ID: 969160561

View in Genome Browser
Species Human (GRCh38)
Location 4:5254078-5254100
Sequence CTACAAAAAAAGATTCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1604
Summary {0: 1, 1: 0, 2: 5, 3: 160, 4: 1438}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969160561_969160564 24 Left 969160561 4:5254078-5254100 CCCAGCTGAATCTTTTTTTGTAG 0: 1
1: 0
2: 5
3: 160
4: 1438
Right 969160564 4:5254125-5254147 TTTTTGCCTATGTTAGCTTTCGG 0: 1
1: 0
2: 3
3: 69
4: 631
969160561_969160565 29 Left 969160561 4:5254078-5254100 CCCAGCTGAATCTTTTTTTGTAG 0: 1
1: 0
2: 5
3: 160
4: 1438
Right 969160565 4:5254130-5254152 GCCTATGTTAGCTTTCGGTAAGG 0: 1
1: 0
2: 0
3: 1
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969160561 Original CRISPR CTACAAAAAAAGATTCAGCT GGG (reversed) Intronic
900252745 1:1679669-1679691 GTACAAAAAAAAAATCAGCCGGG + Intronic
901010908 1:6201563-6201585 AAACAAAAAAACATGCAGCTGGG - Intronic
901043625 1:6381975-6381997 ATACAAAAAAAAAATTAGCTGGG + Intronic
901054464 1:6442411-6442433 ATACAAAAAAAAATTTAGCCAGG + Intronic
901062418 1:6478039-6478061 ATACAAAAAAAAAATTAGCTGGG - Intronic
901074162 1:6542456-6542478 CTCAAAAAAAAAATTCAGCTGGG - Intronic
901091415 1:6644119-6644141 ATAAAAAAAAAAATTCAGCCAGG - Intronic
901095853 1:6678811-6678833 CTACAAAAAATAAATTAGCTGGG - Intronic
901109009 1:6780617-6780639 CTAAAAATAAAAATTTAGCTGGG - Intergenic
901332564 1:8422899-8422921 CCACAAAAAAAGTCTCGGCTAGG + Intronic
901694545 1:10997084-10997106 ATACAAAAAAAAAATTAGCTGGG + Intergenic
902266974 1:15274449-15274471 ATACAAAAAAAAAATTAGCTGGG + Intronic
902644250 1:17787422-17787444 ATACAGAAAAAAATTTAGCTGGG - Intronic
903208774 1:21803260-21803282 ATACAAAAAAAAAATTAGCTGGG + Intergenic
903247779 1:22028811-22028833 CTACAAAAAAAAAATTATCTGGG - Intergenic
903424100 1:23240548-23240570 ATACAAAAAAAAATTTAGCCGGG + Intergenic
903505870 1:23835444-23835466 ATACAAAAAAAAAATTAGCTGGG - Intronic
903551576 1:24160886-24160908 CTACAAAAAAAAAAAAAGCTGGG - Intronic
903932479 1:26871097-26871119 CTAAAAAAAAAAAATTAGCTGGG - Intergenic
904026341 1:27505918-27505940 CTACAAAAAATAAATTAGCTGGG + Intergenic
904220515 1:28964438-28964460 CTAAAAAAAAAAAATTAGCTGGG + Intronic
904231584 1:29078587-29078609 CTACCAAAAAAAAATTAGCTGGG + Intronic
904546445 1:31277034-31277056 CAAAAAAAAAAAATTTAGCTGGG + Intronic
904665601 1:32118629-32118651 CTACAAAAAAAAAATTAGTTGGG + Intronic
904682378 1:32238423-32238445 ATACAAAAAAAAAATTAGCTGGG + Intergenic
904687643 1:32272422-32272444 CTACAAAAAAATAATCAGCTGGG + Intronic
904729096 1:32574936-32574958 CTACAAAATAAAAATTAGCTTGG - Intronic
905067619 1:35196688-35196710 ATACAAAAAAAAAATTAGCTGGG - Intergenic
905120008 1:35674554-35674576 ATACAAAAAAAAATTTAGCTGGG + Intergenic
905136710 1:35806075-35806097 ATACAAAAAAAAATTTAGCCGGG + Intergenic
905374506 1:37510236-37510258 ATACAAAAAAAGAATTAGCTGGG - Intronic
905562437 1:38938176-38938198 CTAAAAAAAAAAAATTAGCTGGG - Intronic
905599539 1:39237707-39237729 AAAAAAAAAAAGAATCAGCTGGG - Intronic
905722354 1:40216325-40216347 ATACAAAAAACAAATCAGCTGGG + Intronic
905810658 1:40910582-40910604 ATACAAAAAAAAAATTAGCTGGG + Intergenic
906085243 1:43127392-43127414 ATACAAAAAAAAAATTAGCTGGG + Intergenic
906152424 1:43595375-43595397 TTACAAAAAAAAAATTAGCTGGG - Intronic
906406861 1:45549173-45549195 AAAAAAAAAAAAATTCAGCTAGG - Intergenic
906426010 1:45713263-45713285 AGAAAAAAAAAAATTCAGCTGGG + Intronic
906453226 1:45970505-45970527 ATACAAAAAAAAAATTAGCTGGG + Intronic
906817460 1:48893522-48893544 ATACAAAAAAAAAATTAGCTGGG + Intronic
907015531 1:51009053-51009075 CTAGAAAAAAAGATAAAGCCGGG + Intergenic
907071586 1:51540491-51540513 CTAAAAAAAAAAAATTAGCTGGG + Intergenic
907164548 1:52398740-52398762 ATACAAAAAAATAATTAGCTGGG - Intronic
907366576 1:53965630-53965652 ATACAAAAAAAAAATTAGCTGGG - Intronic
907506369 1:54921496-54921518 ATACAAAAAAAAAATTAGCTGGG - Intergenic
907561019 1:55387736-55387758 ATACAAAAAAAAAATTAGCTGGG - Intergenic
908035128 1:60043540-60043562 ATACAAAAAAAAATTTAGCTGGG - Intronic
908192334 1:61715960-61715982 ATACAAAAAAAAAATTAGCTGGG - Intronic
908242894 1:62202842-62202864 CTACAAATACAGATTTAGCTGGG - Intronic
908245311 1:62223232-62223254 ATACAAAAAAAAAATTAGCTGGG - Intergenic
908301314 1:62763016-62763038 ATACAAAAAAAAAATTAGCTGGG + Intergenic
908890187 1:68837693-68837715 CTACAAAGGCAGATTGAGCTTGG - Intergenic
909020256 1:70423274-70423296 TAATAAAAAAAGAATCAGCTGGG + Intronic
909452939 1:75818921-75818943 ATACAAAAAAAAAATTAGCTGGG - Intronic
910301566 1:85712339-85712361 ATACCAAAAAAAATTTAGCTGGG - Intergenic
911548749 1:99254091-99254113 CTACAAAAAAAAAATTAGCCAGG + Intergenic
912409780 1:109472770-109472792 CTACAAACAAAAAATTAGCTGGG - Intronic
912689385 1:111793028-111793050 CTACAAAAAGTAAATCAGCTGGG - Intronic
913003285 1:114603298-114603320 CTAAAAATAAAAAATCAGCTGGG - Intronic
913128853 1:115818746-115818768 CTAAAAATAAAAAATCAGCTGGG + Intergenic
913562903 1:120040878-120040900 ATACAAAAAAAAAATTAGCTGGG + Intronic
913635220 1:120752729-120752751 GTACAAAAAAAAAATTAGCTGGG - Intergenic
914283501 1:146200260-146200282 GTACAAAAAAAAAATTAGCTGGG + Intronic
914544531 1:148650980-148651002 GTACAAAAAAAAAATTAGCTGGG + Intronic
914622100 1:149420025-149420047 GTACAAAAAAAAAATTAGCTGGG - Intergenic
914721120 1:150289805-150289827 CAAAAAAAAAAAATTAAGCTGGG + Intergenic
914793650 1:150901755-150901777 ATACAAAAAAAAAATTAGCTGGG + Intergenic
914826549 1:151141705-151141727 TTAAAAAAAAAAAGTCAGCTGGG - Intronic
914849367 1:151302736-151302758 ATACAAAAAAAAAATTAGCTGGG - Intronic
914862386 1:151397503-151397525 CAACAAAAAAAAAATTAGCTGGG + Intergenic
915195253 1:154184192-154184214 CTACAAAAAAAAAATTAGCCGGG - Intronic
915233392 1:154462966-154462988 CTACTAAAAAAGAATTAGCCGGG - Intronic
915404303 1:155647737-155647759 ATACAAAAAAAAATTTAGCCGGG + Intergenic
915494993 1:156275973-156275995 CTACAAAAAATAATTTAACTGGG - Intronic
915501034 1:156317867-156317889 ATACAAAAAAAAAGTTAGCTGGG - Intronic
915777137 1:158502058-158502080 ATACAAAAAAAAAATTAGCTGGG - Intergenic
915799860 1:158778855-158778877 ATACAAAAAAAAAATCAGCCGGG + Intergenic
916025343 1:160828590-160828612 ATACAAAAAAACAATTAGCTGGG + Intergenic
916126096 1:161572632-161572654 TTAGAAAAAAGGATTCAGGTGGG + Intergenic
916136014 1:161654473-161654495 TTAGAAAAAAGGATTCAGGTGGG + Intronic
916149545 1:161773292-161773314 ATACAAAAAAAAATTTAGCCAGG - Intronic
916551115 1:165850777-165850799 ATACAAAAAAAAAATTAGCTGGG - Intronic
917107312 1:171505538-171505560 CAACAAAAAAAAATTCAAATTGG - Intronic
917110129 1:171539160-171539182 CTAAAAATACAGAATCAGCTGGG - Intronic
917437415 1:175035369-175035391 ATACAAAAAAAAATTTAGCCGGG + Intergenic
917690898 1:177467737-177467759 CATCACAAAAAGATTTAGCTTGG - Intergenic
917772730 1:178297444-178297466 ATAAAAAAAAAAAATCAGCTGGG + Intronic
917841262 1:178981033-178981055 CTACAAAAAAATAATTAGCTGGG - Intergenic
918052788 1:180989333-180989355 ATACAAAAAAAAAATTAGCTGGG + Intronic
918337013 1:183526307-183526329 ATACAAAAAAAAAATCAGCCGGG - Intronic
918772221 1:188575713-188575735 ATACAAAAAAAAATTTAGCTGGG - Intergenic
918851413 1:189695360-189695382 ATAGAAAAATAGATTTAGCTAGG - Intergenic
919054782 1:192556362-192556384 TTAGAAAAAAAGATTGAGCATGG + Intergenic
919230820 1:194771691-194771713 CTACAAAAACAAAATTAGCTGGG - Intergenic
919295068 1:195688070-195688092 ATACAAAAAAAAAATTAGCTGGG - Intergenic
920112423 1:203596463-203596485 ATACAAAAAAATAATTAGCTGGG + Intergenic
920175633 1:204099975-204099997 CTATAAAAAATGAATTAGCTGGG + Intronic
920203308 1:204274092-204274114 CTAAAAAAAAAAAATTAGCTAGG - Intronic
920238006 1:204522165-204522187 CTACAAAAAATAAATTAGCTGGG + Intronic
920326361 1:205167943-205167965 ATACAAAAAAAAATTTAGCCGGG + Intronic
920354344 1:205359405-205359427 ATACAAAAAAAAAATTAGCTGGG + Intergenic
920355095 1:205366060-205366082 CTACAACAGGAGAGTCAGCTAGG - Intergenic
920409865 1:205750494-205750516 CTAGAAAAAAAGATTTATGTAGG + Intergenic
920846798 1:209600280-209600302 CAAAAAAAAAAAAATCAGCTAGG - Intronic
920992029 1:210948670-210948692 ATACAAAAAAAAATTTAGCCAGG + Intronic
921173939 1:212576886-212576908 ATACAAAAAAAAAATCAGCCGGG - Intronic
921240629 1:213178036-213178058 CTACAAAAAAAGAAAAAGCTGGG + Intronic
921621014 1:217326257-217326279 CTAGAAAAACAGTTTCAACTTGG + Intergenic
921750799 1:218791318-218791340 CTACAAAAAAAGTTTCAACTGGG + Intergenic
921784226 1:219208374-219208396 TTACACAAAGACATTCAGCTTGG + Intronic
921973581 1:221177254-221177276 CAACAAAAAAAAAATTAGCTGGG - Intergenic
922449536 1:225725664-225725686 ATACAAAAAAAAAATTAGCTGGG + Intergenic
922664852 1:227459944-227459966 CTACAAAAACAAATTTAGCCAGG + Intergenic
922918154 1:229275779-229275801 ATACAAAAAAAAAATTAGCTAGG - Intronic
923191217 1:231622638-231622660 CTACAAAAAAAAAATTAGCTGGG - Intronic
923275493 1:232391917-232391939 ATACAAAAGAAAATTTAGCTGGG + Intergenic
923543381 1:234906231-234906253 ATACAAAAAAAAATTTAGCTGGG - Intergenic
923575598 1:235156029-235156051 CTAAAAAAAAAAAATTAGCTGGG - Intronic
923578816 1:235187377-235187399 CTATAAAACAAGAATAAGCTGGG - Intronic
923635734 1:235694168-235694190 ATACAAAAAAAAAATCAGCCGGG - Intronic
923672267 1:236050920-236050942 ATACAAAAAAAAAATTAGCTGGG + Intronic
923969869 1:239188322-239188344 TTACAAAAAAAAAATTAGCTGGG + Intergenic
924000394 1:239544172-239544194 CTACAAAAAAACAGCCAGCTTGG - Intronic
924267733 1:242300281-242300303 ATACAAAAAAAAAATTAGCTGGG + Intronic
1063240566 10:4165392-4165414 AAAAAAAAAAAAATTCAGCTTGG - Intergenic
1063413619 10:5855670-5855692 ATACAAAAAAATAATTAGCTAGG + Intergenic
1063471502 10:6290657-6290679 ATACAAAAAAAAAGTTAGCTGGG - Intergenic
1063572778 10:7231481-7231503 CTACACAAAGACATTAAGCTGGG + Intronic
1064013488 10:11755163-11755185 ATACCAAAAAAAATTTAGCTGGG + Intronic
1064028495 10:11868434-11868456 CTACAAAAAAAAATTTAGCCAGG - Intronic
1064137640 10:12764477-12764499 CTCCTAGAAAAGATTCATCTGGG - Intronic
1064174863 10:13066155-13066177 CTAAAAAAAAAAAATCACCTAGG - Intronic
1064232156 10:13538474-13538496 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1064539504 10:16391117-16391139 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1064651104 10:17510718-17510740 CTACAAAAAAAAAATCAGATGGG - Intergenic
1064912051 10:20413182-20413204 CTAAAAAAACAAAATCAGCTGGG - Intergenic
1065028946 10:21566108-21566130 ATACAAAAAAAAATTTAGCCAGG - Intronic
1065054364 10:21829189-21829211 CAACAACAAAAAAATCAGCTGGG - Intronic
1065215557 10:23444938-23444960 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1065216391 10:23452872-23452894 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1065243854 10:23737357-23737379 CTACTAAAAAAAAATTAGCTAGG - Intronic
1065289046 10:24211887-24211909 CTAGAAAAAAAAATTTAGCTAGG + Intronic
1065353752 10:24819049-24819071 CTACTAAAAAAAAATTAGCTGGG + Intergenic
1065359977 10:24880405-24880427 CAACAACAAAAAATTTAGCTGGG - Intronic
1065627938 10:27650381-27650403 CTATAAAAAAAAATAGAGCTGGG + Intergenic
1065677197 10:28189406-28189428 ATACAAAAAAAAAGTTAGCTGGG + Intronic
1065855041 10:29823240-29823262 ATACAAAAAAAAAGTTAGCTGGG - Intergenic
1066876392 10:40617038-40617060 CTCTAAAGAAAGGTTCAGCTCGG - Intergenic
1066911085 10:41300783-41300805 CTCTAAAGAAAGGTTCAGCTCGG - Intergenic
1066958361 10:42194800-42194822 GTACAAAAAAAAATTAATCTTGG - Intergenic
1067108332 10:43380488-43380510 CTACATAAAAAAAATTAGCTGGG - Intergenic
1067121456 10:43475352-43475374 CTACAAATAAACAATTAGCTGGG + Intronic
1067242861 10:44510804-44510826 CCAGAAAACAAGATGCAGCTAGG + Intergenic
1067902242 10:50254173-50254195 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1068531940 10:58198482-58198504 CAACAAAATAACATTCAGCTGGG - Intronic
1068692603 10:59932380-59932402 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1068880396 10:62042752-62042774 ATACAAAAAAAAAATTAGCTGGG + Intronic
1068900327 10:62261488-62261510 ATACAAAAAAAAAATCAGCTGGG + Intronic
1069129829 10:64684929-64684951 CTTCAAAAAAACATTCATATCGG + Intergenic
1069135199 10:64755104-64755126 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1069434742 10:68370835-68370857 CTAAAAAAAAAAGGTCAGCTGGG + Intronic
1069458233 10:68570788-68570810 ATACAAAAAAAAAATGAGCTGGG - Intronic
1069480418 10:68776711-68776733 CTACAAAAAATTAAACAGCTGGG - Intronic
1070036390 10:72729307-72729329 ATACAAAAAAAAATTTAGCCGGG + Intronic
1070088016 10:73255392-73255414 CTCAAAAAAAAAATTCAGCTGGG + Intronic
1070128847 10:73642785-73642807 ATACAAAAAAAAATTTAGCCGGG - Intergenic
1070909123 10:80102181-80102203 CTACAAAAAAAAATAAGGCTGGG + Intergenic
1070942781 10:80361066-80361088 CAAGAAAAAATAATTCAGCTGGG - Intronic
1071025688 10:81110177-81110199 CCACAAACAAAGTTTCAGTTTGG - Intergenic
1071356417 10:84800862-84800884 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1071574113 10:86713543-86713565 CTGCTAAAAAAGATTAAGATTGG - Intronic
1071587559 10:86839816-86839838 CTACAAAAAATAAATTAGCTGGG - Intronic
1071604549 10:86976078-86976100 CTACAAAAAAAAATTCCAGTAGG - Intronic
1071795333 10:88998858-88998880 TTACAAAAAAAAATTCGGCCGGG + Intronic
1071896364 10:90071578-90071600 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1071990827 10:91099349-91099371 CTACAAAAAAAATTTTAGCTGGG + Intergenic
1072046021 10:91655949-91655971 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1072055137 10:91747716-91747738 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1072180728 10:92976839-92976861 TTAAAAAAAAAGATACAGCAAGG + Intronic
1072508934 10:96098703-96098725 ATACAAAAAAAAATTTAGCCAGG + Intergenic
1072762360 10:98067229-98067251 CTAGAAAAAAATATGCTGCTGGG - Intergenic
1072841256 10:98776284-98776306 AAAAAAAAAAAAATTCAGCTGGG + Intronic
1072917056 10:99544200-99544222 CTTTAAAAAATAATTCAGCTTGG - Intergenic
1072981003 10:100097491-100097513 CTACTAAAAAAAAATTAGCTGGG + Intergenic
1073091795 10:100947367-100947389 AAATAAAAAAATATTCAGCTTGG - Intronic
1073092305 10:100952384-100952406 ATACAAAAAAAAAATTAGCTGGG + Intronic
1073370729 10:102986617-102986639 CTTAAAAAAAAAAGTCAGCTGGG + Intronic
1073408447 10:103319306-103319328 ATACAAAAAAAAAATTAGCTGGG - Intronic
1073409278 10:103326226-103326248 ATACAAAAAAAAAATCAGCCGGG + Intronic
1073460811 10:103664825-103664847 ATACAAAAAAAAATTTAGCCAGG - Intronic
1073503215 10:103961612-103961634 CTACAAAAATAAAATTAGCTGGG - Intergenic
