ID: 969158714

View in Genome Browser
Species Human (GRCh38)
Location 4:5236244-5236266
Sequence CTGAGTGAGTGCCAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 1, 2: 7, 3: 49, 4: 405}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969158714 Original CRISPR CTGAGTGAGTGCCAGGTGGA AGG (reversed) Intronic
900012777 1:131252-131274 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
900042840 1:487239-487261 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
900064278 1:722230-722252 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
900398236 1:2462087-2462109 CGGAGGGGGTGTCAGGTGGAGGG - Intronic
900398353 1:2462463-2462485 CAGAGGGGGTGTCAGGTGGAAGG - Intronic
900570232 1:3354706-3354728 CTGAGTCAGTGCCAGCTCCAAGG + Intronic
900709787 1:4106496-4106518 CTGAAAGAGGGCCAGGAGGAGGG + Intergenic
901653067 1:10754190-10754212 GGGAGTGAGAGGCAGGTGGATGG - Intronic
901915302 1:12494928-12494950 ACGAGTGAGTGCCTGGTGGCTGG - Intronic
902098329 1:13964961-13964983 ATAAGAGGGTGCCAGGTGGAGGG + Intergenic
902718264 1:18287696-18287718 CTGAGTGAGTACCTGGAGGCAGG - Intronic
903287174 1:22284566-22284588 CAGAGTCAGTGCTAGATGGATGG - Intergenic
904318616 1:29682106-29682128 CAGAATGAGGGCCAGATGGAGGG + Intergenic
904616544 1:31753142-31753164 CAGAGTTAGTGCCAGCTGCAGGG - Intronic
904876544 1:33659204-33659226 CTGAATGAATGCTAGATGGAAGG + Intronic
904963292 1:34351548-34351570 CTGATTGTGTGCCAGGTGGTAGG + Intergenic
905369782 1:37476804-37476826 ATGAGTCAGTGCTGGGTGGATGG + Intronic
905791896 1:40794138-40794160 CCGAGTGAGCTCCAGGTGAAGGG + Intronic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906914127 1:49989992-49990014 CTTAGTGAGTGAGGGGTGGAAGG + Intronic
907309200 1:53529726-53529748 CTGAATGAGTGGCAGGTGTGTGG + Intronic
909030135 1:70529693-70529715 CTGAGTAAGTCCCAGGTAAACGG + Intergenic
912481674 1:109986082-109986104 CTAACTGGGTGCCAGGTGTATGG - Intronic
913192755 1:116427108-116427130 CTGAGTAAGGGCCAGGTCAATGG - Intergenic
915943246 1:160132270-160132292 CTGGGTCAGAGCCAGTTGGAAGG + Intronic
918465432 1:184817017-184817039 CAGGGTGAGGGGCAGGTGGAGGG - Intronic
919423891 1:197405829-197405851 CGGGGTGGCTGCCAGGTGGAGGG - Intronic
919570763 1:199244024-199244046 CTGATTATATGCCAGGTGGAGGG - Intergenic
920093180 1:203468720-203468742 CTGAGGAAGAGTCAGGTGGAGGG + Intergenic
920842398 1:209565733-209565755 CTGACTGTGAGTCAGGTGGATGG - Intergenic
921577648 1:216855617-216855639 CTGAGTCTGTGGCACGTGGAAGG + Intronic
921729875 1:218566041-218566063 TTGGGTGAGGTCCAGGTGGAGGG - Intergenic
921767015 1:218983812-218983834 CGGAGTGAGTGCCAGGAGCAGGG + Intergenic
922013692 1:221620873-221620895 CTGGAAGAGGGCCAGGTGGATGG - Intergenic
922022808 1:221721443-221721465 CTGTGTGAGTTACAGCTGGATGG - Intronic
922099178 1:222468248-222468270 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
922261215 1:223947742-223947764 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
923295203 1:232587877-232587899 AAGAGTGAGAGCCAAGTGGAAGG - Intergenic
923523583 1:234755614-234755636 CTGAGTGGGTGCCACGTGACCGG - Intergenic
924342382 1:243049922-243049944 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
924686299 1:246294233-246294255 CTGAGTGAGTGCTATGTGCTGGG - Intronic
1062783929 10:244555-244577 CTGCGAGAGTGGCTGGTGGATGG + Intronic
1063120310 10:3101306-3101328 CTGAGAGAGCGCCAGGTGGATGG - Intronic
1064111235 10:12540999-12541021 CTGTGTAATTGTCAGGTGGAGGG + Intronic
1066479696 10:35783683-35783705 CTGAGTGAGTCCCACCTGCATGG + Intergenic
1066734094 10:38455633-38455655 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1067159378 10:43810422-43810444 CTGAGTCAGTCACAGGTGGAAGG + Intergenic
1067677883 10:48401160-48401182 CTCATTTAGTGCCAAGTGGAGGG - Intronic
1068972132 10:62970255-62970277 CTGAGTGATTGCCAGGGGCGGGG - Intergenic
1069685266 10:70314021-70314043 CAGAATGAGAGCCAGGTGAAAGG + Intronic
1070543655 10:77435866-77435888 CTCTGTCACTGCCAGGTGGATGG - Intronic
1070654915 10:78264764-78264786 ATGAGTGAATGGCAGTTGGATGG + Intergenic
1070684157 10:78468927-78468949 CTGGGCGGTTGCCAGGTGGAGGG + Intergenic
