ID: 969159544

View in Genome Browser
Species Human (GRCh38)
Location 4:5244243-5244265
Sequence CAATTTCAGAGCCTGTTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969159539_969159544 22 Left 969159539 4:5244198-5244220 CCATCTGGTCCTGGACTTTTTTT 0: 3205
1: 6922
2: 3398
3: 2434
4: 2909
Right 969159544 4:5244243-5244265 CAATTTCAGAGCCTGTTTATTGG No data
969159542_969159544 13 Left 969159542 4:5244207-5244229 CCTGGACTTTTTTTGGTTGGTAA 0: 1531
1: 5988
2: 3192
3: 2162
4: 1700
Right 969159544 4:5244243-5244265 CAATTTCAGAGCCTGTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969159544 Original CRISPR CAATTTCAGAGCCTGTTTAT TGG Intronic
No off target data available for this crispr