1073663855 10:105508265-105508287 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1073681003 10:105703329-105703351 CTACAAAAATAAAATTAGCTAGG + Intergenic
1073781490 10:106843590-106843612 ATACAAAAACAGAATAAGCTGGG - Intronic
1074009201 10:109459211-109459233 ATACAAAAAAAAATTTAGCTGGG - Intergenic
1074367352 10:112869895-112869917 ATACAAAAAAAGAATTAGCAGGG + Intergenic
1074692231 10:116016535-116016557 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1075121052 10:119665295-119665317 ATACAAAAAAAAAATTAGCTGGG - Intronic
1075123038 10:119678280-119678302 CTACAAAAAACAAATCAGCCAGG + Intergenic
1075371997 10:121945168-121945190 CTACAAAAAAAAATTTAGGCCGG - Intergenic
1075538384 10:123291208-123291230 CAATAAAAAAAGAATCAGCTTGG - Intergenic
1076101673 10:127785290-127785312 CTACAAAAAATAGTTCAGCATGG - Intergenic
1076551066 10:131278496-131278518 ATACAAAAAAAAAATTAGCTGGG - Intronic
1076589371 10:131572846-131572868 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1076982790 11:213784-213806 ATACAAAAAAAAAGTTAGCTGGG + Intronic
1077804690 11:5578824-5578846 ATACAAAAAAAAAATTAGCTGGG + Intronic
1078548760 11:12265949-12265971 CTACTAAAAAAAAATTAGCTGGG + Intergenic
1079029917 11:16979014-16979036 CAACAACAAAAGAATCAGGTTGG - Intronic
1079205243 11:18409219-18409241 CTACAAAAAAGAAATTAGCTAGG + Intergenic
1079488231 11:20958251-20958273 CTCCAAAAAAAAAATTAGCTGGG + Intronic
1079528764 11:21423207-21423229 ATACAAAAAAAAAATTAGCTGGG + Intronic
1080045955 11:27808298-27808320 CAACAAAAAAACATGCAGGTTGG - Intergenic
1080850780 11:36067821-36067843 ATACAAAAAAAAATTTAGCCAGG - Intronic
1081101186 11:39004827-39004849 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1081188356 11:40073066-40073088 CTACTAAAAAAAAATCAGCCAGG - Intergenic
1081495804 11:43609087-43609109 ATACAAAAAAAAAATCAACTGGG - Intronic
1081829387 11:46094737-46094759 ATACAAAAAAAAAATTAGCTGGG + Intronic
1082014357 11:47473334-47473356 CTAAAAACAGAGATTCATCTGGG + Intronic
1082039251 11:47671357-47671379 ATACAAAAAAAAAATTAGCTGGG + Intronic
1082100106 11:48166019-48166041 ATACAAAAAAAAAATTAGCTGGG - Intronic
1082315683 11:50716787-50716809 CTAAAAAGAAAGGTTCAACTCGG + Intergenic
1082624595 11:55467603-55467625 GTATAAAAAAGGATTCAGCATGG - Intergenic
1082948924 11:58789565-58789587 TTAAAATAAAAGTTTCAGCTGGG + Intergenic
1083081334 11:60096724-60096746 ATACAAAAAAAAAATTAGCTGGG + Intronic
1083449288 11:62731840-62731862 ATACAAAAAAAAAATTAGCTGGG - Intronic
1083461796 11:62818399-62818421 ATACAAAAAAAAAATTAGCTGGG + Intronic
1083702395 11:64488116-64488138 ATACAAAAACAAAATCAGCTGGG - Intergenic
1083833123 11:65246111-65246133 CTGCTAAAAAAAATTTAGCTGGG + Intergenic
1084058680 11:66654983-66655005 CTCAAAAAAAAAATTTAGCTGGG - Intronic
1084132597 11:67148258-67148280 TTAAAAAAAAAAATTTAGCTGGG + Intronic
1084533306 11:69742146-69742168 ATACAAAAAAAATTTTAGCTGGG + Intergenic
1084865778 11:72055818-72055840 AAAAAAAAAAAAATTCAGCTGGG + Intronic
1084926854 11:72520777-72520799 ATACAAAAAAAAAATTAGCTAGG - Intergenic
1085105844 11:73842244-73842266 GTACAAAAATAGTATCAGCTAGG - Intronic
1085624729 11:78063354-78063376 AAACAAAAAAAAACTCAGCTAGG + Intronic
1085648376 11:78243681-78243703 ATACAAAAAAAAAATTAGCTGGG + Intronic
1085758992 11:79225632-79225654 CTACAAAAAAATAGCCAGCATGG - Intronic
1085837203 11:79969906-79969928 CTACAAAAATAACTTTAGCTTGG - Intergenic
1086243080 11:84720039-84720061 CTACAAGAGCAGATGCAGCTCGG - Intronic
1087051175 11:93887866-93887888 ATACAAAAACAAAATCAGCTGGG - Intergenic
1087361640 11:97167485-97167507 CTTGAAAAAAAAAGTCAGCTGGG - Intergenic
1087471798 11:98584771-98584793 ATACAAAAAAAAATTTAGCCGGG - Intergenic
1087679642 11:101205033-101205055 GTACAAAAAAATAATTAGCTGGG - Intergenic
1087825130 11:102756413-102756435 CTACAAAAAAAAAGTTACCTGGG - Intergenic
1088159893 11:106856084-106856106 ATACAAAAAAAAATTTAGCCAGG - Intronic
1088218858 11:107545374-107545396 CTAAAAAAACCCATTCAGCTAGG + Intronic
1088254859 11:107893836-107893858 CTAAAAATAAAGAATTAGCTGGG + Intronic
1088273539 11:108060191-108060213 TTAAAAAAAAAAATTAAGCTTGG + Intronic
1088339061 11:108742402-108742424 CTAAAAATAAAAAATCAGCTGGG + Intronic
1088485365 11:110335264-110335286 TTAAAAAAAAAAAATCAGCTGGG + Intergenic
1088744987 11:112797691-112797713 GTACAAAAAAGAATTCAGCGAGG + Intergenic
1088931971 11:114361423-114361445 ATACAAAAAAAAAATCAGCCAGG + Intergenic
1089230462 11:116970109-116970131 CTACAAAAAAAATTTCAAATTGG + Intronic
1089326298 11:117659877-117659899 ATACAAAAAAAAATTTAGCTAGG - Intronic
1089504041 11:118951579-118951601 CAACAAAAAAACAATGAGCTGGG - Intronic
1089509677 11:118988502-118988524 CTACAAAAAATAAATAAGCTGGG + Intergenic
1089584278 11:119500334-119500356 CTACAAGAAAAGATTTGGGTGGG - Intergenic
1089592947 11:119556479-119556501 ACAAAAAAAAAGATTAAGCTGGG + Intergenic
1089768809 11:120788024-120788046 ATACAAAAAAAAAATTAGCTGGG - Intronic
1090088545 11:123673015-123673037 CAACAAAAAAAGTTTTGGCTAGG - Intergenic
1090366027 11:126206394-126206416 ATACAAAAAAAAAATCAGCCAGG + Intronic
1090870692 11:130744206-130744228 CAACAAAAAAAAATTCACATGGG + Intergenic
1090870977 11:130747408-130747430 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1091156706 11:133381400-133381422 GTAGAAAGAAAAATTCAGCTTGG + Intronic
1091494080 12:957300-957322 ATACAAAAAAACAATTAGCTGGG + Intronic
1091725332 12:2842569-2842591 CTACAAAAAAAAATTCAGCCAGG + Intronic
1091870920 12:3890571-3890593 CAAAAAAAAAAAATTTAGCTGGG + Intergenic
1092019164 12:5186039-5186061 CCACAAAATGAGATTGAGCTTGG - Intergenic
1092186409 12:6482770-6482792 CTACAAAAAATAAATTAGCTGGG + Intergenic
1092346127 12:7715926-7715948 CTACAAAAAATTAATTAGCTGGG + Intronic
1092387869 12:8050129-8050151 ATACAAAAAAAAAATTAGCTGGG - Intronic
1092620523 12:10260643-10260665 ATACAAAAAAAAATTGGGCTGGG + Intergenic
1092647050 12:10586425-10586447 ATACAAAAAAAAATTTAGCTGGG + Intergenic
1092762330 12:11821203-11821225 ATACAAAAAAAAAATTAGCTGGG + Intronic
1093025965 12:14245767-14245789 CTACAAATAAAAAATTAGCTGGG + Intergenic
1093168818 12:15836332-15836354 ATACAAAAAAAAAATTAGCTGGG - Intronic
1093453485 12:19341114-19341136 ATACAAAAAAAGAGAGAGCTGGG + Intronic
1093725272 12:22500021-22500043 CTACAAAAAAATAATTAGCCAGG + Intronic
1093801568 12:23379713-23379735 CTAAAAAAAAAAAGTCAGCCGGG + Intergenic
1093941297 12:25057552-25057574 CTAAAAAAATACATGCAGCTGGG - Intronic
1094351776 12:29534148-29534170 CTACCAAAAAATGTTAAGCTAGG + Intronic
1094604883 12:31941470-31941492 CTACAAAAAAATACCCAGCCAGG - Intergenic
1094643709 12:32300803-32300825 CAAAAAAAAAAAATTTAGCTGGG - Intronic
1094651033 12:32376242-32376264 ATACAAAAAAAAAATTAGCTGGG - Intronic
1095265878 12:40156922-40156944 TTACTGAAAAAGATTCAACTGGG - Intergenic
1095434915 12:42176804-42176826 ATACAAAAAAAAATGTAGCTAGG + Intronic
1095633772 12:44407537-44407559 TTAAAAAAAAAAAATCAGCTGGG - Intergenic
1095744570 12:45643411-45643433 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1096108715 12:49015731-49015753 ATACAAAAAAAAACTTAGCTGGG - Intronic
1096128105 12:49134848-49134870 AAAAAAAAAAAGAATCAGCTGGG - Intergenic
1096206080 12:49722931-49722953 CTAAAAACAAAAAATCAGCTGGG + Intronic
1097056070 12:56250034-56250056 CTTCAAAAAAACAATTAGCTGGG + Intronic
1097109835 12:56650296-56650318 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1097259473 12:57708465-57708487 CTACAAAAAAATATTTAGCCAGG + Intronic
1097291907 12:57924142-57924164 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1097802664 12:63932118-63932140 ATACAAAAAAAAAATTAGCTGGG + Intronic
1097916578 12:65026730-65026752 CTACAAAATAAAAATTAGCTGGG - Intergenic
1097929277 12:65166847-65166869 CTACAAAAAAAAAATTAGCCAGG - Intergenic
1098025087 12:66193166-66193188 ATACAAAAAAAAATTAAGCCGGG - Intronic
1098198840 12:68033301-68033323 CTAAATAAAAAGTTTCAACTGGG + Intergenic
1098278351 12:68836430-68836452 ATAAAACAAAACATTCAGCTAGG - Intronic
1098278972 12:68843807-68843829 CAAAAAAAAGAGATTCTGCTTGG - Exonic
1098343990 12:69481433-69481455 CTTAAAAAAAAAAATCAGCTGGG - Intronic
1098741806 12:74181924-74181946 CTACAAGAAAAGATTCAGACAGG - Intergenic
1098822403 12:75249479-75249501 CCACAAAAAAAGATTGAGTTTGG - Intergenic
1098825425 12:75290759-75290781 ATAAAAAAAAAGATTTAGCCGGG + Intronic
1099194217 12:79595689-79595711 ATACAAAAAAAGAATTAGCCGGG + Intronic
1099216020 12:79854830-79854852 CAACAACAAAAAAATCAGCTGGG - Intronic
1099243861 12:80171232-80171254 ATACAAAAAAAAATTTAGATGGG - Intergenic
1099305170 12:80945142-80945164 CTAAATAAAAATATTCAGGTTGG - Intronic
1099333136 12:81317374-81317396 CTAAAAAATAAGATTTAGATAGG + Intronic
1099746833 12:86715467-86715489 ATACAGAAAAACATACAGCTTGG - Intronic
1099883724 12:88501088-88501110 CAACAAAAAAAGTTGCACCTAGG - Intronic
1100247788 12:92781069-92781091 TTAAAAAAAAAAATTTAGCTGGG - Intronic
1100259848 12:92922795-92922817 ATACAAAAAAAAAATTAGCTGGG + Intronic
1100379003 12:94044276-94044298 CTAGAAAATAACATTCAACTGGG + Intergenic
1100519450 12:95359270-95359292 CTACAAAAAAAAAATTAGCTGGG + Intergenic
1100524726 12:95408601-95408623 CAACAAAAAAAAATTTATCTGGG + Intergenic
1100547733 12:95619422-95619444 ATACAAAAAAAAAATGAGCTGGG - Intergenic
1100590703 12:96025664-96025686 CTACACAAAAAAAATTAGCTGGG + Intronic
1100728867 12:97441529-97441551 CTAAAAATAAAAAATCAGCTGGG + Intergenic
1100877612 12:98979426-98979448 ATACAAAAAAAAAATTAGCTGGG - Intronic
1100877978 12:98983169-98983191 CTAAAATCAAAGTTTCAGCTGGG + Intronic
1100967730 12:100031284-100031306 ATACAAAAAAAAAATGAGCTGGG + Intronic
1100992374 12:100265433-100265455 CAACACAAAAAAATTTAGCTGGG + Intronic
1101049001 12:100841490-100841512 CTACAAAGAAAGATGAAGCTGGG + Intronic
1101121952 12:101591232-101591254 CTATTAAAAAAGATTGAGTTAGG + Intronic
1101264500 12:103069207-103069229 CTACAAAAAAAAAATCAAATGGG - Intergenic
1101313585 12:103608297-103608319 ATACAAAAAAAAAATTAGCTAGG - Intronic
1101370704 12:104127405-104127427 CTACTAAAAAAAAATTAGCTGGG + Intronic
1101955682 12:109210751-109210773 CTAAAAAAAAAAAATTAGCTGGG + Intronic
1102114311 12:110390227-110390249 ATACAAAAAAAAAATTAGCTGGG - Intronic
1102114702 12:110394013-110394035 ATACAAAAAAAAAATTAGCTGGG + Intronic
1102195202 12:111020532-111020554 CTACCAAAAAAAAATTAGCTGGG + Intergenic
1102284786 12:111647103-111647125 CTACAAAAAAATTTTCAATTGGG + Intronic
1102478750 12:113206057-113206079 ATACAAAAAAAAAATTAGCTGGG + Intronic
1102929378 12:116850786-116850808 ATACAAAAAAAAAATTAGCTGGG - Exonic
1102944194 12:116971196-116971218 CTACAAAAAATGAACTAGCTGGG + Intronic
1103110669 12:118275297-118275319 CTACAAAAAATAAGTTAGCTGGG - Intronic
1103126815 12:118430558-118430580 CTACAGAAAAAAATACAGCATGG - Intergenic
1103153922 12:118667221-118667243 CTACTAAAAAATATTTAGCTGGG + Intergenic
1103176959 12:118872565-118872587 ATACAAAAAAAAACTTAGCTGGG - Intergenic
1103497877 12:121376784-121376806 CTATAAAATAAAATACAGCTGGG - Intronic
1103511936 12:121481084-121481106 ATACAAAAAAAAAATTAGCTGGG - Intronic
1103552340 12:121746795-121746817 ATACAAAAAAAAAATTAGCTGGG + Intronic
1103570978 12:121844718-121844740 ATACAAAAAAAAAATTAGCTGGG + Intronic
1103708108 12:122890490-122890512 CTACAAAAAATAAATTAGCTGGG - Intronic
1103765127 12:123274281-123274303 AAAAAAAAAAAGTTTCAGCTGGG + Intergenic
1103767006 12:123287477-123287499 CTACAAAAATAAAATTAGCTGGG - Intergenic
1103775188 12:123362139-123362161 CAAAAAAAAAAGATTCTGTTGGG + Intronic
1103781518 12:123402044-123402066 CTACAAAAAATAAATAAGCTAGG - Intronic
1103987222 12:124775665-124775687 CTACAAAAAAAAAATTAGCCAGG + Intergenic
1104000905 12:124859368-124859390 ATACAAAAAAAAAATTAGCTGGG + Intronic
1104181884 12:126389725-126389747 CTTCAAAAGAAAATTCAGCCTGG - Intergenic
1104221075 12:126785703-126785725 CTACCAAAAGAGTTTCAGCTGGG - Intergenic
1104691068 12:130826846-130826868 CAAAAAAAAAAGAATTAGCTGGG + Intronic
1105021594 12:132820176-132820198 CAAAAAAAAAAAAATCAGCTAGG + Intronic
1105025404 12:132845296-132845318 ATACAAAAAAAAAATTAGCTGGG + Intronic
1105028213 12:132863917-132863939 ATACAAAAAACAATTTAGCTGGG - Intronic
1105064420 12:133184260-133184282 ATACAAAAAAAAAATTAGCTGGG - Intronic
1105064742 12:133186532-133186554 ATACAAAAAAAAAATCAGCCAGG - Intronic
1105342133 13:19537392-19537414 CTAAAAATAAAAATTTAGCTGGG - Intergenic
1105375353 13:19839529-19839551 ATAGAAAAAAAAATTTAGCTGGG - Intronic
1105381606 13:19892430-19892452 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1105548381 13:21368703-21368725 CTACAGAAAAAAAATGAGCTGGG + Intergenic
1105617904 13:22037317-22037339 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1106001117 13:25724291-25724313 CTCCAGAGAAAGATTCAGCCTGG + Intronic
1106095607 13:26640560-26640582 ATACAAAAAAAAATTTAGCCAGG - Intronic
1106239585 13:27900249-27900271 CAAAAAAAAAAGAATTAGCTGGG - Intergenic
1106280305 13:28261666-28261688 CTACAAAAAATAAATTAGCTGGG + Intronic
1106289477 13:28347365-28347387 ATACAAAAAAAAAATTAGCTGGG + Intronic
1106547210 13:30741264-30741286 ATACAAAAAAAAAATTAGCTGGG - Intronic
1106673483 13:31932439-31932461 CTACAAATAAAAAATCAGCCAGG - Intergenic
1106676736 13:31967787-31967809 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1106929623 13:34650402-34650424 CTACAAAAACAAAATTAGCTGGG - Intergenic
1107290552 13:38848429-38848451 TAACAAAAAAATATTCAGTTGGG - Intronic
1107304113 13:38999900-38999922 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1107495246 13:40920014-40920036 ATACAAAAAAAGAATTAGCCAGG - Intergenic
1107712491 13:43164095-43164117 ATACAAAAAAAAAATCAGCTGGG - Intergenic
1108010143 13:45998486-45998508 ATACAAAAAAAAAATTAGCTGGG + Intronic
1108094534 13:46887260-46887282 ATACAAAAAAAAATTTAGCCGGG + Intronic
1108318245 13:49259684-49259706 CTACAAAAAATAAGTTAGCTAGG + Intronic
1108406507 13:50108467-50108489 ATACAAAAAAAAAATTAGCTGGG - Intronic
1108547228 13:51508086-51508108 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1108642842 13:52398428-52398450 CTACAAAAAGAAAATTAGCTGGG - Intronic
1109169866 13:59082070-59082092 ATACAAAAAAAAATTTAGCCGGG + Intergenic
1109291336 13:60478962-60478984 ATACAAAAAAAAAATCAGCTAGG - Intronic
1109340607 13:61053394-61053416 CTGCAAAAAATAAATCAGCTGGG - Intergenic
1109639197 13:65164884-65164906 ATACAAAAACAAAATCAGCTGGG + Intergenic
1109871372 13:68338339-68338361 TTACAAAAAAAGAATTAGCTGGG - Intergenic
1110022645 13:70494502-70494524 ATACAAAAAAAAATTTAGCTGGG - Intergenic
1110091237 13:71450595-71450617 ATGCTAAAAATGATTCAGCTTGG + Intronic