1072564976 10:96609939-96609961 CTGTGAGAGAGGCAGGTGGAGGG - Intronic
1073477112 10:103761638-103761660 CTGTGTGGGTGGCAGGTGGCTGG - Intronic
1074492880 10:113955033-113955055 CTGACTGCTTGCCAGGTGGAGGG + Intergenic
1074694679 10:116039113-116039135 CTGAGTGAGGGCCAGCTTGTGGG + Intergenic
1074869245 10:117564074-117564096 CTGAGAGAGGGGCAGGAGGAGGG - Intergenic
1074911259 10:117911443-117911465 CTGGGTCAGTGCCAGGAGGTGGG - Intergenic
1075064213 10:119278639-119278661 ATGAATGAGTGATAGGTGGAAGG - Intronic
1076234183 10:128851048-128851070 CTGAGTTTGTAACAGGTGGAAGG - Intergenic
1076920874 10:133454160-133454182 CTGAGTGAGACCCAGGCAGACGG - Intergenic
1076969113 11:123456-123478 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
1077283520 11:1756054-1756076 AGGCATGAGTGCCAGGTGGAAGG - Intronic
1077512476 11:2975828-2975850 CTGAGAGTTTGCCTGGTGGATGG - Intronic
1077577718 11:3397376-3397398 CGGGGTGGCTGCCAGGTGGAGGG - Intergenic
1080861834 11:36156690-36156712 CTGGGTGGGTGCCATGAGGAGGG - Intronic
1082166447 11:48955730-48955752 CTGGGTGGCTGCCGGGTGGAGGG + Intergenic
1082195481 11:49299117-49299139 CTGAGTGAGTGATATGTGAAAGG - Intergenic
1083724448 11:64620969-64620991 ATGAGTGAGTGTAAGGAGGAGGG + Intronic
1083841046 11:65304483-65304505 CAGAGTGTGTGCCATGTGGTAGG - Intronic
1083936615 11:65872869-65872891 CTGAGCCAGCGCCAGGGGGAGGG + Exonic
1083963491 11:66027727-66027749 CTTAGGGAGTGCGAGGTGGGTGG - Intergenic
1085046893 11:73358886-73358908 AAGAGTGTGTGCCCGGTGGATGG - Intronic
1085625399 11:78067984-78068006 CTGAATGACTGCCATGAGGAGGG - Exonic
1086660455 11:89410435-89410457 CTGAGTGAGTGATATGTGAAAGG + Intronic
1088703533 11:112437674-112437696 CTGAGTGAATGCCAGGGAGTTGG + Intergenic
1089093878 11:115901745-115901767 CTCAGTGAGCCCCTGGTGGAAGG - Intergenic
1089200546 11:116722364-116722386 CTGAGTTAGGTCCAGGTGGTTGG - Intergenic
1089610457 11:119665821-119665843 CAGAGTGACTGCCAGGTGTCTGG - Intronic
1090317525 11:125807052-125807074 CTGACTGAGGGCCAGGAGGCAGG + Intergenic
1091310961 11:134574923-134574945 TTGAGTGATTGCCACGTGGCAGG - Intergenic
1092761961 12:11818727-11818749 CAGCATGAGTGCCAAGTGGAGGG - Intronic
1092910905 12:13144226-13144248 ATGAGTGAATGTCATGTGGATGG - Intergenic
1095098196 12:38159017-38159039 CTGAGTGGGACCCAGGTGGACGG + Intergenic
1096214280 12:49791069-49791091 CTGCATGGGTGCCAGGTTGAGGG - Intergenic
1096257645 12:50072946-50072968 CTGAGAGAGTACCTGGTGGTGGG + Intronic
1096543901 12:52323828-52323850 CCGAGCGAGTGCCTGGTGGAGGG + Intergenic
1097185127 12:57192659-57192681 CTGTGGGAGGGCCAGGTGCATGG - Intronic
1098295431 12:68999418-68999440 CTGAGTCAGTTCCTGGTTGAGGG - Intergenic
1098486757 12:71030422-71030444 CTGGGTGAGTGACACGTGGAAGG + Intergenic
1098641915 12:72849216-72849238 CTGATTAAGTGCCATGTCGATGG + Intergenic
1098805457 12:75016151-75016173 GTGAATGAGAGCCAGGTGGGAGG - Intergenic
1098918364 12:76280040-76280062 CTGGGCTAGGGCCAGGTGGAAGG + Intergenic
1098918389 12:76280215-76280237 CTGGGCTAGGGCCAGGTGGAAGG + Intergenic
1099725897 12:86427497-86427519 CTGTGTGTGTGTAAGGTGGATGG - Intronic
1101159287 12:101956909-101956931 CTCTGTGAGTGCCATGTGGCAGG + Intronic
1101169763 12:102078603-102078625 CTGAGTGACTGCCATGTGACTGG + Intronic
1101673079 12:106894957-106894979 GTGAGTGAGTGGCAAGTGAATGG - Intergenic
1101801068 12:108022320-108022342 ATGAGTGAATGACAGATGGATGG - Intergenic
1102222127 12:111201677-111201699 CTGAGAAGGTGCCAGGTGCAGGG - Intronic
1102813723 12:115845347-115845369 CTGGGAGAATGCCAGGTGGAAGG - Intergenic
1103719819 12:122967131-122967153 CTCAGTGACTGCCAGGTGCTGGG + Intronic
1104856455 12:131904569-131904591 CTGGGTGAGTGGCTGGGGGATGG + Intronic
1105817294 13:24048169-24048191 CTGAGTGATACCCAGGTGGCAGG - Intronic
1108800068 13:54084095-54084117 CTGTGTGACTGGCAGGTGGTCGG - Intergenic
1109698391 13:65992625-65992647 CTGAGTGAGTTCCTGGTTGGGGG + Intergenic
1109831625 13:67798805-67798827 TTCATTGATTGCCAGGTGGAAGG + Intergenic
1110360130 13:74615367-74615389 ATGAATGTGTACCAGGTGGAGGG + Intergenic
1111893270 13:94109207-94109229 ATGAATGAGTGCCCAGTGGATGG + Intronic
