRCh38)
Location 4:5230623-5230645
Sequence GGGCTGTCCCAGACCTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 237}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969158060_969158065 17 Left 969158060 4:5230623-5230645 CCTGGAAAGGTCTGGGACAGCCC 0: 1
1: 0
2: 1
3: 12
4: 237
Right 969158065 4:5230663-5230685 GTGCTGATATTACCACACTTTGG 0: 1
1: 0
2: 0
3: 12
4: 100
969158060_969158069 30 Left 969158060 4:5230623-5230645 CCTGGAAAGGTCTGGGACAGCCC 0: 1
1: 0
2: 1
3: 12
4: 237
Right 969158069 4:5230676-5230698 CACACTTTGGGCTGGAGATGTGG 0: 1
1: 0
2: 3
3: 31
4: 354
969158060_969158067 22 Left 969158060 4:5230623-5230645 CCTGGAAAGGTCTGGGACAGCCC 0: 1
1: 0
2: 1
3: 12
4: 237
Right 969158067 4:5230668-5230690 GATATTACCACACTTTGGGCTGG 0: 1
1: 0
2: 1
3: 9
4: 72
969158060_969158066 18 Left 969158060 4:5230623-5230645 CCTGGAAAGGTCTGGGACAGCCC 0: 1
1: 0
2: 1
3: 12
4: 237
Right 969158066 4:5230664-5230686 TGCTGATATTACCACACTTTGGG 0: 1
1: 0
2: 0
3: 10
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969158060 Original CRISPR GGGCTGTCCCAGACCTTTCC AGG (reversed) Intronic
900538235 1:3189471-3189493 GGGTTGTCCCAGGCCTGACCTGG - Intronic
900646977 1:3713404-3713426 GGGCCGTCCCAGGCTTCTCCTGG + Intronic
900836945 1:5012072-5012094 GGGCTCTTCCAGGCCTATCCTGG + Intergenic
906312226 1:44762135-44762157 GGTCTGTCCCAATCCTCTCCGGG + Intronic
907404802 1:54247365-54247387 AGGCTGTCCCAGCCATTTTCTGG + Intronic
909445306 1:75742655-75742677 GGGCTGTAGCAACCCTTTCCTGG - Intronic
912484939 1:110019029-110019051 GGGCTCTCTCTTACCTTTCCAGG + Exonic
916435320 1:164772608-164772630 GGGCTGTCCTAGTCCCTTTCAGG - Intronic
916748367 1:167701913-167701935 TGTCTGTCCCAGGTCTTTCCTGG + Intronic
917210494 1:172627023-172627045 GGGCTGTCCCAGATATTCTCAGG - Intergenic
920299096 1:204977537-204977559 GGGCTGTCCCCGTCCTTCCATGG - Intronic
921584937 1:216935515-216935537 GGGGTTTCCAAGCCCTTTCCAGG + Intronic
1064483170 10:15759822-15759844 GGGCTTTCCCTGACCTCCCCAGG + Intergenic
1067687795 10:48478205-48478227 GGGTGGGCTCAGACCTTTCCAGG + Intronic
1072466646 10:95669568-95669590 GGGGTGTCTCAGACCTTCCATGG + Intronic
1074363076 10:112838248-112838270 GGTCTGTCCCAGGCCCTCCCTGG - Intergenic
1074494348 10:113966585-113966607 GGTCTGTCACAGAGCTTTCAAGG + Intergenic
1075886434 10:125903437-125903459 GCTGTGCCCCAGACCTTTCCTGG + Intronic
1076001060 10:126913410-126913432 GGGCTGTCCCACACAACTCCAGG + Intronic
1076526213 10:131113730-131113752 GGGCTGTCCTGGTCCTTTTCAGG - Intronic
1076646223 10:131956732-131956754 GGCTTTTCCCAGACCTTACCTGG - Intronic
1076888983 10:133274866-133274888 AGGCTGTCCCAGAGCTCTGCAGG - Intronic
1077921873 11:6647403-6647425 GGGCTGTCCCAGGGATATCCAGG - Intronic