1110253369 13:73405231-73405253 CTACAAAAAATAAGTTAGCTGGG + Intergenic
1110317716 13:74130494-74130516 CTACAAAAAAATTTTTAGCTGGG + Intronic
1110433775 13:75457315-75457337 CTACAAACAAAGAATGATCTGGG - Intronic
1110684307 13:78353633-78353655 CTACCCAAAAAGAATGAGCTTGG + Intergenic
1111264583 13:85791953-85791975 CTACTAAAAAATATTCAGCATGG - Intergenic
1111269513 13:85863210-85863232 TAAAAAAAAAAGATTCATCTGGG - Intergenic
1111668801 13:91302722-91302744 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1111910603 13:94307475-94307497 CTACAAAAAAATAAAAAGCTGGG - Intronic
1112271325 13:97973201-97973223 ATACAAAAAAAAAATCAGCTGGG - Intronic
1112286633 13:98110585-98110607 TTAAAAAAAAAAATCCAGCTTGG - Intergenic
1112327848 13:98455399-98455421 CAAAAAAAAAAAATTTAGCTAGG - Intronic
1112374100 13:98822760-98822782 CTACAAAAAAAGAAATAGATTGG - Intronic
1112481919 13:99783981-99784003 CAACAAAAAATGATTTAGATAGG - Intronic
1112593996 13:100791282-100791304 ATACAAAAAAAAATTTAGCTGGG + Intergenic
1112619221 13:101037420-101037442 CAACAACAAAACAGTCAGCTAGG - Intergenic
1112879782 13:104092821-104092843 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1112915216 13:104539820-104539842 CTACAAAAAAAAAATTAGCCAGG - Intergenic
1112952565 13:105018853-105018875 ATACAAAAAAAAATTTAGCCGGG - Intergenic
1113227314 13:108173392-108173414 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1113532880 13:111042272-111042294 CCCCAAACAAACATTCAGCTTGG - Intergenic
1113979820 13:114265127-114265149 CTGCCATAAAAGATTCAGCATGG - Intronic
1114169630 14:20259192-20259214 ATACAAAAAAAAAATTAGCTGGG - Intronic
1114253922 14:20985625-20985647 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1114488999 14:23084447-23084469 ATACAAAAAAAATTTTAGCTGGG + Intronic
1114786535 14:25606465-25606487 ATACAAAAAAAAATTTAGCCGGG - Intergenic
1114791119 14:25659562-25659584 CTAAAAAAAGTGATTCATCTGGG + Intergenic
1115486286 14:33914217-33914239 ATACAAAAAAAAAGTGAGCTGGG + Intergenic
1115605202 14:34994152-34994174 ATACAAAAAAAAAATTAGCTGGG - Intronic
1115736973 14:36342765-36342787 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1115981035 14:39051805-39051827 ATACAAAAAAAAAATCACCTGGG + Intronic
1115984751 14:39093022-39093044 ATACAAAAAAAAAATTAGCTGGG - Intronic
1116353541 14:43897805-43897827 CTAAAAAAAAAGATCCAATTAGG + Intergenic
1116387755 14:44352854-44352876 CTTCAAAAAAATATTCAGAATGG + Intergenic
1116632414 14:47352452-47352474 GTCCAAAAAGAGAGTCAGCTAGG - Intronic
1116791918 14:49348314-49348336 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1116851552 14:49914128-49914150 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1117053021 14:51881139-51881161 CTGCTGAAAAAGATTCAGCGAGG - Intronic
1117360052 14:54963945-54963967 CTACAAAAAATAAATTAGCTGGG + Intronic
1117407910 14:55422404-55422426 ATACAAAAAAAAAATTAGCTGGG - Intronic
1117705421 14:58462406-58462428 ATACAAAAAAAAAATTAGCTGGG - Intronic
1117818416 14:59622178-59622200 ATACAAAAAGAAAATCAGCTGGG + Intronic
1118196083 14:63627790-63627812 GAAAAAAAAAAAATTCAGCTGGG + Intronic
1118240595 14:64053806-64053828 ATACAAAAAAAAAATTAGCTGGG + Intronic
1118248258 14:64133043-64133065 ATACAAAAAAAAAATTAGCTGGG + Intronic
1118310672 14:64690382-64690404 ATACAAAAAAAAAATGAGCTGGG + Intergenic
1118458162 14:65963567-65963589 CTACAAAATGAAATTCAGCCAGG + Intronic
1118669173 14:68103124-68103146 CTACAAGAAAAGATTTGGGTGGG + Intronic
1119053473 14:71393658-71393680 CACCAAAAAAAACTTCAGCTGGG + Intronic
1119250242 14:73146347-73146369 CTACAAAAAAATAATTAGCTGGG - Intronic
1119340142 14:73870034-73870056 AAAAAAAAAAAGAATCAGCTGGG + Intronic
1119443414 14:74645047-74645069 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1119467448 14:74870260-74870282 CTCCAAAAAAAAAATCACCTGGG + Intronic
1119654186 14:76405274-76405296 CTACAAAAAAAAAATTAGCCGGG - Intronic
1120027617 14:79604046-79604068 ATACAAAAAAAAATTTATCTGGG - Intronic
1120135056 14:80857578-80857600 CAACAACAAAAAAATCAGCTGGG + Intronic
1120303082 14:82733089-82733111 CTACAAAAAAAAAATTATCTGGG - Intergenic
1120589498 14:86358603-86358625 TTAAAAAAAAATATTCACCTTGG - Intergenic
1120724155 14:87919179-87919201 CTACAAAATTAGATTCACCTGGG + Intronic
1120748840 14:88178747-88178769 ATACAAAAAAAAAGTTAGCTGGG + Intergenic
1120907301 14:89631570-89631592 AAAAAAAAAAAGATTCATCTGGG + Intronic
1120962711 14:90139968-90139990 AAACAAAAAAAAATTCTGCTAGG + Intronic
1121143695 14:91564885-91564907 CAACAAAAAAAATTTCAGCCGGG - Intergenic
1121190002 14:92018798-92018820 ATACAAAAAAAAAATTAGCTGGG + Intronic
1121413074 14:93761188-93761210 ATACAAAAAAAAAATTAGCTGGG + Intronic
1121664053 14:95658541-95658563 CTACAAAAAATAAATTAGCTGGG - Intergenic
1122435475 14:101692857-101692879 CTACAAAAAAAATTTCAGCCAGG + Intergenic
1122435554 14:101693545-101693567 CTACAAAAAAACTTTCGGCCAGG + Intergenic
1122644407 14:103184006-103184028 CTACAAAAAATAAGTTAGCTGGG + Intergenic
1122734232 14:103826849-103826871 ATACAAAAAAAAAATTAGCTGGG + Intronic
1122748391 14:103914649-103914671 GTACAAAAAAAAAATTAGCTAGG + Intronic
1122755007 14:103971463-103971485 CTACAAAAAAAAAATTAGCCTGG - Intronic
1123000132 14:105289180-105289202 CTACAAAAAAAAAATGAGCGGGG + Intronic
1123133761 14:106009100-106009122 ATAGAAAAAAAGAATTAGCTGGG + Intergenic
1123214842 14:106798309-106798331 CTACAAAAAAAGAAATACCTAGG - Intergenic
1202829388 14_GL000009v2_random:10038-10060 TTTAAAAAAAATATTCAGCTGGG - Intergenic
1123625717 15:22225632-22225654 CCAAAAAAAAAAATTTAGCTGGG - Intergenic
1124389165 15:29238477-29238499 ATACAAAAAATTATTCAGCTTGG + Intronic
1124672893 15:31657516-31657538 ATACAAAAAAAAAATTAGCTGGG - Intronic
1124899196 15:33806911-33806933 AAAAAAAAAAAAATTCAGCTGGG - Intronic
1124908992 15:33899627-33899649 CTAAAAATAAAAAATCAGCTGGG - Intronic
1124950853 15:34319294-34319316 ATACAAAAAAAAAATTAGCTGGG - Intronic
1125013621 15:34908154-34908176 TTATAAAACAATATTCAGCTGGG + Intronic
1125028686 15:35055253-35055275 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1125188621 15:36963217-36963239 ATACAAAAAAAAATTTAGCCGGG + Intronic
1125627609 15:41121594-41121616 CTACAATAAAAGGTTCATTTTGG + Intergenic
1125662724 15:41406732-41406754 CCAAAAAAAAAAAATCAGCTGGG - Intergenic
1125696232 15:41639703-41639725 ATACAAAAAAAAAATTAGCTGGG - Intronic
1125763504 15:42116259-42116281 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1125804856 15:42484992-42485014 CTACAAAAAAAAAATTAGCTGGG + Intronic
1125806935 15:42501558-42501580 CAACAAAAAAAAAATCAGCCAGG - Intronic
1125809538 15:42525799-42525821 CTATAAACAAAGAATCAGATTGG - Intronic
1125970730 15:43909237-43909259 ATACAAAAAAAAAATTAGCTGGG + Intronic
1125982744 15:44017764-44017786 ATACAAAAAAAAATTTAGCTGGG - Intronic
1125986642 15:44059670-44059692 ATACAAAAAAAAAATTAGCTGGG - Intronic
1126031090 15:44498428-44498450 CTACAAAAAATGAATGAGCCTGG + Intronic
1126121512 15:45256562-45256584 ATACAAAAAAAAAATTAGCTGGG - Intronic
1126130646 15:45338111-45338133 ATACAAAAAAAAATTTAGCCGGG - Intergenic
1126140900 15:45437829-45437851 CTACAAAAAAAAAATTAGCTGGG + Intronic
1126488855 15:49213957-49213979 AAATAAAAAAAGATTTAGCTGGG + Intronic
1126730195 15:51674581-51674603 CTACAAAAAAAAAATTAGCCAGG + Intergenic
1127168386 15:56271981-56272003 CTACAAAAACAAAATTAGCTGGG + Intronic
1127240957 15:57113788-57113810 AAAAAAAAAAAAATTCAGCTAGG + Intronic
1127576576 15:60297684-60297706 CTAAAAATAAAAAATCAGCTTGG - Intergenic
1127597233 15:60497896-60497918 CTAAAAAAAAAAAATTAGCTAGG + Intronic
1127612441 15:60650236-60650258 AAACAAACAAATATTCAGCTTGG + Intronic
1127632379 15:60839051-60839073 ATACAAAAAAAAATTTAGCCAGG - Intronic
1127985873 15:64069976-64069998 ATACAAAAAAAAATTTAGCTGGG + Intronic
1128023386 15:64413339-64413361 CTACAAAAAATAAATTAGCTGGG - Intronic
1128071157 15:64798382-64798404 ATATAAAAAAAGAATCAGCCGGG - Intergenic
1128332935 15:66767948-66767970 AAAAAAAAAAAGATGCAGCTTGG - Intronic
1128359300 15:66949618-66949640 ATACAAAAAAAAATTTAGCCGGG - Intergenic
1128937282 15:71757594-71757616 TTTCAAAAATATATTCAGCTTGG - Intronic
1128987797 15:72233869-72233891 AAACAAAAAAAGATCAAGCTTGG + Intergenic
1129372635 15:75107314-75107336 CAACAAAAAAAAAATTAGCTGGG - Intronic
1129447334 15:75627742-75627764 CCACAAAAAAAAAATTAGCTAGG + Intergenic
1129575191 15:76735539-76735561 ATACAAAAAAAAAATTAGCTGGG + Intronic
1129821639 15:78606163-78606185 ATACAAAAAAAAATTTAGCTAGG + Intronic
1129836679 15:78712452-78712474 GTACAAAAAAAAAATTAGCTAGG + Intronic
1130007300 15:80112097-80112119 CTAAAAATAAAGAATTAGCTGGG + Intronic
1130077538 15:80702332-80702354 CTACAAAAAATAAATTAGCTGGG + Intronic
1130161042 15:81400374-81400396 CTACCACAAAATGTTCAGCTGGG - Intergenic
1130237287 15:82147479-82147501 CAACAAAAAAAAAATTAGCTGGG + Intronic
1130373576 15:83308223-83308245 CAAAAAAAAAAAATTTAGCTGGG + Intergenic
1130389534 15:83443413-83443435 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1130548617 15:84874688-84874710 ATACAAAAAAAAATTTAGCAGGG - Intergenic
1131090364 15:89620367-89620389 CTAAAAACAAAAAATCAGCTGGG - Intronic
1131407625 15:92178344-92178366 TTAAAAAATAAGATCCAGCTTGG - Intergenic
1131412364 15:92220543-92220565 ATACAAAAAAAAATTTAGCCAGG - Intergenic
1131522046 15:93123858-93123880 AAAAAAAAAAAGATCCAGCTAGG - Intergenic
1131844652 15:96476256-96476278 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1132068407 15:98752520-98752542 ATACAAAAAAAAAGTTAGCTGGG + Intronic
1132078271 15:98841259-98841281 CTACAAAAAAAAATACTGATTGG + Intronic
1132149453 15:99448991-99449013 ATACAAAAAAAGAATTAGCTGGG - Intergenic
1132149600 15:99450220-99450242 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1132247513 15:100309191-100309213 CCACAAAAAAATAATCAGCTGGG + Intronic
1132362135 15:101225226-101225248 CAAAAAAAAAAAAATCAGCTGGG - Intronic
1132942758 16:2516271-2516293 CTAAAAAAAAAAAATTAGCTGGG - Intronic
1133117524 16:3586358-3586380 CTAAAAAAAAAAAATTAGCTGGG + Intronic
1133227131 16:4346681-4346703 AAACAAAAAAAGATTCAGAGAGG - Intronic
1134295098 16:12938656-12938678 ATACAAAAAAAAAATTAGCTGGG - Intronic
1134470242 16:14518436-14518458 TTAAAAAAAAAAATTCAGATTGG + Intronic
1134673819 16:16075467-16075489 ATACAAAAAAAAAATTAGCTGGG + Intronic
1134854600 16:17507747-17507769 CTAGAAAAATAAATGCAGCTGGG + Intergenic
1135062246 16:19280839-19280861 ATACAAAAAAAAAATCAGCCGGG + Intergenic
1135087969 16:19489947-19489969 CTACAAAAAAATAATTAGCTGGG - Intronic
1135125245 16:19804191-19804213 ATACAAAAAAAAAATTAGCTGGG + Intronic
1135535829 16:23293760-23293782 CTACAAAAAAAAAATTAGCCTGG + Intronic
1135632510 16:24047179-24047201 ATACAAAAAAAAAATTAGCTGGG + Intronic
1135890490 16:26352668-26352690 TTACAATAAAAGAATCAGCATGG + Intergenic
1136130089 16:28214451-28214473 ATACAAAAATAAATTTAGCTGGG - Intergenic
1136290034 16:29266169-29266191 ATACAAAAAAAAAATAAGCTGGG - Intergenic
1136341581 16:29647481-29647503 ATACAAAAAAAAATTTAGCCGGG - Intergenic
1136446112 16:30320392-30320414 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1136579934 16:31145210-31145232 ATACAAAAAAAAAATTAGCTGGG + Intronic
1136780951 16:32901459-32901481 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1136916591 16:34207854-34207876 CTCTAAAGAAATATTCAGCTCGG + Intergenic
1137042007 16:35621526-35621548 ATAAAAAAAAAAATTTAGCTTGG - Intergenic
1137232528 16:46579962-46579984 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1137294488 16:47077333-47077355 AAAAAAAAAAAAATTCAGCTGGG + Intergenic
1137690860 16:50426410-50426432 CTACAAAAAAATAATTAGCTTGG - Intergenic
1137691026 16:50427820-50427842 CTACAAAAAAATAATTAGCTTGG + Intergenic
1137732878 16:50702103-50702125 CTACAAAAAAAAAATTAGCCTGG - Intronic
1137744672 16:50812087-50812109 TTAAAAAGAAAGATTGAGCTGGG - Intergenic
1137894878 16:52200591-52200613 CTACAAAAAAAAAATTAGCCTGG - Intergenic
1138058545 16:53862694-53862716 ATACAAAAAAAAAATTAGCTGGG - Intronic
1138293095 16:55864746-55864768 ATAAAAAAAAAGAATTAGCTGGG + Intronic
1138440378 16:57030811-57030833 CTATTAAAAAAAATTCAGCCGGG + Intronic
1138640153 16:58379314-58379336 ATACAAAAAAAAAATTAGCTGGG + Intronic
1138853429 16:60657939-60657961 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1139479443 16:67221461-67221483 ATACAAAAAAAAAATTAGCTGGG + Intronic
1139553287 16:67688894-67688916 ATACAAAAAAAAAATTAGCTGGG - Intronic
1139721970 16:68863447-68863469 ATACAAAAAAACAATTAGCTGGG + Intronic
1139727017 16:68908517-68908539 ATACAAAAAAAAAATCAGCCTGG + Intronic
1139804183 16:69550100-69550122 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1139816435 16:69677995-69678017 ATACAAAAAAAAAATTAGCTGGG + Intronic
1139900000 16:70320712-70320734 ATACAAAAAAAAAATTAGCTGGG - Intronic
1139904152 16:70351683-70351705 ATACAAAAAAAAAATTAGCTGGG - Intronic
1140072905 16:71668253-71668275 ATACAAAAAAAAATTTAGCCGGG + Intronic
1140517202 16:75552156-75552178 CAAAAAACAAAAATTCAGCTGGG + Intronic
1140628678 16:76825665-76825687 CTACAAATAGTGATTCAGCATGG + Intergenic
1140828983 16:78733899-78733921 CTACAAAAAATAAAACAGCTAGG + Intronic
1140887306 16:79256140-79256162 CAAAAAAAAAAAATTTAGCTGGG - Intergenic
1141281122 16:82630321-82630343 CTAAAAAAAAATATTCAGACAGG - Intronic
1141848044 16:86624364-86624386 ATAAAGAAAAAGATGCAGCTAGG - Intergenic
1142418530 16:89956297-89956319 ATACAAAAAAAAATTTAGCCGGG + Intronic
1142593150 17:1016475-1016497 CTACAAATAAAAAATTAGCTGGG - Intronic
1142626220 17:1193849-1193871 ATACAAAAAAAAAATTAGCTGGG - Intronic
1142662576 17:1441489-1441511 CTCAAAAAAAAAAATCAGCTGGG - Intronic
1142690586 17:1604207-1604229 ATACAAAAAAAAAATTAGCTGGG - Intronic
1142705522 17:1691338-1691360 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1142790257 17:2258636-2258658 CTACGAAAAAATAATTAGCTGGG + Intronic
1142816769 17:2432570-2432592 ATAAAAAAAAAAATTAAGCTTGG + Intronic
1142965473 17:3578145-3578167 ATACAAAAAAAAATTTAGCCAGG + Intronic
1143060789 17:4198998-4199020 CTACAAAAAAAAACTTAGCAAGG + Intronic
1143235123 17:5393111-5393133 ATACAAAAAAAAAATTAGCTGGG - Intronic
1143247323 17:5498034-5498056 CTAAAAAAAAAAAATTAGCTGGG + Intergenic
1143311924 17:5999148-5999170 AAAAAAAAAAAAATTCAGCTGGG + Intronic
1143434196 17:6910442-6910464 ATACAAAAAAAAAGTTAGCTGGG + Intronic
1143533663 17:7522612-7522634 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1143979073 17:10852392-10852414 ATACAAAAAAAAATTTAGCCGGG + Intergenic