1113218734 13:108073679-108073701 CTGAGTAAGTGCCAGGGGGTAGG + Intergenic
1113772675 13:112920653-112920675 GTGGGTGGGTGCCAGGGGGAGGG + Intronic
1113858045 13:113460213-113460235 CAGAGAGTGTGGCAGGTGGAGGG - Intronic
1113934158 13:113984613-113984635 ATGGGTGAGTGATAGGTGGATGG - Intronic
1113934835 13:113988523-113988545 ATGGGTGAGTGATAGGTGGATGG - Intronic
1113935035 13:113989444-113989466 ATGGGTGAGTGACGGGTGGATGG - Intronic
1113935087 13:113989677-113989699 ATGGGTGAGTGACGGGTGGATGG - Intronic
1114519611 14:23324992-23325014 CTGAGTGAGAGACAGGGGCAAGG - Intronic
1114659188 14:24334074-24334096 CTCAGTGAGAGCCCGGTGGAGGG + Intronic
1115085904 14:29514282-29514304 CAGAGTGAGAGCCAAGTGAAAGG + Intergenic
1116541639 14:46108288-46108310 CAGAGTGGGTGCCAGGAGCAGGG + Intergenic
1117349390 14:54866642-54866664 CTGAGTGAGTCACAGGAAGATGG + Intronic
1117596837 14:57333686-57333708 CGGGGTGGTTGCCAGGTGGAGGG - Intergenic
1118121537 14:62849994-62850016 CTGAGTGAATACCAGGTGTCAGG - Intronic
1118402625 14:65393920-65393942 CAGAGTGAGAGCCAAGTGAAAGG + Intergenic
1119165434 14:72488754-72488776 CTGAGTGAGTGCTGGGCTGAGGG - Intronic
1120316334 14:82898270-82898292 CTGACTCAGTGCCAAGTTGATGG - Intergenic
1120996569 14:90422437-90422459 CAGAGTGTGTGACAGGTAGAGGG - Intergenic
1121217739 14:92261689-92261711 CTGAGAAAGTTCAAGGTGGAAGG - Intergenic
1121438742 14:93935561-93935583 CTGAGTGAGGTCCTGGGGGAGGG + Intronic
1121601590 14:95208898-95208920 CTGAGTGAGTGACAGATGGGTGG - Intronic
1122100231 14:99402606-99402628 CAGAGTGAGACCCAGGTGGGTGG - Intronic
1122337732 14:101004951-101004973 CTTAATGAGTCGCAGGTGGAAGG - Intergenic
1122597011 14:102900643-102900665 CTGAGTGAAGGCCGCGTGGATGG - Intronic
1202897760 14_GL000194v1_random:19992-20014 CTGTGTGGGTGCCAGGTCCAAGG + Intergenic
1202902716 14_GL000194v1_random:52696-52718 CTGAGTTAGTCCCACGTGAAAGG + Intergenic
1123682552 15:22773147-22773169 CTGTGAAAGTGCCAGGTTGAAGG + Intronic
1123761565 15:23437379-23437401 CGGTGTGAGTGCCAGGCAGACGG - Intergenic
1123762532 15:23443933-23443955 CTGTGAAAGTGCCAGGTTGAAGG + Exonic
1123807534 15:23889846-23889868 CTTTGTGAGTCCCAGGTGGGCGG + Intergenic
1124334302 15:28845671-28845693 CTGTGAAAGTGCCAGGTTGAAGG + Intergenic
1124604351 15:31159929-31159951 CTCAGTAAGTGCCAGCTGGGGGG + Intronic
1125243736 15:37608827-37608849 CTGAGTGATTGCTAGGTGCCAGG - Intergenic
1125749501 15:42019148-42019170 CATAGTGAGAGCCAGGTGGATGG - Intronic
1126517189 15:49550446-49550468 CGGGGTGACTGCCAGGCGGAGGG + Intronic
1126761907 15:51977244-51977266 CTTAGTGAGGCCAAGGTGGATGG - Intronic
1128099723 15:64989168-64989190 CTGAGTGTGGGCCAGGTGTAAGG - Intronic
1128291998 15:66485116-66485138 ATGTTTGGGTGCCAGGTGGAAGG + Exonic
1129878608 15:78993001-78993023 CTGTGTGTGTGCCATGTGGGTGG + Intronic
1130210802 15:81919797-81919819 CAGAGTGAGTGCCAAGTGAAGGG - Intergenic
1130232875 15:82109866-82109888 CTTAGTAAGGGTCAGGTGGAGGG + Intergenic
1130321278 15:82844184-82844206 CTGAATGAGTACAAGGGGGATGG + Intronic
1130905995 15:88241314-88241336 CTGAGTGAGTGACAGAAGGAGGG + Intronic
1131405861 15:92163848-92163870 CTGAGGGGGAGCCAGGTGGGGGG + Exonic
1131449444 15:92527295-92527317 CTGGGTGAGTGCCAGGTACATGG + Intergenic
1132861961 16:2076247-2076269 CAGAGTGACAGGCAGGTGGAGGG + Intronic
1133017843 16:2952840-2952862 CTGCGTGAGTGCCGGGCTGAGGG - Intergenic
1134035882 16:11031146-11031168 CTGACTGAGTGCCAGGCGGTAGG - Intronic
1134385458 16:13767937-13767959 ATGAGTGATTGCCAAATGGAAGG - Intergenic
1135726537 16:24858440-24858462 ATGAGTGAGTGGATGGTGGATGG + Intronic
1136063560 16:27743490-27743512 CTCAGTCAGTGTCAGGAGGAGGG + Intronic
1137995653 16:53208360-53208382 CTGAATGAGTGGGAGGAGGAGGG + Intronic
1138054382 16:53816593-53816615 ATGAGAGAGTTCCAGGTTGAGGG - Intronic
1138271251 16:55697617-55697639 CTGAGTGAGTGTCAGGAGACAGG + Intronic
1138382287 16:56610996-56611018 CTGACTGTGTACCAGGGGGAGGG + Intergenic
1138467279 16:57201161-57201183 CGGTGTGGCTGCCAGGTGGAGGG + Intronic
1138467298 16:57201241-57201263 CGGTGTGGCTGCCAGGTGGAGGG + Intronic