1078233327 11:9461542-9461564 GGGCTGGCCCAGGCCCTCCCAGG + Intronic
1081396091 11:42588024-42588046 GTGCTGCCCCAGACCTTGCTGGG + Intergenic
1081565783 11:44260214-44260236 GGTATGTCCCAGACCTTCACAGG + Intergenic
1082802880 11:57427174-57427196 GGTCTGCCCCAGCCCCTTCCGGG - Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1083693965 11:64430260-64430282 GGGCTGACTCAGACCTCTCCTGG - Intergenic
1083697733 11:64453821-64453843 GGGGTTTCCCAGATCTTTCAGGG + Intergenic
1085794330 11:79523684-79523706 GGCCTGGAACAGACCTTTCCTGG + Intergenic
1088606670 11:111540211-111540233 GCGGTGTCCCATAACTTTCCTGG + Intergenic
1089360543 11:117883261-117883283 GGGCTGTGCCTGGCCTTTCTTGG + Intergenic
1090383848 11:126345234-126345256 GAGCTGTCCCAGGCCAATCCAGG + Intronic
1090636414 11:128692988-128693010 GAGCAGACCCAGACTTTTCCCGG - Intronic
1093458174 12:19384697-19384719 GGGATCTCCAAGACCTTTTCAGG + Intergenic
1094493396 12:30975301-30975323 GGCCTGTCACACACCTGTCCAGG + Intronic
1098353733 12:69590005-69590027 TGACTGACCCAGACCCTTCCTGG - Intronic
1101494202 12:105237835-105237857 GGGCTGTCTGAGCCCTTTCAAGG - Intronic
1102531697 12:113551400-113551422 GTGCTGTCCAAGACCTCTCTTGG + Intergenic
1102540796 12:113617796-113617818 GGGCTGGCTCAGTCCTTCCCTGG + Intergenic
1102654795 12:114473028-114473050 TGGCTTTCCCAGACATTTGCTGG + Intergenic
1103023324 12:117554178-117554200 GGGCTGTACCAAATCTATCCCGG - Intronic
1103119919 12:118372258-118372280 CCGCTGTCCCTGACCTTTTCTGG + Intronic
1103443502 12:120979912-120979934 GGGTTGGCCCAGATCTTTCCAGG - Intronic
1104783872 12:131437604-131437626 GGGCTGTCCCAAATCATTCCAGG - Intergenic
1107064229 13:36195394-36195416 GCCCTGTGCCAGAGCTTTCCTGG - Intronic
1107936834 13:45352410-45352432 GTGGTCTCCCAGACCTTTTCAGG + Intergenic
1107981512 13:45738435-45738457 GAGCTGTCCCATACTTTTCAAGG + Intergenic
1111919396 13:94394608-94394630 GGGCTTTCACAGACCCTTTCCGG + Intronic
1111919488 13:94395801-94395823 GGGCTGTCCCAGGCCTGTAGAGG + Intronic
1114550271 14:23528750-23528772 GGGCTGGGCCAGAATTTTCCTGG - Intronic
1114665685 14:24376098-24376120 GGGCTGTCCCAGAGCGCACCAGG - Exonic
1115729235 14:36250168-36250190 GGGCTTTCTCAGATCTTTCCTGG - Intergenic
1119077914 14:71662666-71662688 AGGCTGTTCCAGAACTTTTCAGG + Intronic
1122854311 14:104552851-104552873 GGGCAGTTCCAGACTTTCCCTGG - Intronic
1123449042 15:20349104-20349126 AGGCTGTCCGAGTGCTTTCCCGG - Intergenic
1126764942 15:52002411-52002433 GTGCTTTCTCAGACCTCTCCTGG + Intronic
1128614076 15:69095700-69095722 TGGCTGTCACAGCCCTTTCTTGG + Intergenic
1129205840 15:74036575-74036597 GGACTGTTCCAGCCCCTTCCTGG + Intronic
1129262019 15:74373944-74373966 TGGCTCTCCCACTCCTTTCCTGG - Intergenic