1144120248 17:12145462-12145484 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1144129734 17:12234591-12234613 ATATAAAAAAAAATTTAGCTGGG + Intergenic
1144159328 17:12542267-12542289 CTACAAAAAAGAATTCTGCTTGG + Intergenic
1144410499 17:14995992-14996014 AAAAAAAAAAAGAATCAGCTGGG - Intergenic
1144440287 17:15275089-15275111 CTACAAAATGAGATTTAGGTGGG + Intergenic
1144817967 17:18049783-18049805 GTACAAAAAAAAATTTAGCCTGG - Intronic
1145078527 17:19875300-19875322 AGACAAAAAAAAAATCAGCTGGG - Intergenic
1145300156 17:21628908-21628930 CCACAAAAAAAAATACATCTTGG - Intergenic
1145929847 17:28677382-28677404 CAAAAAAAAAAAAATCAGCTGGG + Intronic
1145948595 17:28797894-28797916 CTACAAAAAAAAAATTAGCCAGG + Intronic
1146028824 17:29346808-29346830 CTACAAAAGAAAAATGAGCTGGG - Intergenic
1146230680 17:31105673-31105695 CTAAAAAAACAAAATCAGCTGGG - Intronic
1146355269 17:32128239-32128261 CCAAAAAAAAAGTTTCAGGTTGG - Intergenic
1146429590 17:32778813-32778835 CTACAAATAAAGATTTACTTAGG + Intronic
1146800372 17:35814461-35814483 CTTAAAAAAAAAAATCAGCTGGG - Intronic
1147029326 17:37618640-37618662 ATACAAAAAAAAATTTAGCCGGG - Intronic
1147171750 17:38624250-38624272 CTACAAAAAATGTTTAAGCTGGG + Intergenic
1147488031 17:40837402-40837424 CTACAGAAAAAAATTTAGCTGGG + Intergenic
1147619077 17:41851748-41851770 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1147691514 17:42318280-42318302 TTACAAAAAAAAAATTAGCTAGG - Intronic
1147942427 17:44058535-44058557 CTACAAAAAAAAACTAGGCTGGG + Intronic
1148274243 17:46289336-46289358 CTACAAAAAAAAAAGTAGCTGGG - Intronic
1148571888 17:48677067-48677089 CTACTAAAAAAAAATTAGCTGGG - Intergenic
1148597743 17:48870388-48870410 CTACAAAAAAAGAAAAAGCCAGG + Intergenic
1148658431 17:49307268-49307290 CTAAAAATAAAAATTTAGCTAGG + Intronic
1148792176 17:50179557-50179579 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1148839667 17:50487045-50487067 CTACAAAAAAACAATTAGCCAGG - Intergenic
1149342058 17:55697645-55697667 CTAAAAAAAAAGCTTAGGCTGGG - Intergenic
1149414024 17:56439520-56439542 CTAGAAATAAACATTCACCTTGG + Intronic
1149425382 17:56549842-56549864 CTTCTAAAAAAGTTTCAGCTAGG - Intergenic
1149820178 17:59768823-59768845 ATACAAAAAAAAAATTAGCTGGG + Intronic
1149892122 17:60399500-60399522 TTAAAAAAAAAAATTTAGCTGGG + Intronic
1149897685 17:60441731-60441753 ATACAAAAAAATAATTAGCTGGG - Intergenic
1149919743 17:60645977-60645999 CTACAAAAAATAAATTAGCTGGG + Intronic
1149921209 17:60661056-60661078 ATACAAAAAAAAAATTAGCTGGG + Intronic
1150030328 17:61727600-61727622 CTACAAAATAAAAATTAGCTGGG + Intronic
1150145429 17:62765189-62765211 ATACAAAAAAAAAATTAGCTGGG + Intronic
1150312239 17:64138181-64138203 CTAAAAATAAAAAATCAGCTGGG + Intergenic
1150590668 17:66559313-66559335 ATACAAAAAAAAAATGAGCTGGG + Intronic
1150798752 17:68261994-68262016 ATACAAAAAAAAAATGAGCTGGG + Intronic
1150801695 17:68288155-68288177 ATACAAAAAAAAAATCAGCCGGG - Intronic
1150838115 17:68582958-68582980 CAAAAAAAAAAAAATCAGCTGGG - Intronic
1150848289 17:68680941-68680963 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1151068779 17:71184342-71184364 CTACAAATAGAGATTCTCCTTGG + Intergenic
1151136969 17:71956225-71956247 ATACAAAAAAAAAATCAGCCGGG + Intergenic
1151257481 17:72890102-72890124 ATACAAAAAAAAAATTAGCTGGG + Intronic
1151644444 17:75420503-75420525 ATACAAAAAAAAATTTAGCCGGG - Intergenic
1151672600 17:75579812-75579834 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1151744472 17:76004514-76004536 CTACAAAAATAAAATTAGCTGGG - Intronic
1151901632 17:77019860-77019882 CTACAAAAAAAAAATTAGCCAGG - Intergenic
1152051546 17:77982668-77982690 CTAAAAATAAAAAATCAGCTGGG + Intergenic
1152182428 17:78831786-78831808 ATACAAAAAAAAAATTAGCTGGG + Intronic
1152197821 17:78927836-78927858 CTACAAAAAAAAAATTAGCTGGG + Intergenic
1152418338 17:80177532-80177554 CTAAAAATAAAGAATTAGCTGGG + Intronic
1152537361 17:80958569-80958591 ATACAAAAAAAAAATTAGCTGGG - Intronic
1152833323 17:82512568-82512590 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1153212696 18:2785489-2785511 ATACAAAAAAAAAATTAGCTGGG + Intronic
1153239761 18:3020293-3020315 CTACAAAAAAAAAATTAGCCAGG + Intergenic
1153609159 18:6864843-6864865 TTAAAAAAAAAAATTTAGCTGGG - Intronic
1153697804 18:7662089-7662111 ATACAAAAAAAAATTTAGCCAGG - Intronic
1155014823 18:21823238-21823260 AAAAAAAAAAAGAATCAGCTGGG + Intronic
1155281261 18:24242309-24242331 CAAACAAAAAAGATTCAGTTAGG + Intronic
1155423012 18:25675964-25675986 CAACAACAACAGATTCAACTAGG + Intergenic
1155628165 18:27860517-27860539 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1155801345 18:30108352-30108374 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1155829535 18:30495657-30495679 CTACAAAATGAGATTCAACTTGG + Intergenic
1155917470 18:31570520-31570542 CTACCAAAAAATAATTAGCTGGG - Intergenic
1156314396 18:35953610-35953632 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1156377519 18:36528126-36528148 CTTCAATAAAGGAATCAGCTGGG + Intronic
1156443191 18:37212879-37212901 CTACAAAAATACAATTAGCTGGG - Intronic
1156760867 18:40588000-40588022 CTATGACCAAAGATTCAGCTTGG + Intergenic
1156829037 18:41468492-41468514 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1157350145 18:46876855-46876877 ATACAAAAAAAAATTTAGCTGGG - Intronic
1157407358 18:47433429-47433451 CTACAAAAAAAAATGCATTTCGG + Intergenic
1157587345 18:48812545-48812567 CTAAAAAAGAAAATTCAGCGGGG + Intronic
1157604883 18:48919895-48919917 CTTTAGAAAAACATTCAGCTAGG + Exonic
1157620089 18:49011999-49012021 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1157664747 18:49476281-49476303 ATACAAAAAAAAAATCAGCCAGG - Intergenic
1157734796 18:50037733-50037755 CTACAAAAAAAGTATTAGCTGGG + Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158512991 18:58107873-58107895 ATACAAAAAAAAAATTAGCTGGG - Intronic
1158590908 18:58778118-58778140 TTTTAAAAAAAGCTTCAGCTGGG + Intergenic
1158590958 18:58778446-58778468 GAAAAAAAAAAGCTTCAGCTGGG + Intergenic
1158681323 18:59569793-59569815 CTACAAAAACAAAATTAGCTAGG - Intronic
1158864996 18:61629989-61630011 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1158985561 18:62812743-62812765 CCACAAAAATAAATTCAGCTGGG + Intronic
1159059814 18:63502861-63502883 ATACAAAAGAAAATTTAGCTGGG + Intronic
1159111807 18:64068476-64068498 CTAAAAATAAAAAATCAGCTGGG - Intergenic
1159443949 18:68517063-68517085 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1159932535 18:74328430-74328452 CTACAATTCAAGATTCAGATGGG + Intronic
1160069756 18:75616910-75616932 CTACAAAAAAAAATCTTGCTTGG - Intergenic
1160734313 19:655143-655165 CTACAAAAAACAAATTAGCTGGG + Intronic
1161126922 19:2563103-2563125 GTACAAAAAAAAAATTAGCTGGG - Intronic
1161136540 19:2623159-2623181 CTACAAAAAAATAATTAGCCAGG + Intronic
1161374180 19:3930727-3930749 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1161427460 19:4211481-4211503 ATACAAAAAAAAAATTAGCTGGG + Intronic
1161693731 19:5753399-5753421 ATACAAAAAAAAAATTAGCTGGG + Intronic
1161784453 19:6315050-6315072 CTACAAAAAAATAATTAGCTGGG - Intronic
1161826448 19:6569724-6569746 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1161846735 19:6715780-6715802 GTACAAAAAAAAAATTAGCTGGG - Intronic
1161880336 19:6946218-6946240 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1161913146 19:7209576-7209598 CTAAAAAAAAAAAATTAGCTGGG - Intronic
1162152748 19:8657265-8657287 CTACAAAAAAAAAATTAGCTGGG - Intergenic
1162172538 19:8802807-8802829 CTACCAAAAAAAAATTAGCTGGG - Intergenic
1162368458 19:10263984-10264006 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1162385761 19:10359682-10359704 CTAAAAAAAAAAATACAGCCGGG + Intronic
1162411457 19:10508482-10508504 ATACAAAAAAAAAATTAGCTAGG - Intergenic
1162594326 19:11615441-11615463 ATACAAAAAAAAAGTTAGCTGGG + Intronic
1162641378 19:12012967-12012989 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1162953246 19:14084231-14084253 CTACACAAAAATAATTAGCTGGG + Intronic
1162981503 19:14243192-14243214 CTACAAATAAAAAATTAGCTGGG + Intergenic
1163017752 19:14467241-14467263 CTAAAAAAAAAAATTCAGGTTGG + Intronic
1163066159 19:14797338-14797360 ATACAAAAACAAAATCAGCTGGG + Intronic
1163172662 19:15543354-15543376 CTACAAAAAAAAAATCAGCCAGG - Intronic
1163213164 19:15856795-15856817 ATACAAAAAAACATTTAGCCAGG + Intergenic
1163286885 19:16354241-16354263 CTAAAAAAAAAAATGCAGGTAGG - Intergenic
1163363165 19:16860760-16860782 ATACAAAAAAAAAATTAGCTGGG - Intronic
1163448885 19:17363901-17363923 ATACAAAAAAAAATTTAGCCGGG - Intronic
1163500831 19:17675171-17675193 ATACAAAAAAATAATTAGCTGGG + Intronic
1163511378 19:17737273-17737295 TTACAAAAAAAAAGTTAGCTGGG - Intergenic
1163560298 19:18015261-18015283 CTACAAAAAAATAATTAGCTGGG - Intergenic
1163580181 19:18134379-18134401 CTACAAAAAAAACCTTAGCTGGG + Intronic
1163606221 19:18277087-18277109 ATACAAAAAAAAATTTAGCCAGG + Intergenic
1163740824 19:19010842-19010864 TAACAGAAAAATATTCAGCTGGG + Intronic
1163854680 19:19691938-19691960 AAACAAAAAAAAATTTAGCTGGG - Intergenic
1164000692 19:21095621-21095643 ATACAAAAAAAAAATTAGCTGGG - Intronic
1164007947 19:21169069-21169091 ATGCAAAAAAAAATTTAGCTGGG - Intronic
1164050030 19:21577934-21577956 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1164072896 19:21785696-21785718 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1164195699 19:22956270-22956292 CTAAAAATAAAGAATTAGCTGGG + Intergenic
1164289885 19:23857649-23857671 ATACAAAAAAAAAATTAGCTAGG - Intergenic
1164446756 19:28324274-28324296 CTAAAAAAAAATGTTCATCTGGG - Intergenic
1164631986 19:29768057-29768079 TTACAAAAAAAGATATAGCCAGG - Intergenic
1164857080 19:31533288-31533310 CTACAAAAAAAAAATTAGCTGGG - Intergenic
1164864998 19:31597386-31597408 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1165202200 19:34154242-34154264 CAACAAAAAAAAATTTAGCCAGG + Intergenic
1165276552 19:34757409-34757431 CTACAAAAAACAAATTAGCTGGG + Intergenic
1165348819 19:35265837-35265859 CTAGAAAAAATGAGTCATCTGGG - Intronic
1165685928 19:37819869-37819891 CTACAAAATAAAAATCAGCTAGG - Intergenic
1165719019 19:38065575-38065597 ATACAAAAAAAAAATTAGCTAGG - Intronic
1165945730 19:39441099-39441121 CTAGAAAAAGACACTCAGCTGGG - Intronic
1165976810 19:39683255-39683277 CTACAAAAAAAAAATTAGCCAGG - Intergenic
1166071205 19:40389162-40389184 GTACAAAAAAAAAATTAGCTGGG + Intronic
1166307563 19:41943430-41943452 CTACAAAAATAAAATTAGCTAGG + Intergenic
1166397571 19:42453113-42453135 CTACAAAAAAAAAATTAGCTGGG + Intergenic
1166408019 19:42536753-42536775 CTCCAAAAAAAGATACAGTATGG - Intronic
1166516352 19:43449994-43450016 CTACAAAAAAAAAATTAGCCAGG + Intergenic
1166819218 19:45566629-45566651 ATACAAAAAAAAAATTAGCTGGG - Intronic
1166848025 19:45742169-45742191 CTACAAAAAACTTTTAAGCTGGG - Intronic
1166926077 19:46269058-46269080 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1166950994 19:46428012-46428034 CTGCAGAAAGAGGTTCAGCTTGG + Intergenic
1166953274 19:46444729-46444751 CTACAAAAAAAAAATTAGCCGGG - Intergenic
1167081165 19:47276859-47276881 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1167158219 19:47751944-47751966 ATACAAAAAAAAAATTAGCTGGG + Intronic
1167201712 19:48069923-48069945 ATACAAAAAAATATTTAGCCGGG - Intronic
1167242567 19:48353338-48353360 ATACAAAAAAAAAATTAGCTGGG - Intronic
1167445652 19:49535687-49535709 CCACAAAAAAATACTTAGCTGGG + Intronic
1167518115 19:49935158-49935180 CTACAAAAAAAAAATTAGGTGGG + Intronic
1167830007 19:52011804-52011826 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1167953211 19:53044374-53044396 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1168027514 19:53653470-53653492 CTAAAAAAAAAAAATTAGCTGGG + Intergenic
1168142949 19:54401569-54401591 ATAAAAAAAAAAATTTAGCTGGG - Intergenic
1168217438 19:54936655-54936677 CTACAAAAAATAAATTAGCTGGG + Intronic
1168542358 19:57223656-57223678 AAAAAAAAAAAGAATCAGCTGGG - Intergenic
1168596220 19:57679913-57679935 ATACAAAAAAACAATTAGCTAGG + Intergenic
1202643305 1_KI270706v1_random:117744-117766 TTTTAAAAAAATATTCAGCTGGG + Intergenic
926349226 2:11980488-11980510 CTAAAAATAAAAAATCAGCTGGG - Intergenic
926374804 2:12215902-12215924 CTAAAAATACAGAATCAGCTGGG - Intergenic
926396364 2:12446738-12446760 TTAAAAAAAAAGATTCAGAATGG + Intergenic
926703815 2:15822419-15822441 CTACAAAAAATAAATTAGCTGGG - Intergenic
926791825 2:16580607-16580629 CTACAATAAAAAATTCTACTGGG - Intronic
927247187 2:20966747-20966769 CTAGAAAGAAAGATCCAGGTAGG + Intergenic
927513916 2:23660868-23660890 ATACAAAAAAAAAGTCAGCCAGG + Intronic
927650677 2:24911681-24911703 CCACCAAAAAAAATTCAGCTGGG - Intronic
927677890 2:25120188-25120210 CTACAAAAAAAAAATTAGCTGGG + Intronic
928039856 2:27864185-27864207 CTACAAAAAAAAAATTAGTTGGG - Intronic
928112275 2:28520221-28520243 AAAAAAAAAAAGATTCGGCTGGG - Intronic
928151387 2:28832998-28833020 CTACAAAAAATAAATTAGCTGGG - Intronic
928307585 2:30183161-30183183 ATACAAAAAAAAAATTAGCTGGG + Intergenic
928522009 2:32098299-32098321 CTACAAAAAATAAATTAGCTGGG + Intronic
928543876 2:32310712-32310734 CTACAAAAGAAAAATTAGCTGGG + Exonic
928691297 2:33801978-33802000 ATACAAAAAAAAAATTAGCTGGG - Intergenic
928774532 2:34744055-34744077 AAAAAAAAAAAGAGTCAGCTGGG + Intergenic
928984100 2:37163987-37164009 ATACAAAAAAAAATTTAGCCAGG - Intergenic
928997170 2:37305143-37305165 TGACAACAAAAGATACAGCTGGG + Intronic
929102506 2:38329831-38329853 CTAAAGAAAAAAAATCAGCTGGG + Intronic
929173108 2:38950911-38950933 CTACAAAAATACATGCAGCAGGG - Intronic
929235522 2:39601341-39601363 ATACAAAAAAAAAATTAGCTGGG + Intergenic
929378553 2:41320980-41321002 ATACAAAAAAAAAATTAGCTGGG + Intergenic
929419957 2:41780496-41780518 ATACAAAATAAAATTCAACTAGG + Intergenic
929507894 2:42542710-42542732 ATACAAAAAAAAAATTAGCTGGG - Intronic
929550383 2:42886898-42886920 CTAAAAATAAAAATTTAGCTGGG + Intergenic
929774168 2:44917835-44917857 AGACATAATAAGATTCAGCTGGG - Intergenic
929988713 2:46765285-46765307 CTACAAAATAAAAATTAGCTGGG + Intergenic
930149518 2:48044358-48044380 ATACAAAAAAAAAATTAGCTGGG - Intergenic
930878553 2:56246565-56246587 CCACAAAAAAAGAATCAAGTTGG - Intronic
930900949 2:56507132-56507154 CTACAAAAAAACAATTAGCCAGG + Intergenic
931266844 2:60668144-60668166 CTACTAAAAAAAAATTAGCTGGG - Intergenic
931316454 2:61137115-61137137 CTACAAAAAAAAAATTAGCGGGG + Intronic
931513941 2:63030646-63030668 ATACAAAAAAAAAATTAGCTGGG - Intronic
931633200 2:64319749-64319771 ATACAAAAAAAAATTTAGCTGGG + Intergenic
932055658 2:68440646-68440668 CTACAAGATGAGATTCAGGTGGG + Intergenic