1138653919 16:58479350-58479372 CTCAGTGAGCACCAGGAGGATGG - Intronic
1139503389 16:67386724-67386746 CAGAGAGAGAGACAGGTGGAAGG + Intergenic
1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG + Intergenic
1140264016 16:73404822-73404844 CTAAGTGTTTCCCAGGTGGAAGG + Intergenic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1140893529 16:79305513-79305535 CTGAGGGTCTGCAAGGTGGATGG + Intergenic
1141265753 16:82495458-82495480 GTGTGAGAGTGCCAGGGGGAGGG + Intergenic
1141641956 16:85346688-85346710 ATGAGTGATTGACAGGTAGATGG + Intergenic
1141805361 16:86338083-86338105 GTGAGTGACAGCCAGGTGAATGG - Intergenic
1142451562 16:90175666-90175688 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1142493448 17:293246-293268 CTGCATGAGTGGCAGGCGGAGGG - Intronic
1142785026 17:2214432-2214454 CAGAGTGAAGGCGAGGTGGACGG + Intronic
1142864499 17:2782416-2782438 CTGAGGGCGGGTCAGGTGGAGGG - Intronic
1144629869 17:16865547-16865569 CTGTCTGAATGCCAGGAGGAGGG - Intergenic
1144651561 17:17010570-17010592 CTGTCTGAATGCCAGGAGGAGGG + Intergenic
1146093469 17:29905655-29905677 CAGACAGAGTGCCAGGTGGAAGG + Intronic
1147699466 17:42383697-42383719 CTCAGTGAGATCCAGGAGGATGG - Intronic
1147726651 17:42569756-42569778 CTGAGTGTCTGCCATGTGTAAGG - Intronic
1148404276 17:47397843-47397865 CGGGGTGACTGCCGGGTGGAGGG - Intronic
1148487450 17:47999916-47999938 CTCAGTGGGTGGCAGGAGGATGG + Intergenic
1148666480 17:49378758-49378780 CTGAGGGACTCCCAGATGGAAGG + Intronic
1148670894 17:49409265-49409287 CTGGGAGGGTGCCAGGTGGCAGG - Intronic
1150281096 17:63930055-63930077 ATGGGTGTGTGCCAGGTGGCTGG - Exonic
1150343206 17:64385377-64385399 CTGAGTCATTTCCAGGTTGAGGG - Intronic
1150435094 17:65147483-65147505 CTGCCTGAGTGACAGGTGGCAGG + Intronic
1151208697 17:72527757-72527779 CTAATTGAGTGGCAGGAGGATGG - Intergenic
1151439666 17:74120027-74120049 CTGAGGGGGCTCCAGGTGGAGGG + Intergenic
1151657821 17:75503916-75503938 CTAAGCGAGTTCCAGCTGGAGGG - Exonic
1152302970 17:79506232-79506254 AGGAGGGAGTGCCAGGAGGAGGG + Intronic
1152700705 17:81817553-81817575 CTGAGTGAGTGCAGGGTGTCTGG - Intergenic
1156492978 18:37507231-37507253 CTGAGTGAGTGCTAGGAACAGGG + Intronic
1156816522 18:41317801-41317823 CTGTCTAAATGCCAGGTGGAAGG - Intergenic
1157575914 18:48742921-48742943 CTGAGTGATAGACTGGTGGAGGG - Intronic
1159643914 18:70894853-70894875 CTTACTGAGTGCCAGCTGGGAGG + Intergenic
1159995440 18:74960251-74960273 CTGAGTGAGTGCTTGGTGGAGGG + Intronic
1159995447 18:74960287-74960309 CTGAGTGAGTGCTTGGTGGAGGG + Intronic
1159995454 18:74960323-74960345 CTGAGTGAGTGCTTGGTGGAGGG + Intronic
1159995461 18:74960359-74960381 CTGAGTGAGTGCTTGGTGGAGGG + Intronic
1159995470 18:74960395-74960417 CTGAGTGAGGACTGGGTGGAGGG + Intronic
1159995478 18:74960431-74960453 CCGACTGAGTGCTTGGTGGAGGG + Intronic
1159995491 18:74960503-74960525 CTGAGTCAGTGCTTGGTGGAGGG + Intronic
1159995498 18:74960539-74960561 CTGAGTCAGTGCTTGGTGGAGGG + Intronic
1159995514 18:74960611-74960633 TTGAGTCAGTGCTGGGTGGAGGG + Intronic
1159995522 18:74960647-74960669 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1159995530 18:74960683-74960705 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1159995553 18:74960791-74960813 CTGAGTGAGTGCTTGGTGGAGGG + Intronic
1159995561 18:74960827-74960849 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1159995568 18:74960863-74960885 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1159995585 18:74960935-74960957 CTGAGTGAGGACTGGGTGGAGGG + Intronic
1159995593 18:74960971-74960993 CTGAGTGAGGACTGGGTGGAGGG + Intronic
1159995602 18:74961007-74961029 CTGAGTGAGGACTGGGTGGAGGG + Intronic
1159995611 18:74961043-74961065 CTGAGTGAGGACTGGGTGGAGGG + Intronic
1160182234 18:76645801-76645823 CTGGGTGGCTGCCGGGTGGAGGG - Intergenic
1160507057 18:79433047-79433069 CTGACTGAGGGCCAGGAGGAGGG - Intronic
1160645919 19:193382-193404 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
1161128584 19:2574395-2574417 ATGAGTGAGTGCCAGGGGCTGGG - Intronic
1161327009 19:3668840-3668862 CGGAGGGAGTTCCAGGCGGAGGG + Intronic