1130516488 15:84629854-84629876 GGGCTCTCCCAGCCCTTCCTTGG + Intergenic
1130986126 15:88845782-88845804 GGGCTTTCCCACACCTGGCCTGG + Exonic
1131283360 15:91038624-91038646 AGACTGTCACAGACCCTTCCGGG + Intergenic
1132382607 15:101376999-101377021 GGGCTGTCTCAGAACTATGCAGG - Intronic
1132608085 16:801775-801797 GGGGTGGCCCAGACCTCTGCAGG + Intergenic
1132630323 16:914209-914231 GGGCAGTCCCTGACCCCTCCTGG + Intronic
1133345532 16:5067606-5067628 GTGCTGTCCCAAACCTTGCTGGG + Intronic
1136775198 16:32868090-32868112 GGACCGTTCCAGGCCTTTCCCGG - Intergenic
1136776243 16:32873356-32873378 GGGCTGTGCCAGGCCTGGCCAGG - Intergenic
1136894372 16:33988156-33988178 GGGCTGTGCCAGGCCTGGCCAGG + Intergenic
1137912069 16:52387787-52387809 CGGCTTTCACAGACCTTTCATGG - Intergenic
1140363951 16:74367574-74367596 GCCCTGTCCCAGACTTTTCTAGG + Intergenic
1203077615 16_KI270728v1_random:1130199-1130221 GGACCGTTCCAGGCCTTTCCCGG - Intergenic
1203078658 16_KI270728v1_random:1135465-1135487 GGGCTGTGCCAGGCCTGGCCAGG - Intergenic
1142961055 17:3552871-3552893 GGGATGTCTCTGCCCTTTCCTGG + Intronic
1147316013 17:39620657-39620679 GGGGTGCCCAAGACATTTCCAGG - Intergenic
1148050443 17:44767609-44767631 GGGCTCTCCCAGCCCCCTCCTGG + Intronic
1149306439 17:55351330-55351352 GGGCCTTCTCAGATCTTTCCTGG - Intergenic
1150462046 17:65361412-65361434 GGGATGTCCCAGACCCTTGGTGG + Intergenic
1150481864 17:65517016-65517038 GGGCTGCCCTGGACTTTTCCAGG - Intergenic
1151466586 17:74289614-74289636 GGGCTGCCACACACCTCTCCTGG + Exonic
1151617019 17:75219979-75220001 GGGCTGTCTCAGACCTGGCCTGG - Intronic
1151714403 17:75823970-75823992 GGCATGTCCCAGCCCTTTCTGGG + Intronic
1151926425 17:77200875-77200897 GAGCAGTCCCAGGCCCTTCCTGG - Intronic
1152339603 17:79716760-79716782 AGGCTGTCCGAGTGCTTTCCCGG + Intergenic
1152605163 17:81285935-81285957 GGGCTCACCCTGGCCTTTCCTGG + Intronic
1152740568 17:82016669-82016691 TGGCTGTCCCAGTCCTCTCTCGG - Intronic
1153199670 18:2635370-2635392 AGCCTTTCCCAGCCCTTTCCAGG - Intergenic
1155316241 18:24573965-24573987 GGGCTGTCCCTGACATTTATGGG + Intergenic
1156479550 18:37427419-37427441 GGACTGTTCTAGACCTTTTCTGG + Intronic
1158433793 18:57418209-57418231 GTGCTGCCCCAGACCTTGCTGGG - Intergenic
1161226054 19:3146471-3146493 GGGCTGTCCCAGAGGGTTCCAGG + Intronic
1161602221 19:5191254-5191276 GGCCTGTCCCGGACATTTCATGG + Intronic
1162430674 19:10626186-10626208 GGGCTCTCCCAGCCCTGTCTTGG + Intronic
1162752401 19:12836801-12836823 GGGATGTCCTAGACATTTCTAGG - Intronic
1163725932 19:18923005-18923027 GGGGTGTCACTGAGCTTTCCTGG + Intronic
1164926224 19:32132053-32132075 GGGCTGTCTCACAACTTTCTTGG - Intergenic