932298244 2:70644488-70644510 CTACAAAAAAAAAATTAGCTGGG - Intronic
932395156 2:71439774-71439796 CCACAACAAAAGATCCAGATAGG - Intergenic
932527263 2:72484404-72484426 AAAAAAAAAAAAATTCAGCTGGG + Intronic
932721681 2:74143314-74143336 ATACAAAAAAAAAATTAGCTGGG - Intronic
932812981 2:74839816-74839838 CTACTAAAAAAAAATTAGCTGGG - Intronic
933020946 2:77190453-77190475 ATACAAAAAAAAATTTAGCTGGG - Intronic
933211664 2:79577588-79577610 CTACAAAAAAAAATTTAGAATGG - Intronic
933622345 2:84557487-84557509 ATACAAAAAAAAAATTAGCTGGG + Intronic
933756631 2:85644590-85644612 CTACAAAAAAAAAATTAGCCAGG - Intronic
934753189 2:96807465-96807487 ATACAAAAAAAAAATTAGCTAGG + Intronic
934995443 2:98953978-98954000 CTGCAAAAAAAAAGTGAGCTGGG - Intergenic
935987964 2:108692930-108692952 ATACAAAAAAAAAATTAGCTGGG - Intergenic
935993294 2:108741664-108741686 GTACAAAAAAAAAATTAGCTGGG - Intronic
936040169 2:109143591-109143613 AAAGAAAAAAAGAATCAGCTGGG + Intronic
936164958 2:110113276-110113298 ATACAAAAAAAAAATTAGCTGGG + Intronic
936676896 2:114726073-114726095 ATACAAAAAAAAATTTAGCTGGG + Intronic
937175658 2:119931602-119931624 CTACAAAAAATAAATTAGCTGGG - Intronic
937243083 2:120475013-120475035 CTAAAAAAAAAAAATTAGCTAGG - Intergenic
937270303 2:120645874-120645896 CTCCAAAAAAATAATTAGCTGGG - Intergenic
937414639 2:121704655-121704677 ATACAAAAAAAAATTTAGCCTGG + Intergenic
937619890 2:123973268-123973290 CTACAAAAAAATAATTTGCTTGG + Intergenic
937639857 2:124199574-124199596 CTACAAATAAAAAATTAGCTGGG - Intronic
937722907 2:125125025-125125047 TTACAAAAAAATCTTCACCTAGG - Intergenic
937772678 2:125739398-125739420 CTAAAAAAAAAAAATCAGCCAGG + Intergenic
937922777 2:127143606-127143628 CTACAAAAATAAAATTAGCTAGG + Intergenic
938118272 2:128616840-128616862 ATACAAAAAAAAAATTAGCTGGG + Intergenic
938130272 2:128709247-128709269 ATACAAAAAAAAAATTAGCTGGG - Intergenic
939803227 2:146738954-146738976 CAAAAAAGAAAAATTCAGCTGGG - Intergenic
939971000 2:148660802-148660824 CTAAAAAAAAAAATTCAAATAGG - Intronic
940362174 2:152807642-152807664 ATACAAAAAAAGAATTAGCTGGG + Intergenic
940502458 2:154510095-154510117 CAACATAAAAAGATTCAACAGGG + Intergenic
940561665 2:155304886-155304908 ATACAAAAAAAAAATTAGCTGGG - Intergenic
940570033 2:155419624-155419646 TAAAAAAAAAAAATTCAGCTGGG + Intergenic
940707536 2:157124333-157124355 ATACAAAAAAAAAATTAGCTGGG - Intergenic
940955140 2:159719134-159719156 ATACAAAAAAAGATTTAGCCGGG - Intronic
941063225 2:160871652-160871674 CAACAAAAAAAAAATTAGCTGGG - Intergenic
941724331 2:168844878-168844900 AAAAAAAAAAAGATTCAGCCTGG + Intronic
941751983 2:169143483-169143505 ATACAAAAAAAAAATTAGCTGGG + Intronic
941924515 2:170882546-170882568 CTACAAAAAAGAAATTAGCTGGG + Intergenic
941928769 2:170921078-170921100 ATACAAAAAAAAAATTAGCTGGG - Intergenic
942142028 2:172986852-172986874 ATACAAAAAAAAAATTAGCTGGG - Intronic
942293588 2:174496563-174496585 CTACAAAAAAAAAATTAGCTGGG - Intergenic
942546465 2:177069468-177069490 CTACAAAAACAAACTTAGCTTGG - Intergenic
942904310 2:181162512-181162534 ATACAAAAAAAAAATTAGCTGGG + Intergenic
943042415 2:182819668-182819690 ATACAAAAAAAAAATTAGCTGGG - Intergenic
943521283 2:188952513-188952535 CTTGAAAAAAAGATTCAAGTTGG - Intergenic
943724115 2:191235546-191235568 ATACAAAAAAAAAATTAGCTGGG + Intergenic
944310209 2:198224780-198224802 CTACAAAAATTCATTCAGATGGG - Intronic
944611872 2:201418338-201418360 CTACAAAAATAAAAACAGCTGGG - Intronic
944815772 2:203373616-203373638 TTAGAAAAAAAGATTAAGCAAGG + Intronic
944996983 2:205304638-205304660 AAAAAAAAAAAAATTCAGCTAGG + Intronic
945079775 2:206077114-206077136 ATACAAAAAAAAAATTAGCTGGG + Intronic
945447047 2:209950851-209950873 TTAAAAAAAAAAATCCAGCTGGG - Intronic
946013310 2:216583924-216583946 ATATAAAAAATGATGCAGCTGGG + Intergenic
946224467 2:218256536-218256558 CTACTAAAAAAAAATTAGCTGGG + Intergenic
946374246 2:219298547-219298569 ATACAAAAAAAAATTTAGCCGGG + Intronic
947007219 2:225526079-225526101 CTCCAAATGAAGATTCAGCTTGG + Intronic
947269897 2:228322296-228322318 CTACAAAACAAGATTAGGATAGG + Intergenic
947338847 2:229116064-229116086 ATACAAAAAAAAAATTAGCTGGG + Intronic
947378000 2:229516948-229516970 ATACAAAAAAAAAATTAGCTGGG + Intronic
947525875 2:230876480-230876502 CTCCAAAAAAAAAAGCAGCTTGG - Intronic
947924010 2:233905143-233905165 ATACAAAAAAAAAATTAGCTGGG - Intergenic
948044742 2:234935094-234935116 ACACAAAAAAAGAATCAGTTTGG - Intergenic
948280311 2:236741957-236741979 ATACAAAAAAAAAATTAGCTGGG - Intergenic
948435549 2:237951268-237951290 CTACAAAAATACAGTTAGCTGGG + Intergenic
949013957 2:241699020-241699042 CCCCAAAAAAAAATTCAGCTGGG - Intergenic
1169105341 20:2989720-2989742 CTTGAAAAAATGACTCAGCTGGG + Intronic
1169240504 20:3974871-3974893 CTACAAAAAAAAAATTTGCTGGG - Intronic
1169259381 20:4124728-4124750 ATACAAAAAAAAAATTAGCTGGG - Intronic
1169315702 20:4588930-4588952 ATACAAAAAAACAATTAGCTGGG + Intergenic
1169394353 20:5216483-5216505 CTACAAACAAAAAATTAGCTGGG + Intergenic
1169480319 20:5974289-5974311 CTACAAAAAAAGCATTAGCCAGG - Intronic
1169485995 20:6033288-6033310 ATACAAAAAAAAAATTAGCTGGG - Intronic
1169706410 20:8510544-8510566 ATACAAAAAAAAAATTAGCTGGG - Intronic
1170678145 20:18501404-18501426 ATACAAAAAAAAATTTAGCTGGG - Intergenic
1170682432 20:18538408-18538430 ATACAAAAAAAAAATTAGCTGGG - Intronic
1170991462 20:21305417-21305439 CTACTAAAAAAAAATCAGCTGGG - Intronic
1171004183 20:21447692-21447714 CTACAAAAAAAAAATTAGCTGGG - Intergenic
1171890429 20:30707947-30707969 TTTAAAAAAAATATTCAGCTGGG + Intergenic
1172037927 20:32023125-32023147 ATACAAAAAAAAAATTAGCTGGG - Intronic
1172145768 20:32756893-32756915 GTACAAAAAAAAAATTAGCTCGG + Intergenic
1172335151 20:34109936-34109958 ATACAAAAAAAAAATTAGCTGGG + Intronic
1172401078 20:34651941-34651963 CTACAAAAAAAAAATTAGCTGGG + Intronic
1172420395 20:34812090-34812112 ATACAAAAAAAAAATTAGCTGGG + Intronic
1172430430 20:34886461-34886483 ATACAAAAAAAAAATTAGCTGGG + Intronic
1172669633 20:36626096-36626118 CTTTAAAAAAAAATACAGCTGGG + Intronic
1172733829 20:37110962-37110984 ATACAAAAAAAAAATTAGCTGGG - Intronic
1173461817 20:43248965-43248987 CTACAAAAAAAAGATTAGCTGGG - Intergenic
1173544450 20:43883629-43883651 ATACAATAAAAGATTCAACTGGG - Intergenic
1173629741 20:44503223-44503245 CTGCAAAAAAATATGTAGCTGGG - Intronic
1173975911 20:47186518-47186540 CTAAAATACAAGAATCAGCTGGG - Intronic
1174004145 20:47396877-47396899 CTACAAAAAATAAATTAGCTGGG + Intergenic
1174023857 20:47555797-47555819 ATACAAAAAAAAAATCAGCCGGG - Intronic
1174031119 20:47627899-47627921 CTACAATAAAAAATTCACCCTGG - Intronic
1174253559 20:49237167-49237189 CTAAAAAAAAAAAATTAGCTGGG + Intronic
1175007627 20:55702250-55702272 ATATAAACAATGATTCAGCTAGG + Intergenic
1176115135 20:63428894-63428916 ATACAGAAAAGGATTCTGCTTGG + Intronic
1176211270 20:63923441-63923463 CTAAAAAAAAAAATTAGGCTGGG + Intronic
1176608572 21:8854878-8854900 TTAAAAAAAAATATTCAGCTGGG - Intergenic
1176677641 21:9794598-9794620 CAAAAAAAAAAAAATCAGCTGGG + Intergenic
1177311941 21:19408790-19408812 ATACAAAAGAAACTTCAGCTGGG + Intergenic
1177465109 21:21467689-21467711 CAATAAAAAAAGAATCAGCTGGG + Intronic
1177690820 21:24505226-24505248 ATACAAAAAAAAATTTAGCTGGG - Intergenic
1177898123 21:26879629-26879651 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1178317610 21:31579646-31579668 ATACAAAAAAAAAATCAGCTGGG + Intergenic
1178374258 21:32053626-32053648 TTATAAAAAAAGATCCAGCTGGG - Intergenic
1178414945 21:32396765-32396787 CTAAAAAAAAAAAATTAGCTGGG + Intergenic
1178687906 21:34725818-34725840 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1179782634 21:43712033-43712055 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1179876126 21:44268844-44268866 ATACAAAAAAAAAACCAGCTTGG - Intergenic
1180358656 22:11864693-11864715 TTAAAAAAAAATATTCAGCTGGG - Intergenic
1180375876 22:12092743-12092765 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1180379610 22:12127638-12127660 TTAAAAAAAAATATTCAGCTGGG + Intergenic
1180386626 22:12182777-12182799 GTACAAAAAAAAATTTAGCCAGG - Intergenic
1180735251 22:18011729-18011751 ATACAAAAAAAAAATTAGCTGGG + Intronic
1180797610 22:18614215-18614237 CTACAAAAAAAATTTTAGCTGGG + Intergenic
1180882362 22:19214839-19214861 CTAAAAATAAAAATTCAGCCAGG - Intronic
1180894669 22:19321156-19321178 CTACAAAAAAAAATTTAAATTGG + Intergenic
1181101518 22:20543547-20543569 ATAAAAAAAAGGACTCAGCTTGG - Intronic
1181224108 22:21381047-21381069 CTACAAAAAAAATTTTAGCTGGG - Intergenic
1181254525 22:21553776-21553798 CTACAAAAAAAATTTTAGCTGGG + Intronic
1181817628 22:25450577-25450599 AAAAAAAAAAAAATTCAGCTGGG - Intergenic
1182255612 22:29035734-29035756 ATAAAAAAAAAAATTTAGCTGGG - Intronic
1182560125 22:31153130-31153152 CTACAAAAAAAAATTTAGCTGGG - Intergenic
1182579200 22:31294096-31294118 ATACAAAAAAAAATTTAGCCAGG - Intergenic
1182634152 22:31711176-31711198 GTAGAAAAGAAGATTCAGCTGGG + Intronic
1182913656 22:34008162-34008184 CTACAAGATAAGATTTAGGTGGG + Intergenic
1183366090 22:37407732-37407754 CTAAAAAAAAAAAATTAGCTGGG + Intronic
1183384175 22:37505513-37505535 ATACAAAAAAAAACTTAGCTGGG + Intronic
1183386296 22:37517340-37517362 TTATATAAAAAAATTCAGCTAGG + Intronic
1183447180 22:37865297-37865319 CTACTAAAAAAAAAACAGCTGGG + Intronic
1183594362 22:38801350-38801372 CTCCATTTAAAGATTCAGCTGGG + Intergenic
1183638538 22:39079476-39079498 ATACAAAAAAAAAATCAGCTGGG - Intronic
1183995974 22:41632660-41632682 CCAAAAAAAAAGAATAAGCTGGG + Intronic
1184359843 22:44008826-44008848 GTACAAAAAAAAAATTAGCTGGG + Intronic
1184513883 22:44948528-44948550 ATAAAAAAAAACATTTAGCTAGG + Intronic
1185396768 22:50595766-50595788 ATACAAAAAAAAAATGAGCTGGG + Intronic
1185407199 22:50659632-50659654 AAAAAAAAAAAAATTCAGCTGGG - Intergenic
949359819 3:3219961-3219983 CTACAAAGAAGGATTCTGCCTGG - Intergenic
949483828 3:4518772-4518794 TTAAAAATAAAGGTTCAGCTTGG + Intronic
949978347 3:9481428-9481450 TTACAAAAAAATAATTAGCTGGG - Intergenic
949995281 3:9611816-9611838 ATACAAAAAAACAATTAGCTGGG - Intergenic
950197013 3:11016430-11016452 ATACAAAAAAAAAATTAGCTGGG + Intronic
950232093 3:11285005-11285027 ATACAAAAAAAAAATTAGCTGGG - Intronic
950250549 3:11461867-11461889 ATACAAAAAAAAAATTAGCTGGG + Intronic
950468062 3:13167242-13167264 CTGGAGATAAAGATTCAGCTAGG + Intergenic
950762363 3:15243357-15243379 CTCCAAATGAAGATGCAGCTAGG + Intronic
950780670 3:15389018-15389040 CTATAAAAAAAAAATTAGCTGGG - Intronic
951224573 3:20106535-20106557 GTACAAAATAAGATTAATCTTGG + Intronic
952211018 3:31229446-31229468 CCATAAAAAAAGAATCAGTTTGG + Intergenic
952291823 3:32024235-32024257 CTACAAAAAAATAGCCTGCTTGG + Intronic
952468332 3:33616170-33616192 CTAAAAAGAAAAAGTCAGCTGGG + Intronic
952490787 3:33870690-33870712 CCACAAAAAAAAAATTAGCTGGG - Intergenic
952862690 3:37827419-37827441 CTACAAAAAAAATTTTAGCTGGG + Intergenic
953639168 3:44689360-44689382 ATACAAAAAAAAAATGAGCTGGG + Intergenic
953954918 3:47224397-47224419 ATACAAAAAAAAAATTAGCTGGG + Intergenic
954171799 3:48809433-48809455 ATACAAAAAAAAAATTAGCTGGG + Intronic
954178879 3:48865971-48865993 ATACAAAAAAAAAATTAGCTGGG + Intronic
954257831 3:49418660-49418682 ATACAAAAAAAAAATTAGCTGGG - Intronic
954309848 3:49757557-49757579 CTACAAAAAAAAAATTAGCCAGG + Intronic
954357510 3:50094638-50094660 CTACAAAAAATAAATTAGCTGGG - Intronic
954564213 3:51584964-51584986 CTACAAAAAAAAAATTAGCCAGG - Intronic
954722847 3:52580517-52580539 ATACAAAAAAAAAATTAGCTGGG - Intronic
955232540 3:57111799-57111821 ATACAAAAAAAAAATCAGCTGGG + Intronic
955235137 3:57132297-57132319 ATACAAAAAAAAATTTAGCCAGG + Intronic
955493025 3:59502089-59502111 ATACAGAAAAAAATTTAGCTGGG - Intergenic
956099445 3:65752102-65752124 ATACAAAAAAAAATTTAGCCAGG - Intronic
956133686 3:66078008-66078030 GTACTAAAAAAGATTGAGATAGG - Intergenic
956234208 3:67049818-67049840 ATACAAAAAATGATTCAGGTGGG + Intergenic
956599946 3:71009907-71009929 AAAAAAAAAAAAATTCAGCTGGG - Intronic
956648653 3:71482559-71482581 CTAAAAATAAAAAATCAGCTGGG - Intronic
956699814 3:71948964-71948986 AAAAAAAAAAAGAATCAGCTGGG - Intergenic
956757792 3:72406279-72406301 CTACTAAAAAATAAGCAGCTTGG + Intronic
956773729 3:72548330-72548352 ATACAAAAAAAAAATTAGCTGGG + Intergenic
957541605 3:81577234-81577256 CTACAATAAAAGACTCAGGGTGG - Intronic
957777668 3:84775110-84775132 ATACAAAAAAAAAATCAGCATGG + Intergenic
957940166 3:86993036-86993058 CTAAAAAAACAAATTAAGCTGGG - Intergenic
958610946 3:96425274-96425296 CTACAAAATCAGGTTCAGATGGG - Intergenic
959179620 3:102961716-102961738 CTACAAAAAATGAAATAGCTAGG - Intergenic
959255550 3:104007414-104007436 ATACAAAAACAAAATCAGCTGGG - Intergenic
960058994 3:113299731-113299753 TTAAAAAATAAGATCCAGCTAGG + Intronic
960284046 3:115807928-115807950 ATACAAGGAAAAATTCAGCTTGG - Exonic
960641976 3:119833851-119833873 ATACAAAAAAAAATTTAGCCAGG - Intronic
960834714 3:121893982-121894004 ATACAAAAAAAAAATTAGCTGGG - Intergenic
960896364 3:122509996-122510018 ATACAAACAAAGAATCAGATTGG + Intronic
961147602 3:124608169-124608191 CTACAAAAAAAAAATTAGCCGGG - Intronic
961435444 3:126913388-126913410 ATACAAAAAAAAAATTAGCTGGG - Intronic
961725015 3:128922180-128922202 ATACAAAAAAAAAATTAGCTGGG + Intronic
961992353 3:131205516-131205538 CCACAAAAAGAGACACAGCTGGG - Intronic
962005152 3:131341911-131341933 CTAAAAAACAAAATCCAGCTAGG - Intronic
962577562 3:136768974-136768996 CTACAAAAAAAAAATTAGCCAGG + Intergenic
962734130 3:138309133-138309155 ATACAAAAAAAAAATTAGCTAGG + Intronic
962796097 3:138850827-138850849 CTCCTAAAAAAAATTTAGCTGGG - Intergenic
962827553 3:139111090-139111112 CTACAAAAAAAATTCAAGCTGGG - Intronic
962913253 3:139874710-139874732 ATACAAAAAAAAAATTAGCTGGG + Intergenic
963628415 3:147702920-147702942 CTGCAAAAAAAATGTCAGCTGGG - Intergenic
963796631 3:149637384-149637406 ATACAAAAAAAAAATTAGCTGGG - Intronic
963890481 3:150631050-150631072 CTACAAAAAAAAAATTAGCCAGG + Intergenic
963927827 3:150969813-150969835 ATACAAAAAAAAAATTAGCTGGG + Intronic
964167560 3:153726654-153726676 TTCCCAAAAAAGATTCAGTTTGG + Intergenic
964203201 3:154141120-154141142 ATACAAAAAAAAAATCAGCCGGG - Intronic
964838715 3:160970436-160970458 AAAAAAAAAAATATTCAGCTTGG - Intronic
965369302 3:167841037-167841059 CTACTAAAAAATAATTAGCTGGG - Intergenic
965539098 3:169854394-169854416 TTACAGAAAAAGAGTCAGCAGGG - Intronic
965907027 3:173721352-173721374 ATACCAAAAAACATTCAGATTGG - Intronic
965998808 3:174921642-174921664 ATACAAAAACAGAATTAGCTGGG + Intronic