1162395021 19:10412909-10412931 CTGAGTCAGAGTCAGGGGGATGG - Intronic
1163258645 19:16173260-16173282 CTGTGTGAGTGTGGGGTGGAGGG - Intronic
1163561223 19:18020696-18020718 GAGACAGAGTGCCAGGTGGAAGG - Intergenic
1163592515 19:18202494-18202516 CTGGGTGGGTCCCAGCTGGAGGG - Exonic
1164541826 19:29127239-29127261 CTGAGTGCCTGTCTGGTGGAAGG - Intergenic
1165007708 19:32820028-32820050 CTCAGTGAGTGTGAGGAGGAAGG + Intronic
1165262693 19:34634466-34634488 CCGTGTGAGTGCCAGGTAGGTGG - Intronic
1165320087 19:35079883-35079905 CTGTGTGAGTGCAAGGAGGCTGG + Intergenic
1165323869 19:35102793-35102815 GTGAGTGAGGGGCAGGTGGGAGG - Intergenic
1165951259 19:39474983-39475005 GTGAGTGAGTTCCAAATGGAGGG + Intronic
1166005266 19:39902281-39902303 GTGAGTGCTTGCCAGGTGGCTGG - Exonic
1166091832 19:40514347-40514369 CTCAGTGGCTGCCATGTGGAGGG + Intronic
1166204449 19:41259910-41259932 GAGAGGGAGTACCAGGTGGAGGG - Exonic
1167037985 19:47005443-47005465 CTGGGTGAGTTCCAGGGGCAGGG + Intergenic
1167153375 19:47722957-47722979 CTGAGTGAGCTCTAGCTGGAGGG + Intronic
1167260233 19:48454092-48454114 CAGAGTGAGTTCCAGATGGAAGG - Exonic
1167539205 19:50074603-50074625 ATGAGTGAATGACAGGAGGAGGG - Intergenic
1167630502 19:50623255-50623277 ATGAGTGAATGACAGGAGGAGGG + Intronic
1168095049 19:54109795-54109817 CTGAGGGAGGGCCGGGTGGAGGG - Intronic
1168097060 19:54121940-54121962 CTGAGTGAGTGCTGGGGGGCAGG + Exonic
1168136450 19:54355435-54355457 GTGAGGGAGTGCCTGGTGGAGGG + Intronic
925424319 2:3736099-3736121 TTAAATGAGTGCCAGGTGGAGGG + Intronic
925675308 2:6356074-6356096 CTGATTGAGGGCCTGGGGGAAGG + Intergenic
926204721 2:10828014-10828036 CTGTGTGTGTGGCAGGGGGAGGG - Intronic
926497629 2:13611152-13611174 ATTAGTGATTGCCAGGTGGCAGG + Intergenic
926871429 2:17422206-17422228 CTGAGTCAGTTCCTGGTTGAGGG + Intergenic
926924518 2:17973640-17973662 CTGAGGGAGCTCCAGGTAGATGG + Intronic
927087246 2:19684656-19684678 CAGAGAGAGGGCCAGGTGGGTGG - Intergenic
928105765 2:28469660-28469682 CTGAGTAAGTCCCTGGGGGAAGG + Intronic
928823118 2:35387186-35387208 CAGAGTGAGAGCCAAGTGAAGGG + Intergenic
928856854 2:35812998-35813020 CAGAGTTAGGGCCTGGTGGAAGG + Intergenic
930819349 2:55629847-55629869 GGGAGTGAGTGGCAAGTGGAGGG - Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934994556 2:98945552-98945574 CTGACTGAGTCCCAGGTGGGAGG + Intergenic
935418137 2:102840215-102840237 ATGAGGGAGTGGGAGGTGGAGGG + Intronic
935560959 2:104559448-104559470 CTGTGTGAGTGCCGGGTTGTGGG + Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936061603 2:109298593-109298615 CTCAGGGAGTGCCAGCTGAAAGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937920394 2:127124808-127124830 GTGAGTGGTTGCCAGGTGAAGGG - Intergenic
938112039 2:128574442-128574464 GTGAGTGAATGCTTGGTGGAAGG + Intergenic
939235387 2:139485640-139485662 GGGAGTGAGTACCAGGAGGAAGG - Intergenic
939837609 2:147150066-147150088 CGGAGTGAGTGCCAGGAGTGGGG - Intergenic
940195033 2:151084538-151084560 CTGAATGTGTACCAGGTGCAAGG + Intergenic
942782800 2:179665958-179665980 GTGAGTGATTGCCAGCTGGGAGG + Intronic
946400765 2:219467248-219467270 CTGTTTGAGTGCCTGGTGGCGGG + Exonic
948189278 2:236045662-236045684 CTGAGTCCGTGCCAGGAGGCTGG + Intronic
948456313 2:238106189-238106211 CTGACTGCGTGCCAGGTGCGGGG - Intronic
948497315 2:238360043-238360065 CTAAGTGACTAACAGGTGGATGG + Intronic
949082945 2:242119972-242119994 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1169653288 20:7893622-7893644 CTGAGTCAGTTCCTGGTTGAAGG - Intronic
1170538407 20:17364517-17364539 GAGAGTGAGAGCCAGGTGAAAGG + Intronic
1172477370 20:35248956-35248978 CTCAGAGAGTGGCAGGTGGATGG + Intronic
1172820037 20:37724500-37724522 CTGAGTGATTCAAAGGTGGAGGG + Intronic
1172941657 20:38658574-38658596 GTGAGTGGGTGAGAGGTGGAAGG + Intergenic
1173082550 20:39882738-39882760 CTTAGGGAGTTCCAGGTGGATGG + Intergenic
1174719106 20:52792248-52792270 CTGTATGAGTGCCAGGTCCAAGG - Intergenic
1176279586 20:64292834-64292856 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1176617445 21:9035981-9036003 CTGTGTGGGTGCCAGGTCCAAGG + Intergenic
1176622080 21:9067463-9067485 CTGAGTTAGTCCCACGTGAAAGG + Intergenic