1165471882 19:36008801-36008823 GGGCGGAGCCAGACCTGTCCTGG - Intergenic
1165745212 19:38226582-38226604 GGGCCGGCCAAGACCTTACCTGG - Intronic
1166651819 19:44580723-44580745 GGGCTGTGCCAGTCCCTCCCTGG - Intergenic
1167721855 19:51185004-51185026 GGGCTGTGTCAGCCCCTTCCTGG - Intergenic
925333769 2:3078118-3078140 GGGGAGAACCAGACCTTTCCGGG + Intergenic
926786460 2:16522944-16522966 CAGCTGACACAGACCTTTCCTGG + Intergenic
927505836 2:23614166-23614188 GAGTTGTCCCACCCCTTTCCAGG + Intronic
931267621 2:60674538-60674560 GTGCTGGCTCAGACCTTACCTGG + Intergenic
932462301 2:71890710-71890732 GGGCTGTCAAAGACATTTCTTGG + Intergenic
932507297 2:72247553-72247575 GGTGTGTCCCTGGCCTTTCCAGG + Intronic
934767259 2:96886600-96886622 GAACTGTCCCAGGGCTTTCCAGG + Intronic
934927031 2:98389205-98389227 GGGCTGCCTCAGAACTATCCAGG + Intronic
937226809 2:120375003-120375025 GGGGTGTCCCACTCCTGTCCAGG + Intergenic
937358104 2:121211153-121211175 GGGCAGGCCCAGCTCTTTCCTGG - Intergenic
938297757 2:130189056-130189078 GGACTGCCCCAAACCTTTCCAGG + Intronic
938412312 2:131075201-131075223 GGGCAGTTCCAGACCTTTCTTGG - Intronic
948838228 2:240636506-240636528 TGGCTGAGCCAGATCTTTCCAGG + Intergenic
948860467 2:240750364-240750386 GGGCTGGCTCTGACCTTTGCAGG - Intronic
1168895555 20:1321119-1321141 GTGCTGTCCCGGAGCTGTCCCGG - Intronic
1174485959 20:50861416-50861438 GGGCTGGACCAGAGCTTTGCAGG + Intronic
1175998440 20:62821593-62821615 GGGATGTCCCAAACCGTGCCTGG + Intronic
1176092395 20:63325075-63325097 GGGTTCTCCCAGACCCTCCCAGG + Intronic
1176302513 21:5105300-5105322 GGTCTGTCCCAGGCCGCTCCTGG - Intergenic
1176342431 21:5710696-5710718 GGGCGCGCCCAGACCTTTGCAGG + Intergenic
1176345302 21:5738607-5738629 GGGAAGTCCCAGACCATTTCTGG - Intergenic
1176352116 21:5859191-5859213 GGGAAGTCCCAGACCATTTCTGG - Intergenic
1176474685 21:7142848-7142870 GGGCGCGCCCAGACCTTTGCAGG + Intergenic
1176499525 21:7585848-7585870 GGGAAGTCCCAGACCATTTCTGG + Intergenic
1176502396 21:7613760-7613782 GGGCGCGCCCAGACCTTTGCAGG - Intergenic
1176536752 21:8108765-8108787 GGGCGCGCCCAGACCTTTGCAGG + Intergenic
1176539623 21:8136677-8136699 GGGAAGTCCCAGACCATTTCTGG - Intergenic
1176558574 21:8319722-8319744 GGGAAGTCCCAGACCATTTCTGG - Intergenic
1177027039 21:15933012-15933034 AGTTTTTCCCAGACCTTTCCTGG + Intergenic
1178599828 21:33985895-33985917 GCGCTGTCCCAGGCCCTCCCTGG + Intergenic
1179854514 21:44156623-44156645 GGTCTGTCCCAGGCCGCTCCTGG + Intergenic
1181324250 22:22032609-22032631 GGGCTGTCCAAGCCCTTTCCTGG - Intergenic
1181466205 22:23112046-23112068 GGGCAGTGCCTGTCCTTTCCTGG - Intronic
1183049565 22:35249939-35249961 GGGCTGGCCCAGGTCCTTCCAGG + Intergenic
1183571392 22:38656183-38656205 GGGCCGACCCAGAACTTTGCGGG - Exonic