966213726 3:177479352-177479374 CTATAAGAAAACATTCAGCCTGG - Intergenic
966461797 3:180184614-180184636 ATACAAAAAAAAAATTAGCTGGG - Intergenic
966721884 3:183071860-183071882 AAAAAAAAAAAAATTCAGCTGGG - Intronic
966755213 3:183363577-183363599 CTACAAAAAAATAATTAGCCAGG + Intronic
966755275 3:183364357-183364379 ATACAAAAAAAAAATTAGCTGGG + Intronic
966795678 3:183711310-183711332 ATACAAAAAAAAAATCAGCCGGG + Intronic
967642135 3:191877918-191877940 ATACAAAAAAAAAATTAGCTGGG - Intergenic
967978967 3:195053999-195054021 CTACAAAAAAAGAAACACCCAGG - Intergenic
968106869 3:196007443-196007465 CTAAAAAAAAAAAATTAGCTGGG - Intergenic
968134769 3:196213354-196213376 CTACAAAAAAAAAATTAGCTGGG - Intronic
968210801 3:196847173-196847195 CTACTAAAAAACAGTTAGCTGGG - Intergenic
968321981 3:197777873-197777895 GTACAAAAAAAAAATTAGCTGGG - Intronic
968559476 4:1271073-1271095 ATACAAAAAAAAAATTAGCTGGG - Intergenic
968670671 4:1849423-1849445 CTAAAAAAAAAAAATTAGCTGGG - Intronic
968735560 4:2294154-2294176 CTTCAAAAGAAGATAAAGCTGGG + Intronic
968763311 4:2454156-2454178 ATACAAAAAAAGAAATAGCTGGG - Intronic
968840417 4:3000723-3000745 ATACAAAAAAAAAATTAGCTGGG - Intronic
969160561 4:5254078-5254100 CTACAAAAAAAGATTCAGCTGGG - Intronic
969394628 4:6912093-6912115 GTATAAATAAAGTTTCAGCTGGG + Intronic
969429166 4:7143966-7143988 ATACAAAAAAAAAATTAGCTGGG + Intergenic
969915366 4:10485615-10485637 ATACAAAAAAAAAATCAGCTGGG - Intergenic
970592613 4:17572584-17572606 GTACAAAAAAAAAATTAGCTGGG - Intergenic
970647495 4:18139112-18139134 ATACAAAAAAAAAATTAGCTGGG + Intergenic
970698350 4:18704942-18704964 CTACAAAAGAAAAATGAGCTAGG - Intergenic
970903434 4:21186933-21186955 TTAAATAAAAAGATTGAGCTGGG - Intronic
971041479 4:22757380-22757402 ATACAAAAAAAAAATTAGCTGGG - Intergenic
971173296 4:24256291-24256313 ATACCAAAAAAGATCCAGATCGG + Intergenic
971687344 4:29786737-29786759 CTACAAAATGAGATTTAGGTAGG + Intergenic
971846562 4:31925826-31925848 CAACAAAAATACATTCAACTTGG + Intergenic
972085955 4:35216034-35216056 ATACAAAAAAAAAATTAGCTGGG - Intergenic
972352472 4:38248761-38248783 CTACAAAAACAAAATTAGCTGGG + Intergenic
972452857 4:39220801-39220823 ATATAAAAAATGTTTCAGCTGGG - Intronic
972458862 4:39280492-39280514 CTACAAAAAAATAATTAGCCAGG + Intronic
972472607 4:39421592-39421614 ATACAAAAAATAATTTAGCTGGG + Intronic
972521486 4:39861295-39861317 ATACAAAAAAAGATTTAGCCAGG + Intronic
973137486 4:46726024-46726046 ATACAAAAAAAAATTTAGCCGGG - Intergenic
973183976 4:47301471-47301493 CTACAATAAAAAATTTAGCCAGG + Intronic
973209643 4:47601501-47601523 CTACAAAAAAAAAATTAGCTTGG - Intronic
973295499 4:48515526-48515548 ATACAAAAAAAAAATTAGCTGGG - Intronic
973628476 4:52795891-52795913 AGAGAAAAACAGATTCAGCTGGG + Intergenic
973773852 4:54228428-54228450 ATACAAAAAAAGCTCAAGCTTGG - Intronic
973961198 4:56111673-56111695 ATACAAAAAAAAAATTAGCTGGG - Intergenic
974308050 4:60167513-60167535 CTATAGATAAAGATTCAGATAGG + Intergenic
974801329 4:66822941-66822963 ATACAAAAAAAAAATTAGCTGGG - Intergenic
975200132 4:71577681-71577703 ATACAAAAAAAAATTTAGCTGGG + Intergenic
975389348 4:73798497-73798519 ATACAAAAAAAAATTTAGCCAGG - Intergenic
975432164 4:74306270-74306292 CTACAAAAAATAAATTAGCTGGG - Intergenic
975571961 4:75826887-75826909 CTAGAAAAAAATATTTGGCTGGG - Intergenic
975679061 4:76857558-76857580 CTACAAAAAAAAATACAAATAGG - Intergenic
975804598 4:78098864-78098886 CTACCAAAAGAGATTCATTTGGG - Intronic
976133277 4:81907700-81907722 ATACAAAAAAAAAATTAGCTGGG + Intronic
976151168 4:82093471-82093493 ATACAAAAAAAAAATTAGCTGGG + Intergenic
976290127 4:83409391-83409413 ATACAAAAAAAAATTTAGCCAGG + Intronic
976412986 4:84738439-84738461 ATACAAAAAAAAATTAAGCCAGG + Intronic
976620075 4:87118648-87118670 CTACAAAAAATAAATTAGCTGGG - Intronic
976698226 4:87941045-87941067 CTACAAAAAAAGAAAAAGCCAGG - Intergenic
976707480 4:88034505-88034527 CTAAAAATAAAAAATCAGCTGGG + Intronic
977282992 4:95065775-95065797 CTACAAGAAAATATGCAACTAGG + Intronic
977412831 4:96689898-96689920 ATACAAAAAAAAAATTAGCTGGG + Intergenic
977777186 4:100934998-100935020 CTACAAAAAAAGAATTGGCAAGG + Intergenic
977938963 4:102837654-102837676 CTACAAAAAATTTTTCGGCTGGG + Intronic
977940192 4:102849201-102849223 CTACAAAAAAAAAACTAGCTGGG + Intronic
978163199 4:105574388-105574410 ATACAAAAAAAAATTTAGCCAGG + Intronic
978220859 4:106272650-106272672 ATACAAAAAAAAAATTAGCTGGG - Intronic
978354569 4:107857980-107858002 CTACAAAAGAAGAGTAAGCCAGG - Intronic
978512484 4:109535689-109535711 ATACAAAAAAACAATTAGCTGGG + Intronic
978528302 4:109689134-109689156 ATGCAAAAAAAAATTTAGCTAGG - Exonic
978786581 4:112616362-112616384 ATACAAAAAAAAAATTAGCTGGG + Intronic
978999036 4:115194907-115194929 ATACAAAAATAAATTCAGCATGG - Intergenic
979060486 4:116053426-116053448 ATACAAAAAAAAAATTAGCTGGG - Intergenic
979078643 4:116306067-116306089 CTACAAAAAAAAATTCAAACAGG + Intergenic
979252347 4:118578727-118578749 ATACAAAAAAAAAATTAGCTGGG - Intergenic
979535426 4:121814488-121814510 CTACAAAAAAAAAGACAGCAGGG - Intronic
979644350 4:123050903-123050925 CTACTAAAAAAAAATTAGCTGGG - Intronic
979933005 4:126655791-126655813 ATACAAAAGAAAAATCAGCTGGG - Intergenic
981036014 4:140169582-140169604 ATACAAAAAAAAAATTAGCTGGG - Intergenic
981355099 4:143780850-143780872 ATACAAAAAAAGAATTAGCCAGG - Intergenic
981389053 4:144166405-144166427 CAAAAAAAAAAAATTTAGCTGGG + Intergenic
981507544 4:145519389-145519411 AAAAAAAAAAAGGTTCAGCTGGG - Intronic
981664656 4:147209518-147209540 CTCCCAAAAAAAATTCAGCTAGG + Intergenic
981738889 4:147982535-147982557 AAAAAAAAAAAGATTTAGCTGGG - Intronic
982226948 4:153175175-153175197 ATACAAAAAAATAATTAGCTGGG - Intronic
982885566 4:160776167-160776189 CTACAAAAGTAAATTCAGTTAGG + Intergenic
983346091 4:166526437-166526459 CTAAAAAAAAAAAATTAGCTGGG + Intergenic
983347230 4:166542584-166542606 ATACAAAAAAAAAGTTAGCTGGG + Intergenic
983744788 4:171184394-171184416 CTCCAAATATAGCTTCAGCTGGG + Intergenic
983795967 4:171863916-171863938 ATACAAAAAAAAAATTAGCTGGG - Intronic
983950192 4:173630447-173630469 ATACAAAAAAAAAATTAGCTGGG - Intergenic
984406904 4:179344283-179344305 ATACAAAAAAAAAATTAGCTGGG + Intergenic
984762118 4:183371452-183371474 CTAAAAAAATAATTTCAGCTTGG - Intergenic
984870960 4:184324698-184324720 ATACAAAAAAAAAATTAGCTGGG + Intergenic
985001480 4:185488233-185488255 ATACAAAAAAAAAATTAGCTAGG - Intergenic
985084131 4:186295765-186295787 ATACAAAAAAATAATTAGCTGGG - Intergenic
985127942 4:186713981-186714003 AGAAAAAAAAAGATTCAGGTTGG - Intronic
985189897 4:187361188-187361210 ATACAAAAAAAAAATTAGCTGGG + Intergenic
985195710 4:187427008-187427030 ATACAAAAAAAAATTTAGCTAGG + Intergenic
985355581 4:189115925-189115947 CTGCAAAAAAAGACTTAGCTAGG + Intergenic
1202757474 4_GL000008v2_random:78183-78205 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1202770678 4_GL000008v2_random:203654-203676 TTTAAAAAAAATATTCAGCTGGG + Intergenic
985768885 5:1796637-1796659 CTGCAACCAAAGTTTCAGCTTGG + Intergenic
986341797 5:6795284-6795306 ATACAAAAAAAAAATTAGCTGGG - Intergenic
986640206 5:9864470-9864492 CTACAAAAAAAAAATTAGCTGGG + Intergenic
987054739 5:14180667-14180689 CTACAAAAAAATAAAAAGCTGGG + Intronic
987148252 5:15013318-15013340 ATACAAAAAAAAAATTAGCTGGG + Intergenic
987315882 5:16723225-16723247 ATACAAAAAAAAAATTAGCTGGG + Intronic
987422305 5:17735027-17735049 ATACAAAAAAAAAATTAGCTGGG - Intergenic
987493229 5:18608550-18608572 CTACAAAAAATAAATTAGCTAGG - Intergenic
987763706 5:22197285-22197307 ATACAAAAAAAAAATTAGCTGGG + Intronic
988030964 5:25761871-25761893 ATACAAAAATAAAATCAGCTGGG + Intergenic
988338786 5:29941743-29941765 CTTCAATAAAAGATTGACCTAGG + Intergenic
988489979 5:31698061-31698083 ATACAAAAAAAAAATTAGCTGGG - Intronic
988566467 5:32323258-32323280 ATACAAAAAAAAATTTAGCCGGG + Intergenic
988671024 5:33381951-33381973 GTACAAAAGAAAAGTCAGCTGGG - Intergenic
988924573 5:35976673-35976695 CTACAAAAAATAAATTAGCTGGG + Intronic
989030259 5:37111279-37111301 ATACAAAAAAAAAATTAGCTAGG - Intronic
989057640 5:37380497-37380519 ATACAAAAAAAAAATCAGCCGGG - Intronic
989352080 5:40498133-40498155 ATACAAAAAAATATTTAGCCGGG + Intergenic
989915771 5:49725610-49725632 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989916053 5:49730038-49730060 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989916513 5:49736679-49736701 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989918701 5:49769395-49769417 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989919753 5:49784903-49784925 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989922752 5:49829031-49829053 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989922906 5:49831244-49831266 ATCAAAAAAAAGTTTCAGCTCGG - Intergenic
989923782 5:49844529-49844551 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989924093 5:49848958-49848980 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989925744 5:49873146-49873168 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989926779 5:49888648-49888670 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989927388 5:49897505-49897527 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989927819 5:49903977-49903999 ATCAAAAAAAAGTTTCAGCTCGG - Intergenic
989928883 5:49919475-49919497 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989929175 5:49923902-49923924 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989929598 5:49930372-49930394 ATCCAAAAAAAGTTTCAACTAGG - Intergenic
989932872 5:49979089-49979111 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989933484 5:49987945-49987967 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989933623 5:49990159-49990181 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989933767 5:49992374-49992396 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989934369 5:50001235-50001257 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989934966 5:50010099-50010121 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989935116 5:50012315-50012337 ATCAAAAAAAAGATTCAACTCGG - Intergenic
989935404 5:50016747-50016769 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989935554 5:50018961-50018983 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989937241 5:50043327-50043349 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989937688 5:50049971-50049993 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989938126 5:50056618-50056640 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989938282 5:50058831-50058853 ATCCAAAAAAAGTTTCAACTCGG - Intergenic
989940213 5:50139109-50139131 ATCCAAAAAAAGTTTCAACTCGG + Intergenic
990138165 5:52672136-52672158 CTCCAACAAAATATTCAGTTTGG + Intergenic
990242542 5:53830465-53830487 ATACAAAAAAATATTTAGCCAGG + Intergenic
990264017 5:54056467-54056489 CTAAAAATAAAAAATCAGCTGGG + Intronic
990354215 5:54949912-54949934 AAAAAAAAAAAAATTCAGCTTGG + Intergenic
990384202 5:55243521-55243543 AAAAAAAAAAAGATTTAGCTGGG + Intergenic
990452929 5:55953548-55953570 CTACTAAAACAAAATCAGCTAGG - Intronic
990578767 5:57148981-57149003 AAACAAAAAAAGTTTCAGCTGGG + Intergenic
990578819 5:57149438-57149460 AAACAAAAAAAGTTTCAGCTGGG + Intergenic
990585395 5:57206667-57206689 ATACAAAAATAAACTCAGCTGGG - Intronic
990898351 5:60724036-60724058 CTACTAAAAAAAAATTAGCTGGG - Intergenic
991052842 5:62291328-62291350 ATACAAAAAAAAAATTAGCTGGG + Intergenic
991231419 5:64337172-64337194 CTACAAAAACAAAATCAGCCAGG - Intronic
991299225 5:65112689-65112711 AAAAAAAAAAAGATTCAGCTGGG + Intergenic
991381301 5:66030721-66030743 TTAAAAAAAAAAATTTAGCTGGG - Intronic
991561598 5:67959222-67959244 CCAGAAAAAAAGATGTAGCTTGG - Intergenic
991578303 5:68127609-68127631 ATACAAAAAAAAAATTAGCTGGG + Intergenic
991662468 5:68963845-68963867 ATACAAAAAAAAATTTAGCCGGG - Intergenic
991731980 5:69598438-69598460 CTTAAAAAAAAAATTCAGCCAGG - Intergenic
991772669 5:70054144-70054166 ATACAAAAAAACAATTAGCTGGG - Intronic
991775432 5:70080168-70080190 ATACAAAAAAAAAATTAGCTCGG + Intergenic
991778063 5:70104940-70104962 ATACAAAAAAAAAATTAGCTGGG + Intergenic
991808414 5:70453582-70453604 CTTAAAAAAAAAATTCAGCCAGG - Intergenic
991851962 5:70929568-70929590 ATACAAAAAAACAATTAGCTGGG - Intronic
991854726 5:70955622-70955644 ATACAAAAAAAAAATTAGCTCGG + Intergenic
991857353 5:70980392-70980414 ATACAAAAAAAAAATTAGCTGGG + Intronic
991862799 5:71028096-71028118 ATACAAAAAAACAATTAGCTGGG + Intergenic
991862972 5:71029419-71029441 CTTAAAAAAAAAATTCAGCCAGG + Intergenic
992805964 5:80338283-80338305 ATACAAAAAAAAATTTAGCCAGG - Intergenic
992855025 5:80850707-80850729 CTACAAGAAAAGATGTGGCTGGG + Intronic
992857044 5:80872304-80872326 CTACAAAAAAAAAATTAGCTAGG + Intronic
993084725 5:83349282-83349304 GTTCAAAAAGAGATTCAGGTGGG + Intronic
993481979 5:88435203-88435225 ATACAAAAAAAAAATTAGCTGGG + Intergenic
993908666 5:93653349-93653371 ATACAAAAAAAAAATTAGCTGGG + Intronic
993969000 5:94394005-94394027 ATACAAAAAAAAAATTAGCTGGG - Intronic
993982779 5:94563195-94563217 CAAAAAAAAAAAAATCAGCTGGG + Intronic
994054050 5:95395280-95395302 ATACAAAAAAAAATTTAGCCAGG + Intronic
994377302 5:99029809-99029831 CTACAAATAAAAAATTAGCTGGG - Intergenic
994514483 5:100753455-100753477 CTGCAAAAAAAAATTCACCTGGG + Intergenic
994519762 5:100818208-100818230 CTACTTAAGAACATTCAGCTTGG + Intronic
994890949 5:105635745-105635767 ATACAAAAAAAAATTTAGCCGGG - Intergenic
995721882 5:115144029-115144051 ATACAAAAAAAAAATTAGCTGGG - Intronic
996211216 5:120813233-120813255 CAACAAAAAAAGACCAAGCTGGG - Intergenic
997142920 5:131401825-131401847 ATACAAAAAAAAAATTAGCTGGG - Intergenic
997527564 5:134563158-134563180 ATACAAAAAAAAAATTAGCTGGG + Intronic
997853746 5:137355351-137355373 CTACAAAAAATAAATTAGCTGGG - Intronic
997908172 5:137841344-137841366 CTACAAAAAAAAAATTAGCCAGG + Intergenic
997970453 5:138397172-138397194 ATACAAAAACAAAATCAGCTGGG + Intronic
997989273 5:138530571-138530593 CTCAAAGAAAAGAATCAGCTGGG - Intronic
998081776 5:139281501-139281523 ATACAAAAAAAAATTTAGCCAGG - Intronic
998400674 5:141847238-141847260 CTAAAAAAAAAAATACAGCCGGG - Intergenic
998565175 5:143210412-143210434 CTACAAGATGAGATTCAGGTGGG + Intronic
998621830 5:143802795-143802817 ATACAAAAAAAAAATTAGCTGGG + Intergenic
999369339 5:151044204-151044226 CTACAAAAAATAAATTAGCTGGG - Intronic
999447456 5:151651319-151651341 CTACAAAAAAAAAATTAGTTGGG + Intergenic
999696970 5:154195852-154195874 CTACAAAAAAATAGCCAGATAGG - Intronic