1177627352 21:23680031-23680053 CAGAGTGAGTGCCCTGAGGAAGG - Intergenic
1178894545 21:36548119-36548141 CAGAGGGTGTGCCTGGTGGAAGG - Intronic
1179905919 21:44423344-44423366 CTGAGGGAGGGCCAGGTGACAGG - Intronic
1181036131 22:20170507-20170529 GTGAGTGAGTGCAAGAGGGAAGG + Intergenic
1181889138 22:26046357-26046379 CTGAGTTAGTGCAAGTTAGAAGG - Intergenic
1182300836 22:29335976-29335998 CTGAGAGAGGGCCAGGGGAAAGG - Intronic
1182655819 22:31888980-31889002 GGGAGTGAGTGCCATGTTGAGGG - Intronic
1182797658 22:33003014-33003036 ATGAATGAGTGCCAAGTGAAGGG - Intronic
1182797964 22:33005032-33005054 ATGAATGAGTGCCAGGTGAAGGG - Intronic
1183085041 22:35481480-35481502 CTGAATGAGTGCAAAGTGCAGGG - Intergenic
1184642137 22:45878374-45878396 CGGAGTGGGTCCCAGGTGGCAGG + Intergenic
952400005 3:32954587-32954609 CTGAGCCAGTGTCAGGAGGAAGG + Exonic
952504666 3:33996859-33996881 GAGAATGAGTGCCAGGTGAAGGG + Intergenic
952994813 3:38869183-38869205 AAGAGTGAGTGACAGGTGGGTGG - Intronic
955113875 3:55976980-55977002 CTGTGTGAGAACAAGGTGGAAGG - Intronic
956353560 3:68365756-68365778 GAGAATGAGTGCCAGGTGAAAGG + Intronic
957216366 3:77324994-77325016 CAGAGTAAGTGCCAAGTGGAAGG + Intronic
957555239 3:81758518-81758540 TTGAGTGACTGCCATGAGGAGGG + Intronic
959073564 3:101726052-101726074 CTTATTGAGTGCCCGGTGGCAGG + Intronic
959664171 3:108903162-108903184 CTGAGTGCTTTCCAGGTGCATGG - Intergenic
959817502 3:110692009-110692031 CTGTGGGAGAGTCAGGTGGAAGG + Intergenic
961336277 3:126181400-126181422 CAGAGAGAGGGCCAGGTGGTCGG - Intronic
962745640 3:138395809-138395831 CTGAGTGCCTGCTAGGTGGCAGG - Intronic
964612877 3:158632439-158632461 TTGAGTGAGGGGCAGGGGGAGGG + Intergenic
965698954 3:171439838-171439860 TTGAGTGAGGGCCAGGTGGGTGG - Intronic
966256026 3:177917603-177917625 CTGAGTGGGTGCCAGGAGTGGGG - Intergenic
967524238 3:190473374-190473396 CGGAGTGGCTGCCGGGTGGAGGG - Intergenic
967532778 3:190568182-190568204 TTGACTGTGTGCCAGGTGCAGGG + Intronic
967854636 3:194107364-194107386 GAGAATGAGTGCCAGGTGAAGGG - Intergenic
968371762 3:198226144-198226166 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
969102285 4:4778202-4778224 CTGAGTCACTGCCTGGAGGAAGG - Intergenic
969158714 4:5236244-5236266 CTGAGTGAGTGCCAGGTGGAAGG - Intronic
969561175 4:7949360-7949382 CTGAGTGCCTGCCAGGTGCCAGG - Intergenic
970305438 4:14726953-14726975 CTGAGTCATTGCCAGGTGCTAGG + Intergenic
970381678 4:15514328-15514350 TTGGTTTAGTGCCAGGTGGAAGG + Intronic
971258281 4:25032780-25032802 CTGAGTGAGAGCCTGGGGGCAGG + Intergenic
971305803 4:25480254-25480276 TAGGGTGAGTGCCAGGTAGATGG + Intergenic
975776214 4:77790076-77790098 ATGAGTGATTGCCAGGGGGAGGG - Intronic
978160192 4:105537624-105537646 CTGAGTAAGTGCAATTTGGATGG - Intergenic
978580875 4:110229912-110229934 CTGAGTGACTTACAGGTGGGAGG - Intergenic
979260448 4:118638622-118638644 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
979502924 4:121460834-121460856 CTGAGAGAGAGACAGGGGGAAGG + Intergenic
980895143 4:138854182-138854204 CTGGGTGGCTGCCGGGTGGAGGG - Intergenic
980973513 4:139588793-139588815 CTGAGAGACAGCCAGGTGCAAGG - Intronic
982252431 4:153420708-153420730 CTTTGTGAGGGCCAGGTGGGAGG + Intergenic
982357509 4:154487152-154487174 TTCAGGGAGTTCCAGGTGGAAGG + Intronic
983574576 4:169247331-169247353 CTGAGAGAGTGAATGGTGGACGG + Intronic
985109756 4:186536455-186536477 CAGAGGGAGCCCCAGGTGGACGG + Intronic
985809006 5:2069446-2069468 CAGAGTGAGTGTCAGCTGGAAGG - Intergenic
985894603 5:2740842-2740864 CTCAGTGCGTGCAAGGGGGACGG - Intergenic
986393162 5:7303683-7303705 CTGTGAAAGTGCCAGGTTGAAGG + Intergenic
986533081 5:8759482-8759504 CAGAGTGAGAGCCAAGTGAAAGG - Intergenic
986602069 5:9482460-9482482 CTGGGTGAGTGGAAGGTGGGAGG + Intronic
986753538 5:10812259-10812281 ATGAATGAGTTCCAGGGGGAAGG + Intergenic
987317777 5:16740186-16740208 CTGAGGGAGTGACAGCTGGGAGG + Intronic
988693678 5:33597552-33597574 CTGAGGCAGTGCGAGGTGGTGGG - Intronic
989261010 5:39420488-39420510 CTGAGTGAGTGTTACGTTGAAGG - Intronic
990208810 5:53459069-53459091 CTGAGTCAGTTCCTGGTGGGAGG - Intergenic