1183614723 22:38937036-38937058 AGGGTGTCCCAGCCCTCTCCAGG + Intergenic
1185031434 22:48445374-48445396 GGGCTTTCCAAGGACTTTCCTGG - Intergenic
1185206248 22:49540888-49540910 GGGCCGGCCCAGGCCATTCCTGG - Intronic
1203241699 22_KI270733v1_random:25176-25198 GGGCGCGCCCAGACCTTTGCAGG + Intergenic
1203244574 22_KI270733v1_random:53032-53054 GGGAAGTCCCAGACCATTTCTGG - Intergenic
953957568 3:47243604-47243626 GGGCTCTGCCAGTCCTTCCCGGG - Intronic
954617483 3:51976746-51976768 GGGCTGTCCCTGTCATTTCTTGG - Intronic
956647018 3:71466161-71466183 AGCCTGCCCCAGACCTTTCAAGG + Intronic
956736463 3:72242367-72242389 TGTCTCTCCCAGACCTCTCCAGG + Intergenic
959357695 3:105353713-105353735 GCGCTGTCTCGGAGCTTTCCCGG - Intergenic
961382863 3:126507149-126507171 GGGCTGTGCGAGACCTCTCTGGG + Intronic
961463161 3:127065840-127065862 GGCCTGCCCCAGAACTCTCCCGG - Intergenic
961663257 3:128481504-128481526 GGGCTGACCCACACCCTCCCTGG + Intronic
966943512 3:184761609-184761631 GGGGTGTGCCAGAACTCTCCTGG + Intergenic
968551683 4:1226603-1226625 GGGGTGCCCCAGACCATCCCTGG + Intronic
968563024 4:1294990-1295012 GGGGTGTCCCAGAGCTGTGCAGG + Intronic
969056269 4:4404844-4404866 GGGATGTTCCAGAGCCTTCCTGG + Intronic
969158060 4:5230623-5230645 GGGCTGTCCCAGACCTTTCCAGG - Intronic
969306325 4:6328081-6328103 GGGCTCTCCCAGACCTCTGAGGG - Intronic
969527838 4:7713016-7713038 GGGCTTTTCCAGACCCTTCTCGG + Intronic
972456115 4:39257108-39257130 GGGCCGTGCCATACCATTCCTGG + Intronic
972565051 4:40262220-40262242 GGTCTGTCCCAGACCAGGCCTGG - Intergenic
973565127 4:52178027-52178049 GGGCCATCTCAGATCTTTCCTGG - Intergenic
973970827 4:56212302-56212324 GGGATTTCCCACCCCTTTCCTGG + Intronic
976571881 4:86621645-86621667 GTGTTGCCCCAGACCTTTGCTGG + Intronic
978446968 4:108789138-108789160 GGGGTGTCCCAGATCTATGCTGG - Intergenic
982204881 4:152990145-152990167 GGGCTGTTCGAGACCCTTCTAGG - Intergenic
985878680 5:2620326-2620348 GGGCTGCCCCAGCCCTTTGGGGG - Intergenic
987117237 5:14735635-14735657 GGTCTGTTCCAGGCCTTTCCTGG + Intronic
987457783 5:18168636-18168658 TGGCTTTCCCAGATCTTTCTTGG + Intergenic
988579216 5:32454504-32454526 CGGCTGACACAGACATTTCCAGG + Intergenic
991298229 5:65103240-65103262 CGGCCGTCCCAGAACTTTCCAGG - Intergenic
992897057 5:81254592-81254614 GGGCAGTCACAGTGCTTTCCAGG - Intronic
992990019 5:82274527-82274549 GCGCTGTCCCACTCCCTTCCTGG + Exonic
993853327 5:93038418-93038440 GGGCTGAACTTGACCTTTCCTGG + Intergenic
994008761 5:94875312-94875334 TGGCTGTGCCAGGCATTTCCAGG + Intronic
994089895 5:95800633-95800655 GGGCTGACCTAGACCTTCTCAGG + Intronic
997304211 5:132826219-132826241 AGGCTGTCCCAGCCCTCACCCGG - Intronic