1001444349 5:171771649-171771671 CTAAAATAATAGATTAAGCTGGG - Intergenic
1001973307 5:175974910-175974932 ATACAAAAAAAAACTTAGCTGGG - Intronic
1002035341 5:176464476-176464498 AAAAAAAAAAAGAATCAGCTTGG - Intronic
1002191544 5:177480642-177480664 AAAAAAAAAAAAATTCAGCTGGG - Intergenic
1002244130 5:177868873-177868895 ATACAAAAAAAAACTTAGCTGGG + Intergenic
1002326517 5:178413020-178413042 CTACAAAAAAAAAAATAGCTGGG + Intronic
1002482242 5:179510294-179510316 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1002510528 5:179713365-179713387 TAACAAAAAAAGGTTAAGCTGGG - Intronic
1002595799 5:180321942-180321964 ATACAAAAAAAAAATCAGCCGGG - Intronic
1002608393 5:180397478-180397500 ATACAAAAAGAAAATCAGCTGGG - Intergenic
1002631710 5:180585886-180585908 CAACAAACAAAAAGTCAGCTGGG - Intergenic
1003419771 6:5946584-5946606 ATACAAAAAAAAATTTAGCTGGG + Intergenic
1003625763 6:7739985-7740007 ATACAACAAAAGATTCAGAAGGG + Intronic
1003669333 6:8141320-8141342 CTATAAAAAAAGATGCATTTTGG - Intergenic
1003735343 6:8872058-8872080 ATACAAAAAAAAATTTAGCCAGG - Intergenic
1003935266 6:10969519-10969541 ATACAAAAAAAAAATTAGCTGGG - Intronic
1004585980 6:17000746-17000768 CTACTAAAAAAAATTTAGCTGGG - Intergenic
1004621283 6:17332810-17332832 ATACAAAAAAAAATTTAGCCGGG - Intergenic
1005053576 6:21708984-21709006 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1005064345 6:21803946-21803968 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1005336998 6:24807310-24807332 ATACAAAAAAAGAGTTAGCTGGG + Intronic
1005664047 6:28031493-28031515 TTACCAACAAATATTCAGCTAGG - Intergenic
1005702732 6:28418825-28418847 AAAAAAAAAAAGATGCAGCTAGG + Intergenic
1005751635 6:28888288-28888310 CTACAAAAAATAAATTAGCTAGG - Intergenic
1005913733 6:30333516-30333538 ATAGAAAAAAAAAATCAGCTGGG - Intronic
1006178036 6:32135125-32135147 CTACAAAATAAAAATTAGCTAGG + Intergenic
1006273430 6:32981823-32981845 CTACTAAAAAAAAATTAGCTGGG + Intergenic
1006547934 6:34794943-34794965 ATACAAAAAAAAAATTAGCTGGG - Intronic
1006918595 6:37613044-37613066 CTAAAAATACAGAATCAGCTGGG + Intergenic
1007041212 6:38724136-38724158 ATACAAAAAAAAATTTAGCTGGG - Intronic
1007411889 6:41668796-41668818 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1007441027 6:41860666-41860688 ATACAAAAAAAAAATTAGCTGGG - Intronic
1007544811 6:42685623-42685645 ATACAAAAAAAAAATTAGCTGGG - Intronic
1007567082 6:42859800-42859822 ATACAAAAAAAAAATTAGCTGGG - Intronic
1007569695 6:42880671-42880693 CTAAAAATAAAAAATCAGCTGGG - Intronic
1007865394 6:44963702-44963724 TTACAAAAAAAGTTGCAGCTGGG + Intronic
1008110020 6:47481923-47481945 CTACAAAAAAATTTTAAACTAGG - Intronic
1008205811 6:48654725-48654747 CTACATAAAAAGATTCTGAATGG - Intergenic
1008774567 6:55021588-55021610 CTACAAATACAAAATCAGCTGGG - Intergenic
1008846890 6:55977341-55977363 ATACAAAAAAAAAGTTAGCTGGG + Intergenic
1008921590 6:56848877-56848899 ATACAAAAAAAAAATTAGCTGGG + Intronic
1009215599 6:60916326-60916348 ATAAAAAAATAGATTCAGATAGG + Intergenic
1009252718 6:61327200-61327222 ATAAAAAGAAAGGTTCAGCTCGG - Intergenic
1009257404 6:61429021-61429043 ATAAAAAGAAAGGTTCAGCTCGG - Intergenic
1009388254 6:63112665-63112687 CAACAAAAAAAAAATCAGCCTGG + Intergenic
1009817415 6:68753848-68753870 CTAGAAAAAAAATTTCAACTGGG - Intronic
1009981981 6:70737300-70737322 ATACAAAAAAAAATTTAGCCAGG - Intronic
1010386566 6:75287019-75287041 CTGAAAAAAATGTTTCAGCTGGG - Intergenic
1010422308 6:75689064-75689086 CTCAAGAAAAAAATTCAGCTGGG + Intronic
1010425233 6:75722248-75722270 ATACAAAAAAAGAATTAGCTGGG - Intergenic
1010685747 6:78853614-78853636 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1010719392 6:79264710-79264732 ATACATAAAAAGAATAAGCTTGG - Intergenic
1010794468 6:80103327-80103349 CTAAAAAGAAATATTAAGCTGGG - Intergenic
1010866767 6:80984987-80985009 CTACAAAAAAATATACAAATTGG - Intergenic
1010919892 6:81668407-81668429 ATACAAAAAAAAAATTAGCTGGG + Intronic
1010974580 6:82297714-82297736 CTAAAAAAAAAAAATTAGCTGGG - Intergenic
1011179115 6:84599209-84599231 CTAGAAAACAATATTTAGCTTGG + Intergenic
1011508724 6:88076870-88076892 CTATAAAAAGAGATTAAACTTGG - Intergenic
1011764609 6:90606569-90606591 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1012120173 6:95355946-95355968 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1012195753 6:96340065-96340087 CTACTAAATAAGTTTCTGCTCGG + Intergenic
1012641626 6:101624890-101624912 AAACAAAAAAAAATTCAGCTGGG - Intronic
1012936212 6:105370239-105370261 ATACAAAAAAAAAATTAGCTGGG + Intronic
1013033533 6:106359447-106359469 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1013499343 6:110732340-110732362 ATACCAAAAAAAATTTAGCTGGG + Intronic
1013913955 6:115311671-115311693 AAAAAAAAAAAAATTCAGCTTGG - Intergenic
1014077514 6:117253074-117253096 AAAAAAAAAAAAATTCAGCTAGG + Intergenic
1014823622 6:126022202-126022224 ATACAAAAAAAAAATCAGCCAGG - Intronic
1015249659 6:131113740-131113762 ATACAAAAAAAAATTTAGCTGGG - Intergenic
1015317647 6:131834689-131834711 ATACAAAAAAAAAATTAGCTGGG - Intronic
1015371681 6:132461465-132461487 ATACAAAAAAAAAATTAGCTGGG - Intronic
1015895193 6:138010232-138010254 ATACAAAAAAAAAGTCAGCTGGG + Intergenic
1015995571 6:138992751-138992773 TTACAAAAAAAAATTTAGCTGGG + Intergenic
1016160506 6:140873638-140873660 ATACAAAAAAAGTATTAGCTGGG + Intergenic
1016360933 6:143266777-143266799 CTACAAAAAATAAATTAGCTGGG + Intronic
1016415805 6:143832499-143832521 CAACAAAAAAAGAATTAGCCAGG - Intronic
1016608184 6:145958991-145959013 ATACAAAAAAAAAGTTAGCTGGG - Intronic
1016932461 6:149424732-149424754 CTAAAAAAAAAAAATTAGCTTGG - Intergenic
1017098532 6:150826801-150826823 CTACAAAAAATGAGTTAGCCGGG - Intronic
1017530156 6:155281896-155281918 CTGAAAAAAAAGATTAAGCGTGG + Intronic
1017911044 6:158793156-158793178 CTACAAAAAATCATTCAGGCTGG + Intronic
1017918210 6:158849162-158849184 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1018536769 6:164828599-164828621 CTAAAAAAAAAAAATTAGCTGGG - Intergenic
1018701364 6:166430116-166430138 CAACAAAAAAAAAATTAGCTGGG - Intronic
1019208323 6:170382118-170382140 CTACAAAAAAAACTAGAGCTAGG + Intronic
1019303380 7:320914-320936 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1019349240 7:545917-545939 TTAAAAAAAAAAATTAAGCTGGG + Intergenic
1019462123 7:1165614-1165636 CTACAAATAAAAAATTAGCTGGG + Intergenic
1019585300 7:1798735-1798757 CTACAAAAATAAAATTAGCTGGG + Intergenic
1020089434 7:5330391-5330413 CAACAAAAAAACAATTAGCTGGG - Intronic
1020102893 7:5404955-5404977 ATACAAAAAAAAAATTAGCTGGG + Intronic
1020209951 7:6151596-6151618 ATACAAAAAAAAAATTAGCTGGG - Intronic
1020232696 7:6331899-6331921 ATACAAAAAATGAATTAGCTGGG - Intronic
1020267495 7:6570976-6570998 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1020395480 7:7711947-7711969 CTACAAAAAAAAATTAAAATCGG - Intronic
1020562152 7:9741956-9741978 ATTCAAAATAAGAATCAGCTTGG - Intergenic
1020904829 7:14052200-14052222 ATACAAAAAAAAATTTAGCTGGG + Intergenic
1020906775 7:14073369-14073391 CTAAAATAAAAGATTCAAATAGG - Intergenic
1021087521 7:16440303-16440325 GTACAAAAAAAGCTTCAGTGAGG - Intergenic
1021412446 7:20343575-20343597 TTACAAAAAAAAATTCAGGATGG + Intronic
1021689207 7:23215705-23215727 CTACAAAAAAAAATTAGGTTTGG - Intergenic
1021732755 7:23612302-23612324 ATACAAACAAAAAATCAGCTGGG + Intronic
1022047630 7:26635340-26635362 TTAAAAAAAAAAATTTAGCTGGG + Intergenic
1022576029 7:31498007-31498029 CAACAAAAAAAGTCCCAGCTGGG + Intergenic
1022917787 7:34976942-34976964 ATACAAAAAAAAAATTAGCTGGG - Intronic
1023011593 7:35928938-35928960 AAAAAAAAAAGGATTCAGCTGGG + Intergenic
1023024922 7:36041627-36041649 TTACAAAAAAAAAATTAGCTGGG + Intergenic
1023058791 7:36310508-36310530 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1023341956 7:39230322-39230344 TTAAAAAAAAAAATTTAGCTGGG + Intronic
1023430838 7:40089277-40089299 ATACAAAAAAAAAATTAGCTGGG + Intronic
1023796140 7:43793945-43793967 AAAAAAAAAAAGACTCAGCTGGG + Intronic
1024064386 7:45720353-45720375 ATACAAAAAAAAAATTAGCTGGG + Exonic
1024079551 7:45844951-45844973 AAAAAAAAAAGGATTCAGCTGGG - Intergenic
1024172131 7:46800516-46800538 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1024210253 7:47197246-47197268 CTACAAAAATTGAGTGAGCTGGG + Intergenic
1024297734 7:47859326-47859348 GTACAATAAGAGATTCAGCATGG - Intronic
1025074108 7:55927605-55927627 GTAAAAAAATAGATACAGCTGGG + Intronic
1025096524 7:56099893-56099915 CTACAAAAAATAAATCAGCCAGG - Intergenic
1025125234 7:56339019-56339041 AAAAAAAAAAGGATTCAGCTGGG + Intergenic
1025189621 7:56886752-56886774 CTACAAAAAAAGATTGAAAGTGG + Intergenic
1025607647 7:63050999-63051021 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1025682317 7:63690165-63690187 CTACAAAAAAAGATTGAAAGCGG - Intergenic
1025708009 7:63884959-63884981 CTACAAAAAAAAAAAAAGCTGGG - Intergenic
1025789192 7:64671940-64671962 ATACAAAAAAAAATTTAGCTGGG - Intronic
1025836109 7:65095070-65095092 CCAAAAAAAAAAAATCAGCTGGG - Intergenic
1025961060 7:66222222-66222244 ATACAAAAAAAGAATTAGCTGGG + Intronic
1026092899 7:67316041-67316063 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1026093130 7:67317803-67317825 CTACAAACAAAAAATTAGCTGGG + Intergenic
1026164086 7:67894604-67894626 AAACAAAAAAAGTATCAGCTGGG + Intergenic
1026217914 7:68365873-68365895 ATACAAAAAAAAAATTAGCTAGG - Intergenic
1026355408 7:69553018-69553040 CTACCAAAAAAAAATTAGCTGGG - Intergenic
1026357382 7:69570326-69570348 CTACAAAAAATAAATTAGCTGGG + Intergenic
1026495342 7:70897022-70897044 CTACAAAAACAAAATTAGCTGGG - Intergenic
1026616446 7:71909175-71909197 CTAAAAAATAAAAATCAGCTGGG - Intronic
1026618849 7:71932654-71932676 ATACAAAAAAAAAATTAGCTGGG + Intronic
1026971711 7:74472589-74472611 ATACAAAAAAAAATTTAGCCAGG + Intronic
1027026314 7:74854389-74854411 CTCCAAAAAAAAAATTAGCTGGG - Intergenic
1027045161 7:74986328-74986350 ATACAAAAAAAGAATTAGCCAGG + Intronic
1027061441 7:75089725-75089747 CTCCAAAAAAAAAATTAGCTGGG + Intergenic
1027224557 7:76235708-76235730 ATACAAAAAAAAATTTAGCTGGG + Intronic
1027422747 7:78033310-78033332 CTACAAAAAATAAATTAGCTGGG + Intronic
1027589896 7:80105510-80105532 CTACAAAAAAAAAATCGGCCAGG + Intergenic
1027772037 7:82418947-82418969 ATACAAAAAAAAAATTAGCTGGG + Intronic
1028453292 7:91010289-91010311 CTACAAAAAAAAAGCCTGCTTGG + Intronic
1028615551 7:92762726-92762748 ATACAAAAAAAAAATTAGCTGGG - Intronic
1029341120 7:99945587-99945609 ATACAAAAAAAAAATTAGCTAGG - Intergenic
1029387644 7:100254175-100254197 ATACAAAAAAAGAATTAGCCAGG - Intronic
1029418905 7:100461830-100461852 ATACAAAAAAAAATTTAGCTGGG + Intronic
1029502536 7:100941620-100941642 ATACAAAAAAAAAATTAGCTAGG - Intergenic
1029544857 7:101205310-101205332 CTACAAAAAATAAATTAGCTGGG - Intergenic
1029649582 7:101882021-101882043 ATAAAAAAAAAAAATCAGCTGGG + Intronic
1029733468 7:102452604-102452626 CTACAAAAAAAACATTAGCTGGG - Exonic
1030036565 7:105412528-105412550 CTACCAAAAAAAAATTAGCTGGG - Intergenic
1030141470 7:106308540-106308562 ATGCAAAAAAAGATACAGCAGGG - Intergenic
1031047947 7:116914620-116914642 CTACAAAAAATAAATTAGCTGGG - Intronic
1031883167 7:127219597-127219619 CTACAAAAAAATAATTAGCTGGG - Intronic
1031927271 7:127650956-127650978 CTACAAAAAAAAAATTAGCTGGG + Intergenic
1032178898 7:129658425-129658447 CTACCAAAAAAAAATTAGCTGGG + Intronic
1032232202 7:130084614-130084636 CTAAAAATAAAAAATCAGCTGGG + Intronic
1032358027 7:131228222-131228244 CTACAAAAATAAAATTAGCTGGG - Intronic
1032373884 7:131389726-131389748 ATACAAAAAAAAATTTAGCTGGG + Intronic
1032517318 7:132516791-132516813 CTACTAAAAAACAATTAGCTGGG + Intronic
1032806523 7:135360419-135360441 CTACAAAACAAAAATTAGCTGGG - Intergenic
1032807700 7:135373735-135373757 ATACAAAAAAAAAATTAGCTGGG - Intronic
1032816788 7:135483888-135483910 CTACAAAAAAACCTATAGCTAGG + Intronic
1033067145 7:138167077-138167099 ATTCAAAAAAAGAATTAGCTAGG - Intergenic
1033172728 7:139098103-139098125 AAACAAAAAAAAATTTAGCTGGG - Intronic
1033298519 7:140163443-140163465 CTACAAAAAATAAATTAGCTGGG - Intronic
1033337343 7:140464949-140464971 CTACAAAATAAAAATTAGCTGGG - Intronic
1033395819 7:140972919-140972941 ATACAAAAAAAAATTTAGCTGGG - Intergenic
1033810707 7:145007661-145007683 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1034170499 7:149059305-149059327 CTAAAAAAAAAAATACAGCTGGG + Intergenic
1034406680 7:150908664-150908686 CTACAAAAAATAAATTAGCTGGG - Intergenic
1034611558 7:152375201-152375223 CTAAAAATAAAAAATCAGCTGGG - Intronic
1034704880 7:153132314-153132336 CTATAAAAAAAAAGGCAGCTAGG + Intergenic
1035150928 7:156872484-156872506 CTAAAAATAAAAATTTAGCTGGG + Intronic
1035200487 7:157261143-157261165 ATACAAAAAAAAAATCAGCCGGG + Intronic
1035235632 7:157496108-157496130 CTAAAAACACAGAATCAGCTGGG - Intergenic
1035261527 7:157664596-157664618 CTCCAAAAAAATAATTAGCTAGG + Intronic
1035486160 7:159227746-159227768 CTACAAAAGAAGACTCAGAAAGG - Intergenic
1036458091 8:8927148-8927170 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1036517820 8:9461059-9461081 ATACAAAAAAAAATTTAGCTGGG + Intergenic
1036555369 8:9855027-9855049 AAAAAAAAAAAAATTCAGCTGGG + Intergenic
1036634939 8:10542710-10542732 ATACAAAAAAAAAATTAGCTGGG + Intronic
1036728297 8:11239877-11239899 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1036813829 8:11886533-11886555 TTAAAAAAAAAGAATTAGCTGGG - Intergenic
1036889680 8:12588191-12588213 ATACAAAAAAAAATTTAGCTGGG + Intergenic
1037481079 8:19306184-19306206 CAACAATACAAAATTCAGCTGGG + Intergenic
1037534909 8:19815185-19815207 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1037801004 8:22035770-22035792 CTAAAATACAAAATTCAGCTGGG + Intronic
1038066533 8:23968987-23969009 CTACCAAAAGAGAAGCAGCTGGG - Intergenic
1038094441 8:24292109-24292131 CTAAAAAAAAAAAATTAGCTGGG - Intergenic
1038221954 8:25617734-25617756 TTAAAAAACAGGATTCAGCTGGG + Intergenic
1038224937 8:25646869-25646891 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1038291844 8:26256752-26256774 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1038308804 8:26429233-26429255 ATACAAAAAAAAATTTAGCCAGG + Intronic
1038533054 8:28334275-28334297 CTACAGAGAAAGAGTCACCTGGG - Intronic
1038719570 8:30021756-30021778 CTACCAAAAAAAAATTAGCTGGG + Intergenic
1038747543 8:30267689-30267711 ATACAAAAAAAAAGTTAGCTGGG + Intergenic
1038773902 8:30510738-30510760 CAAAAAATAAAGATTTAGCTGGG - Intronic
1038792749 8:30683119-30683141 AAAAAAATAAAGATTCAGCTGGG - Intronic