990498597 5:56372727-56372749 CTGGGTGGCTGCCGGGTGGAGGG - Intergenic
991444414 5:66683884-66683906 ATGCTTGGGTGCCAGGTGGATGG - Intronic
992442982 5:76812397-76812419 CGGGGTGACTGCCGGGTGGAAGG - Intergenic
993710182 5:91216682-91216704 ATGAGTGGCTGCCATGTGGAGGG - Intergenic
995321481 5:110839190-110839212 CTGGCTGCGTGCCAGGTGCATGG - Intergenic
997392012 5:133524826-133524848 CTGAGTGGGTGCCCAGTGGGTGG - Intronic
999093502 5:148958035-148958057 CTGGGACAGTGCCAGGTGAAAGG + Intronic
1000239915 5:159399752-159399774 CTAAGTGGGTGCCTGCTGGATGG + Intergenic
1002105702 5:176878577-176878599 CTGTGGGTGTGGCAGGTGGAGGG + Exonic
1002731003 5:181331690-181331712 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1002753532 6:142414-142436 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
1002941986 6:1725373-1725395 CTGACTGATTGCTAGATGGATGG - Intronic
1003507762 6:6753518-6753540 CTGAGGAACCGCCAGGTGGAAGG - Intergenic
1004017392 6:11744580-11744602 CTGAGATGGGGCCAGGTGGAAGG + Intronic
1004973109 6:20934364-20934386 CTGAGTGAGCTCCAGGTGCTGGG - Intronic
1006029950 6:31171203-31171225 CTGAGAGAGTGCCAGGGAGCGGG - Intronic
1006407476 6:33853557-33853579 CTGAGTGAGTGGTGGGTGCAGGG + Intergenic
1006430584 6:33993324-33993346 CTGAGTGAGTGGGAAGTGGAAGG + Intergenic
1007597693 6:43061579-43061601 CTGAGTGAGGCCCAGGTGAGAGG + Exonic
1007790249 6:44304571-44304593 CTGAGTGGGAGCCAAGGGGAGGG - Intronic
1008508485 6:52254065-52254087 TTGAGTGTGTGGCATGTGGAGGG - Intergenic
1009276434 6:61687413-61687435 CTGAGTGCCTGCCATGTGCATGG - Intronic
1009323679 6:62322995-62323017 GTGAGTGACTGTCAGTTGGAGGG + Intergenic
1011968821 6:93195843-93195865 CAGAATGAGTGCTAGGTGGCTGG + Intergenic
1012428677 6:99142089-99142111 CGGGGTGATTGCCAGGCGGAGGG - Intergenic
1013404992 6:109835225-109835247 TTGAGTGAGTGCCCTGAGGATGG + Intergenic
1013685384 6:112575314-112575336 TGGAGGGAGTGCCAGGTGTAGGG + Intergenic
1014645056 6:123962911-123962933 GTGGGTGAGTGGCAGGTGGCTGG - Intronic
1017820816 6:158048096-158048118 CTGAGCGTCTGCCAGGTGTAGGG + Intronic
1019742751 7:2682873-2682895 ATGGGGGTGTGCCAGGTGGAAGG - Intronic
1019944557 7:4316319-4316341 CTGAGTGAGTAGCAGGTGGTGGG - Intergenic
1020274905 7:6617918-6617940 CTGAGTGAGGGCCTGGGGCAGGG + Intronic
1021075767 7:16302690-16302712 CTAGGTGAGTGCCAGGTGTTGGG + Intronic
1021741200 7:23687260-23687282 TTGGGGGTGTGCCAGGTGGAAGG + Intronic
1022964145 7:35457235-35457257 AAGAGTGAGTGCCAAGTGAAAGG + Intergenic
1022972024 7:35527300-35527322 CTAAATGACTGCCAGGTGGGTGG + Intergenic
1023578723 7:41658274-41658296 CTGAGTAAGTACCAGGAGTAGGG - Intergenic
1023861455 7:44219793-44219815 CTGGGTGGGTTGCAGGTGGATGG - Intronic
1024076146 7:45818852-45818874 CTGAGTGACTGGCAGGTTGCCGG + Intergenic
1024230418 7:47359364-47359386 ATGAGTGAGTGCCAGGGGTTTGG + Intronic
1024647457 7:51382438-51382460 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
1025008208 7:55371917-55371939 GTGTGTGTGTGTCAGGTGGAAGG + Intronic
1025051291 7:55736933-55736955 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
1025128255 7:56362600-56362622 CTGAGTGACTGGCAGGTTGCCGG - Intergenic
1025176637 7:56805481-56805503 CTGAGTGACTGGCAGGTTGCTGG - Intergenic
1025695155 7:63770905-63770927 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1026864075 7:73811789-73811811 CTGTGCTAGTGGCAGGTGGAGGG - Intronic
1027233438 7:76284662-76284684 CTGAGTGGGTGCCAGGTGGAAGG - Intronic
1028136683 7:87230283-87230305 CAGAGAGGGTGCCAGGAGGAGGG - Intergenic
1028743879 7:94306313-94306335 CTGAGTAACTGGCAGGGGGAGGG - Intergenic
1028899554 7:96081652-96081674 CTCTGTGAGTGCCTGGTGGATGG + Intronic
1030288312 7:107848305-107848327 CGGGGTGGCTGCCAGGTGGAGGG - Intergenic
1030725706 7:112922748-112922770 CAGGGTGGCTGCCAGGTGGAGGG - Intronic
1031175667 7:118345777-118345799 TTGAGTGTGTGCTAGGTGTATGG - Intergenic
1031856688 7:126930909-126930931 GTATGTGAGTGCCAGATGGATGG - Intronic
1032052679 7:128658615-128658637 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033275092 7:139965808-139965830 TTGAGTGGGTGCCATGTGCAAGG - Intronic