997575691 5:134975236-134975258 GGGCTCTCTCACATCTTTCCCGG - Intronic
998147371 5:139737898-139737920 GGAGTCTCCCAGACCTTTTCAGG - Intergenic
998523562 5:142821957-142821979 GGGCTGACCCAGCCCTTTGAGGG + Intronic
999374237 5:151075849-151075871 GGGCAGTCCCATACCTGCCCTGG + Intronic
1000755196 5:165149566-165149588 TGGCTGTGCCTGACATTTCCTGG + Intergenic
1002099884 5:176852131-176852153 GGGCTGCCACAGGCCTTGCCAGG + Intronic
1002851416 6:1000025-1000047 GGGCTGTCACAAACCCTGCCAGG - Intergenic
1003588069 6:7411501-7411523 GGACTGTCCCAAACCTATCTGGG + Intronic
1003739180 6:8915240-8915262 GGTCTGTACCAGCCCTTTACTGG - Intergenic
1004394245 6:15234215-15234237 GGACTGTCCCAGATTTTCCCAGG - Intergenic
1005276729 6:24227547-24227569 GGCCTGTCTCAGATCTGTCCAGG - Intronic
1007282942 6:40725770-40725792 AGGCTGTGCCAGTCCTTTTCTGG + Intergenic
1007502670 6:42310597-42310619 GGGCTGTCCCATGCCTTCCAGGG - Intronic
1007812236 6:44494708-44494730 GGGCTGTGGCAGACATTACCAGG + Intergenic
1007986009 6:46207289-46207311 GGGCTGTATCAGACCTATTCAGG - Intergenic
1010277526 6:73987121-73987143 GGTCTGTCCCAGTCCTCTTCTGG - Intergenic
1010301525 6:74265961-74265983 GTGCCCTCTCAGACCTTTCCTGG + Intergenic
1010784047 6:79979109-79979131 GGGCAGTCCCAGAACTAACCTGG - Intergenic
1014710694 6:124803143-124803165 GACCTGTTCCACACCTTTCCAGG + Intronic
1017605330 6:156127190-156127212 GGGCCGTCCCATACATTTCAGGG - Intergenic
1017773485 6:157661617-157661639 GGGCTGCCTCTGACCTTTGCTGG + Intronic
1018754423 6:166837258-166837280 AGGCTCTCCCAGCCCTTCCCCGG + Intronic
1019477209 7:1249716-1249738 GGCCTGTCCCGGACCCTGCCAGG - Intergenic
1019630457 7:2046199-2046221 GGGGAGTCCCATCCCTTTCCAGG + Intronic
1020137830 7:5596416-5596438 GGGCTGGCCCAGAGCTGCCCTGG + Intronic
1023861492 7:44219927-44219949 GGGAAGTCCCTGAGCTTTCCTGG - Intronic
1024920260 7:54546680-54546702 GGGCTGTCCCGGCGCTGTCCCGG - Intronic
1024920263 7:54546691-54546713 GGGCTGTCCCGGGGCTGTCCCGG - Intronic
1026501593 7:70947450-70947472 GCTCTGTCCCAGAACTGTCCTGG + Intergenic
1026772744 7:73212601-73212623 CGACTGTCCCAGATCTCTCCTGG + Intergenic
1027013608 7:74766001-74766023 CGACTGTCCCAGATCTCTCCTGG + Intergenic
1027074430 7:75180032-75180054 CGACTGTCCCAGATCTCTCCTGG - Intergenic
1031672204 7:124563621-124563643 TGGTTGTCCCAGATATTTCCAGG - Intergenic
1032080939 7:128858157-128858179 GGGCTGTCCCAGGCCTTCGTGGG + Exonic
1032091309 7:128913003-128913025 GGGCTGTCCCAGGCCTTCGTGGG - Intergenic
1032588703 7:133172400-133172422 GGACTCTGCCAGACTTTTCCAGG - Intergenic
1034216895 7:149414802-149414824 GGGCTTTTCTACACCTTTCCAGG + Intergenic
1035644098 8:1205285-1205307 GGGCTATCCCCGACCCCTCCTGG - Intergenic