1038797380 8:30721854-30721876 CTACAAAAAAAAAATTAGCTGGG + Intronic
1038905532 8:31897857-31897879 ATACAAAAAAAAAATGAGCTAGG + Intronic
1038974270 8:32675214-32675236 CAAGAAAAAAATATACAGCTTGG - Intronic
1039010839 8:33090994-33091016 ATACAAAAAAATAATTAGCTGGG + Intergenic
1039054399 8:33523817-33523839 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1039087244 8:33792167-33792189 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1039433290 8:37542553-37542575 CTAAAAAAAAAAAATTAGCTGGG - Intergenic
1039536753 8:38323213-38323235 GTACAAAAAAAAAATTAGCTGGG - Intronic
1039691093 8:39865597-39865619 ATACAAACAAAAATTTAGCTGGG + Intergenic
1039768213 8:40653783-40653805 ATACAAAAAAAGAGTCAGACTGG + Intronic
1039773323 8:40710939-40710961 ATACAAAAAAAAATTTATCTGGG - Intronic
1039961291 8:42249920-42249942 TAAAAAAAAAAAATTCAGCTGGG + Intergenic
1040040806 8:42915215-42915237 CTACAAAAATATAATTAGCTGGG + Intronic
1040297133 8:46158617-46158639 CTAGAAAAAAAAATTTATCTTGG - Intergenic
1040351153 8:46570101-46570123 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1040500330 8:47999515-47999537 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1040764528 8:50891375-50891397 CTATAAAAATATATTCAGCTGGG + Intergenic
1040847894 8:51863764-51863786 ATACAAAAAAAAATTTAGCTGGG + Intronic
1041042834 8:53864271-53864293 ATACAAAAAAAAAATCAGCTGGG + Intronic
1041089079 8:54285343-54285365 AAAAAAAAAAAGATCCAGCTGGG + Intergenic
1041247473 8:55902486-55902508 CTAGAAAAAAAAAATTAGCTGGG - Intronic
1041389084 8:57333079-57333101 CTACATAAGAAGTTTCATCTGGG - Intergenic
1042220221 8:66466227-66466249 AAAAAAAAAAAAATTCAGCTGGG - Intronic
1042527268 8:69776401-69776423 CTTCAAAAAAAGATTGGGCTGGG + Intronic
1042660934 8:71153625-71153647 CTACAAGATGAGATTCAGTTGGG + Intergenic
1042667956 8:71228273-71228295 TTACAAAAGAAGATTCAGAAGGG - Intronic
1042827360 8:72992403-72992425 CTACAAAAAAACAATTAGCTGGG - Intergenic
1042927103 8:73977341-73977363 ATACAAAAAAAAAATCAGCCGGG - Intronic
1043270933 8:78332057-78332079 AAAAAAAGAAAGATTCAGCTTGG - Intergenic
1043397259 8:79851132-79851154 TTATAAGAAGAGATTCAGCTGGG + Intergenic
1043402893 8:79901289-79901311 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1043460053 8:80450548-80450570 TTAAAAAAAAATTTTCAGCTGGG + Intergenic
1043621919 8:82204275-82204297 TTAAAAAAAAAAAGTCAGCTAGG + Intergenic
1044335375 8:90977784-90977806 ATACAAAAAAAAAATTAGCTAGG + Intronic
1044415110 8:91929607-91929629 AAAAAAAAAAAAATTCAGCTGGG - Intergenic
1044577444 8:93785907-93785929 CTACAAAAAAAAATTTAGCTTGG + Intronic
1044698481 8:94946534-94946556 CTACAAAAAATAAATTAGCTGGG + Intronic
1044715879 8:95099077-95099099 CTACAAATAAAAAATTAGCTGGG + Intronic
1045011742 8:97964597-97964619 CTACAAAAAATAAATTAGCTGGG - Intronic
1045220128 8:100190823-100190845 ATACAAAAAAAAAATTAGCTTGG - Intronic
1045230737 8:100304115-100304137 ATACAAAAAAAAATTTACCTAGG - Intronic
1045453615 8:102353868-102353890 CCACAAAAAAATAATTAGCTGGG + Intronic
1045850476 8:106691072-106691094 CTACAAAAAAAGATAACTCTAGG + Intronic
1046775702 8:118161417-118161439 CTACCAAAAAAAAATTAGCTGGG + Intergenic
1047072713 8:121364771-121364793 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1047109589 8:121774231-121774253 GTACAAAAAAAAAATTAGCTGGG + Intergenic
1047368289 8:124232906-124232928 CCACAACAAAAGCTGCAGCTAGG - Intergenic
1047429469 8:124778600-124778622 ATACAAAAAAAAAATTAGCTAGG - Intergenic
1047685534 8:127301689-127301711 CTAGAAAAAAATATTCAGTGAGG - Intergenic
1047985347 8:130227411-130227433 ATACAAAAAAAAAATTAGCTGGG - Intronic
1048012287 8:130467459-130467481 AAAAAAAAAAAGATTTAGCTTGG + Intergenic
1048253844 8:132889935-132889957 GTACAAAAAAAAAATTAGCTGGG - Intronic
1048515233 8:135102211-135102233 ATACAAAAAAATAATTAGCTGGG - Intergenic
1048624780 8:136173036-136173058 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1049171507 8:141164318-141164340 TTACAAAAAAATAATCACCTTGG + Intronic
1049713250 8:144076908-144076930 CTACAAAAAAAAAGTTAGCAGGG + Intergenic
1049722374 8:144125076-144125098 ATACAAAAAAAAATTTAGCCAGG + Intergenic
1049730187 8:144173261-144173283 CTACAAAAAAAAAATTAGCCAGG - Intronic
1049858173 8:144877245-144877267 CTACAAAAAAAAAATTAGCTGGG - Exonic
1049908640 9:244025-244047 ATACAAAAAAAAATTTAGCCGGG + Intronic
1049961717 9:743699-743721 CTACAAAAAAAAAATTATCTAGG + Intronic
1049962245 9:747973-747995 CTACAAAAGAAAAATTAGCTGGG + Intergenic
1049963293 9:756659-756681 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1050171739 9:2826713-2826735 ATACAAAAAAAAAATTAGCTTGG - Intronic
1050361079 9:4831632-4831654 CTACTAAAAAAAAATAAGCTGGG - Intronic
1050524508 9:6533915-6533937 TTAAAAAAAAAGCATCAGCTGGG + Intronic
1051199300 9:14598916-14598938 TAACAAAAAAAAATTTAGCTAGG - Intergenic
1051668469 9:19487288-19487310 CTATAAAAAAAGAATTAGCCAGG + Intergenic
1051933208 9:22411652-22411674 CTACATAAAAAAAGTTAGCTGGG + Intergenic
1052000114 9:23268333-23268355 ACAGAAAAAAAGATTCTGCTTGG + Intergenic
1052101738 9:24455251-24455273 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1052258328 9:26485483-26485505 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1052415053 9:28167539-28167561 TAACAAAAAAAGAATTAGCTGGG - Intronic
1053207773 9:36201948-36201970 CTAAAAAAAAAAAATTAGCTGGG + Intronic
1053657961 9:40239302-40239324 TTAAAAAAAGATATTCAGCTGGG - Intronic
1054370082 9:64385578-64385600 TTAAAAAAAGATATTCAGCTGGG - Intronic
1054526635 9:66136919-66136941 TTAAAAAAAGATATTCAGCTGGG + Intronic
1054677713 9:67875332-67875354 TTAAAAAAAGATATTCAGCTGGG - Intronic
1055159901 9:73113719-73113741 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1055424029 9:76174465-76174487 ATACAAAAAAAAAATTAGCTGGG - Intronic
1055442151 9:76347183-76347205 CTACACAGAAAGATGCAGCTTGG - Intronic
1055587931 9:77775568-77775590 ATACAAAAAAAAATTTAGCTGGG - Intronic
1055624859 9:78165872-78165894 CAACAAACAAAAAATCAGCTGGG - Intergenic
1055952694 9:81744911-81744933 CTACAAAAAAAAAATTAGCTAGG - Intergenic
1056130185 9:83577188-83577210 CTGGAAAAAAAAAGTCAGCTGGG - Intergenic
1056645686 9:88409675-88409697 ATACAAAAAAAAAATTAGCTGGG + Intronic
1057118056 9:92544874-92544896 ATACAAAAAAAAATTTAGCTGGG - Intronic
1057165515 9:92922070-92922092 CTACAAAAAAAATATTAGCTGGG - Intergenic
1057464622 9:95301586-95301608 CTAGAAAAAAAGAATTAGCTGGG - Intronic
1057959591 9:99441497-99441519 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1058055139 9:100441476-100441498 CTACAAAAAAAAAATTAGCCGGG + Intronic
1058325853 9:103696671-103696693 GTTAAAAAAAAAATTCAGCTGGG - Intergenic
1058378956 9:104357852-104357874 TTACAAAAAAAAATTTAGCCAGG + Intergenic
1059026185 9:110633827-110633849 CAACAAATAAAGGTTCAACTGGG - Intergenic
1059147923 9:111918762-111918784 ATACAAAAAAAAAATTAGCTGGG + Intronic
1059417749 9:114172412-114172434 CTACAAAAACAGGCTCAGCATGG - Intronic
1060530140 9:124343158-124343180 CTCCAACAAATGAGTCAGCTCGG - Intronic
1060640408 9:125233497-125233519 ATACAAAAAAAAAATTAGCTGGG - Intronic
1060835410 9:126751978-126752000 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1060853970 9:126900158-126900180 ATACAAAAAAAAAGTTAGCTGGG + Intergenic
1061018569 9:127998295-127998317 ATACAAAAAAAAAATAAGCTGGG - Intergenic
1061021526 9:128018731-128018753 CTAAAAAAAAAAATTGAGCTGGG - Intergenic
1061044159 9:128155485-128155507 ATACAAAAAAAAAATTAGCTAGG - Intergenic
1061107172 9:128540053-128540075 CTACAAAAAAAAAATTAGCCAGG + Intronic
1061214812 9:129215558-129215580 CGAAAAAAAAAAAATCAGCTGGG + Intergenic
1061315639 9:129794163-129794185 CTACTAAACAAAAATCAGCTGGG + Intergenic
1061494749 9:130966090-130966112 ATACAAAAAAAAAATCAGCCGGG + Intergenic
1061531259 9:131215313-131215335 CAACAAAAACCCATTCAGCTCGG + Exonic
1061619156 9:131799889-131799911 CTACAAAAAAAAAATTAGCTGGG - Intergenic
1062705678 9:137939640-137939662 ATACAAAAAAAAAATTAGCTGGG + Intronic
1203703970 Un_KI270742v1:20098-20120 TTTAAAAAAAATATTCAGCTGGG - Intergenic
1203538264 Un_KI270743v1:63046-63068 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1185615801 X:1421118-1421140 ATACAAAAAAAAAATTAGCTGGG - Intronic
1185665961 X:1765873-1765895 TTAAAAAAAAAAATGCAGCTGGG + Intergenic
1185870302 X:3659099-3659121 CTACAATAAAAGAATCAGCCAGG + Intronic
1185879354 X:3726792-3726814 CTACAAAAAAAAAATTAGCTGGG + Intergenic
1185948129 X:4401099-4401121 CCCCAAAAAAAGAAGCAGCTGGG + Intergenic
1186400435 X:9253712-9253734 CTACATAAAAAAATTTAGCTGGG + Intergenic
1186406404 X:9307852-9307874 ATACAAAAAAACAATTAGCTGGG - Intergenic
1186872370 X:13785441-13785463 ATACAAAAAAAAATTTAGCTGGG - Intronic
1186893131 X:13979843-13979865 CAACAAAAAAGAAATCAGCTGGG - Intergenic
1186978524 X:14934008-14934030 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1187483528 X:19680217-19680239 ATACAAAAAAAAATTAAGCTGGG + Intronic
1187702661 X:21978277-21978299 CAACAAAGAAATAATCAGCTGGG + Intronic
1187712476 X:22067991-22068013 TTACAAAAAAAAAATTAGCTGGG - Intronic
1187856803 X:23644671-23644693 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1187911774 X:24118101-24118123 ATACAAAAAAAGAATTAGCCAGG - Intergenic
1188002735 X:24997490-24997512 CTTCAAAAAGAGATGCTGCTGGG - Intergenic
1188156232 X:26746738-26746760 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1188742225 X:33800069-33800091 ATACAAAAAAAAAATTAGCTTGG - Intergenic
1188861186 X:35258828-35258850 CTACAACAAAAGATTTATTTGGG + Intergenic
1188984236 X:36755190-36755212 CTACAAAATAAAAATTAGCTGGG - Intergenic
1189041977 X:37552145-37552167 ATACAAAAAAAAATTTAGCTGGG + Intronic
1189453282 X:41159688-41159710 CTACAAAAAAAAAATTAGCCGGG - Intronic
1189951175 X:46232747-46232769 ATACAAAAAAAAAATTAGCTAGG + Intergenic
1189972596 X:46433392-46433414 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1190046901 X:47119296-47119318 TTAAAAAAAAAAATTTAGCTGGG - Intergenic
1190080408 X:47352708-47352730 CTACAAATAAAAAATTAGCTGGG + Intergenic
1190093808 X:47462887-47462909 ATACAAAAAAAAAATCAGCCGGG - Intronic
1190158161 X:48010277-48010299 ATACAAAAAAAAATTTAGCCGGG + Intronic
1190173932 X:48133160-48133182 ATACAAAAAAAAATTTAGCCGGG + Intergenic
1190232709 X:48594731-48594753 CTACAAAAATAAAATTAGCTGGG - Intronic
1190552569 X:51599815-51599837 CCACAAAAAAAGAGTCTTCTTGG + Intergenic
1190770807 X:53512625-53512647 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1190821455 X:53977171-53977193 CTAGAAAAAAAAAATTAGCTGGG + Intronic
1190826081 X:54019300-54019322 ATACAAAAAAAAAATTAGCTGGG + Intronic
1190837138 X:54111541-54111563 CTACAAAAAAAAAAACACCTAGG + Intronic
1191169575 X:57429176-57429198 ATACAAAAAAAAAATTAGCTGGG + Intronic
1191841629 X:65517406-65517428 ATACAAAAAAAAAATTAGCTGGG - Intronic
1192107671 X:68331568-68331590 CTAAAAAAACAAAATCAGCTGGG + Intronic
1192116780 X:68419166-68419188 ATACAAAAAAAAAATTAGCTGGG - Intronic
1192123809 X:68481945-68481967 CAAAAAAAAAAAATTCAGCGGGG - Intergenic
1192431667 X:71116620-71116642 CAACAAAAAAATATTTAGCTGGG + Intergenic
1192492056 X:71584705-71584727 ATACAAAAACAAATTTAGCTGGG + Intronic
1192703755 X:73505882-73505904 CTACAAACAAAAATTTTGCTGGG + Intergenic
1192708874 X:73558599-73558621 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1192890340 X:75383897-75383919 ATACAAAAAAAAAATTAGCTGGG - Intronic
1193090475 X:77488660-77488682 CTACAAAAAATAAATTAGCTGGG + Intergenic
1193126308 X:77874276-77874298 TTTAAAAAAAAGATGCAGCTGGG - Intronic
1193331846 X:80243585-80243607 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1193797599 X:85895442-85895464 CTACAAAGAAACATTGACCTGGG - Intronic
1194311947 X:92321351-92321373 ATACAAAAAAAAAATTAGCTGGG - Intronic
1194579753 X:95657533-95657555 GAACAAAAAAAGATTTAGCATGG + Intergenic
1194786304 X:98088081-98088103 CAAAAAAAAAAAATTCAGGTTGG - Intergenic
1195015991 X:100781594-100781616 ATACAAAAAGATATTCACCTAGG - Intergenic
1195268503 X:103207693-103207715 CTACAAAAAAAAAATTAGCCAGG - Intergenic
1195416460 X:104625362-104625384 GTACATAAAAAAATACAGCTTGG + Intronic
1195429940 X:104777735-104777757 ATACAAAAAAAAAATTAGCTGGG - Intronic
1195787278 X:108540733-108540755 ATAGAAATAAACATTCAGCTGGG - Intronic
1195953623 X:110305820-110305842 TTAAAAAAAAAAAATCAGCTGGG + Intronic
1196063431 X:111435963-111435985 CAACAAAAAAATATTCAGTATGG - Intergenic
1196291240 X:113943780-113943802 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1196414973 X:115461551-115461573 CTACAAAAGAAAAATTAGCTGGG + Intergenic
1196666953 X:118326990-118327012 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1196705386 X:118712918-118712940 ATACAAAAAAAGAATTAGCCAGG - Intergenic
1196720720 X:118851245-118851267 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1196785087 X:119415078-119415100 ATACAAAAAAAAATTTAGCTGGG - Intronic
1196842884 X:119874715-119874737 GTACAAAAAAAAATTTAGCTGGG - Intronic
1196922626 X:120600342-120600364 ATACAAAAAAAAAATTAGCTGGG + Intronic
1197249645 X:124201649-124201671 CTACGAAAAAAAAATTAGCTGGG + Intronic
1197508380 X:127337840-127337862 CTACAAAAAAAAATTAAAATGGG - Intergenic
1197704221 X:129622457-129622479 CTACAAAAAATAAATCAGCCGGG + Intergenic
1198066899 X:133107106-133107128 CCACAATAATAGACTCAGCTTGG + Intergenic
1198194123 X:134342953-134342975 CTAGAAAAAAAAAATCAGCCGGG - Intergenic
1198455573 X:136814398-136814420 CTAGAACAAAACTTTCAGCTAGG - Intergenic
1198508224 X:137322860-137322882 CCACAAACAAAGAATCAGCAGGG - Intergenic
1198855155 X:141007867-141007889 ATACAAAAAAAAAATTAGCTGGG + Intergenic
1198907536 X:141579502-141579524 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1198909255 X:141594922-141594944 ATACAAAAAAAAAATTAGCTGGG + Intronic
1199001151 X:142637975-142637997 GTAAAAAAAAAAATTCAGGTTGG + Intergenic
1199282724 X:146021436-146021458 ATACAAAAAAAAAATTAGCTGGG - Intergenic
1199653476 X:149971379-149971401 CTACAAAAAAAAAAACAGCCAGG - Intergenic
1199934851 X:152562657-152562679 CTACAAAATGAGATTTAGGTGGG - Intergenic
1200341119 X:155396910-155396932 ATACAAAAAAGGAATTAGCTGGG - Intergenic
1200793742 Y:7321989-7322011 CTACAATAAAAGAATCAGCCAGG - Intergenic
1201306550 Y:12555746-12555768 CTAAAAAAAAAAAATTAGCTGGG + Intergenic
1201411935 Y:13707247-13707269 CTTTATAAAAACATTCAGCTGGG - Intergenic
1201529950 Y:14980597-14980619 CTGGAAAAAAAGATTCACCTGGG + Intergenic
1201904975 Y:19078214-19078236 CTACAAACAAACGTCCAGCTGGG + Intergenic
1202590180 Y:26474248-26474270 CTAGAAATAAAAATTTAGCTGGG + Intergenic