1034285296 7:149879979-149880001 CTGAGGGAGGTCCAGGTGGCAGG - Exonic
1034438247 7:151073958-151073980 CTCAGTGAGTGTCGGGTGGAAGG - Intronic
1034965525 7:155388509-155388531 CGGAGAGTGTGCCAGGTGGTAGG + Intronic
1035052184 7:156005296-156005318 CTGAGGGAGCCCCAGGTGGAGGG + Intergenic
1035177519 7:157062370-157062392 CTGCCTGGGTGCCAAGTGGAAGG + Intergenic
1035683397 8:1506062-1506084 CTATGTGCCTGCCAGGTGGAAGG - Intronic
1036915537 8:12800052-12800074 CAGAGTGGGTGCCAGGAGCAGGG + Intergenic
1036986753 8:13540751-13540773 ATGAGTGATTGCCATGTCGAAGG - Intergenic
1038720248 8:30028539-30028561 ATGTTTGGGTGCCAGGTGGAGGG + Intergenic
1038862847 8:31406378-31406400 CTGAGTGAGTAACAGGTGTGGGG + Intergenic
1038951588 8:32420946-32420968 CAGAGTGAGTGCCAAGTGAAGGG - Intronic
1039122444 8:34162503-34162525 CTGCATGAGTGGCAGATGGAAGG + Intergenic
1042400681 8:68342702-68342724 CTAAGTGACTGACAGGTGGGTGG - Intronic
1042687942 8:71462377-71462399 CGGAGTGGGTGCCAGGAAGAGGG + Intronic
1043267036 8:78279336-78279358 CAGAGGAAGTGCCAGCTGGAGGG + Intergenic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1044609892 8:94080795-94080817 GCCAGTGAGTGACAGGTGGAGGG + Intergenic
1045653436 8:104364060-104364082 CAGCGTGGGTTCCAGGTGGACGG - Intronic
1047297779 8:123586604-123586626 CTGAGGGAGTGACATCTGGATGG - Intergenic
1048503327 8:134998216-134998238 GTGCGTTAGTACCAGGTGGAAGG + Intergenic
1048779731 8:137987949-137987971 ATGAGGCACTGCCAGGTGGATGG + Intergenic
1049354228 8:142179723-142179745 CTGAATGAGTGCCAGGGCCATGG + Intergenic
1049378094 8:142298533-142298555 CTGAGTGAGCGCCAGGAGGCTGG + Intronic
1049532641 8:143162137-143162159 CTGTGTGGGTGCCAAGTGGAGGG - Intergenic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1049718819 8:144106238-144106260 CTGGGTGAGGGTCAGGTGGAGGG + Exonic
1051877374 9:21806517-21806539 CAGAGTGGGTGGCAGGTTGAGGG + Intronic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1053450600 9:38191334-38191356 CTTAGTGAGTCCAAGATGGAGGG + Intergenic
1054349880 9:64012060-64012082 CTGTGTGGGTGCCAGGTCCAAGG + Intergenic
1056149085 9:83766176-83766198 GAGAATGAGTGCCAGGTGAAGGG - Intronic
1057875334 9:98749293-98749315 CTGAGGCAGTGCCATGGGGAGGG - Intronic
1058070078 9:100592710-100592732 CTAAGTGAGGACCAAGTGGAAGG + Intergenic
1058267307 9:102918696-102918718 CTGGGTGAGTGACAGCTGAATGG - Intergenic
1060345100 9:122809017-122809039 CTTTGGGAGTCCCAGGTGGAAGG + Intronic
1062214160 9:135380041-135380063 CTGTGTCAGTGCCAGGTGGCAGG + Intergenic
1062708729 9:137960190-137960212 CTGAGTGAGGGGGAGGGGGAGGG + Intronic
1062755408 9:138284197-138284219 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1203579322 Un_KI270745v1:28369-28391 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1185689207 X:2139442-2139464 ATGGGTGAATGGCAGGTGGATGG - Intergenic
1186614109 X:11168873-11168895 TTGAGTGCCTGCCAGATGGAGGG + Intronic
1187247632 X:17567338-17567360 GTGAGTGGGTGCCAGGAGGCTGG - Intronic
1187281205 X:17860047-17860069 CTGAGTGAGTGCCATGGTGTGGG + Intronic
1187774826 X:22744634-22744656 CTGAGTGCTTGCCATGTGTAAGG + Intergenic
1191044427 X:56120650-56120672 GTGAGTGAGTGGCAGCAGGAAGG - Intergenic
1191747859 X:64509692-64509714 CTCAGTCAGTGCCAGATGTAGGG + Intergenic
1192222503 X:69207043-69207065 CTGAGTGAGGGCCAGGGTGAGGG + Intergenic
1192352871 X:70371767-70371789 CGGGGTGGCTGCCAGGTGGAGGG + Intronic
1194239329 X:91424125-91424147 GAGAATGAGTGCCAAGTGGAGGG - Intergenic
1194681698 X:96861919-96861941 CGGAGAGTGTTCCAGGTGGAGGG - Intronic
1195318840 X:103704842-103704864 CAGAGGCAATGCCAGGTGGAAGG - Intergenic
1196123433 X:112074781-112074803 CTCAGTGTGCACCAGGTGGAAGG - Intronic
1199259032 X:145749184-145749206 CAGAGTGAGTGCCAAGCGAAGGG + Intergenic
1200203051 X:154295706-154295728 CGGAGGGAGCGGCAGGTGGAGGG + Exonic
1201150841 Y:11094818-11094840 CTGTGTGGGTGCCAGGTCCAGGG + Intergenic
1201922460 Y:19248363-19248385 GAGAGTGAGGGCCAGGGGGAGGG + Intergenic
1202381928 Y:24280991-24281013 CTGAGTGACTGGCAGGTTGCTGG + Intergenic
1202488856 Y:25389134-25389156 CTGAGTGACTGGCAGGTTGCTGG - Intergenic