1035725685 8:1823865-1823887 TGGCGGGCCCAGACCGTTCCGGG - Intergenic
1035970097 8:4238349-4238371 GGGCTGCCCCAGTCCTTGCTGGG - Intronic
1039469340 8:37803704-37803726 CAGCTCTCCCAGCCCTTTCCTGG + Intronic
1039846227 8:41327362-41327384 GGGCTGTCACCGACCTTGCAGGG + Intergenic
1041020364 8:53632557-53632579 GGGCTTTCCCAGATCATCCCTGG - Intergenic
1042822100 8:72940802-72940824 GGACATTCCCAGACCATTCCAGG - Intergenic
1045653692 8:104366011-104366033 GGGCTTTCTCAGAACTTGCCTGG + Intronic
1048912482 8:139149156-139149178 GGGCTGTCCCAGGCCTGCCTAGG + Intergenic
1049102009 8:140586809-140586831 GCTCTGTCCTAGACGTTTCCTGG - Intronic
1049371473 8:142269978-142270000 CGGCTGTGCCAGAGCTTCCCCGG + Intronic
1049404877 8:142447878-142447900 GGACTGCCCCCGCCCTTTCCTGG + Intergenic
1052686585 9:31764905-31764927 GGTCTGTCCCTGAGCTTTGCAGG + Intergenic
1053363794 9:37508656-37508678 GGGCTCTCCCAGACCTACCCAGG + Intergenic
1057134842 9:92680444-92680466 GGCGTCTCCCAGCCCTTTCCCGG - Intergenic
1057171304 9:92964865-92964887 GGGTGGTCCCAGACGTGTCCTGG + Intronic
1057536657 9:95916226-95916248 GGGCTGTGCCAGGCCTTTTAGGG + Exonic
1057897087 9:98917804-98917826 GGGATGTCAGAGACCCTTCCAGG - Intergenic
1058747447 9:108005657-108005679 TGCCTGTCAGAGACCTTTCCAGG + Intergenic
1058887407 9:109331707-109331729 GGGCTGTCACAGGCCATGCCTGG - Intergenic
1060486700 9:124052259-124052281 AGCCTGTCTCAGTCCTTTCCAGG - Intergenic
1060556099 9:124507805-124507827 GGGCTGGGCCAGACCATGCCAGG - Intergenic
1061894081 9:133637916-133637938 GGGCTGTCCCAGGTCTTTCTTGG - Intronic
1061939821 9:133877986-133878008 GTGCTTTCCCAGGCCCTTCCAGG - Intronic
1061972933 9:134054484-134054506 GGTCTGCCCCACACCTTTACAGG - Intronic
1062174669 9:135154559-135154581 GGGATTTCTCTGACCTTTCCAGG - Intergenic
1062586824 9:137253304-137253326 GGGCTTTCCCAGGCCTCCCCTGG + Exonic
1062595413 9:137296946-137296968 GGGCAGGCCCTGACCTTGCCGGG + Intergenic
1203458022 Un_GL000220v1:8251-8273 GGGCGCGCCCAGACCTTTGCAGG + Intergenic
1203460906 Un_GL000220v1:36115-36137 GGGAAGTCCCAGACCATTTCTGG - Intergenic
1190379949 X:49829624-49829646 GGGCTGTCCCACCCTTTCCCTGG - Intronic
1192057412 X:67786661-67786683 GGCCTCTCTCAGACCTTTCAAGG + Intergenic
1192547547 X:72026568-72026590 AGGCTGTCCCAGGCCCTGCCAGG + Intergenic
1193338472 X:80318665-80318687 GGGGTTTCCCAGATCCTTCCAGG - Intergenic
1197896114 X:131317404-131317426 AGCCTGTCCCAAACCTTTTCTGG - Intronic
1199616469 X:149659762-149659784 GGTCTGACCCAGGCCATTCCTGG - Intergenic
1199626172 X:149743486-149743508 GGTCTGACCCAGGCCATTCCTGG + Intergenic
1200104725 X:153705970-153705992 GGACCGTCCCAGGCCCTTCCCGG + Intronic
1202048049 Y:20753808-20753830 GGGCTCTCCGAGAGCTGTCCAGG + Intergenic