ID: 969160702

View in Genome Browser
Species Human (GRCh38)
Location 4:5256131-5256153
Sequence CAGTATCTGCATCTCTAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1639
Summary {0: 1, 1: 0, 2: 13, 3: 166, 4: 1459}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969160702_969160703 -9 Left 969160702 4:5256131-5256153 CCATGTTAGAGATGCAGATACTG 0: 1
1: 0
2: 13
3: 166
4: 1459
Right 969160703 4:5256145-5256167 CAGATACTGAGCCTAGAGAGAGG 0: 1
1: 1
2: 2
3: 21
4: 217
969160702_969160710 26 Left 969160702 4:5256131-5256153 CCATGTTAGAGATGCAGATACTG 0: 1
1: 0
2: 13
3: 166
4: 1459
Right 969160710 4:5256180-5256202 CGGGACCACACAGTTATCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 62
969160702_969160706 7 Left 969160702 4:5256131-5256153 CCATGTTAGAGATGCAGATACTG 0: 1
1: 0
2: 13
3: 166
4: 1459
Right 969160706 4:5256161-5256183 AGAGAGGACATGACCTTCCCGGG No data
969160702_969160705 6 Left 969160702 4:5256131-5256153 CCATGTTAGAGATGCAGATACTG 0: 1
1: 0
2: 13
3: 166
4: 1459
Right 969160705 4:5256160-5256182 GAGAGAGGACATGACCTTCCCGG 0: 1
1: 0
2: 4
3: 19
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969160702 Original CRISPR CAGTATCTGCATCTCTAACA TGG (reversed) Intronic
900834236 1:4987813-4987835 CAGTTTCTTCATCTGTAAAATGG + Intergenic
900978095 1:6029670-6029692 CAGTTTCTCCATCTGTAAAATGG - Intronic
901223174 1:7595662-7595684 CAGTTTCCCCATCTCTAAAATGG - Intronic
901303031 1:8213352-8213374 CAGTTTCTTCATCTGTAAGATGG - Intergenic
901390229 1:8940854-8940876 CACTATTAGCATTTCTAACATGG - Intergenic
901523273 1:9802062-9802084 CAGTTTCTTCATCTGTAAAATGG - Intronic
901583765 1:10269037-10269059 CTCTATCTGCATCCCTAAGAAGG + Intronic
901787313 1:11633199-11633221 CAGTTTCTTCATCTCAAAAATGG + Intergenic
901811376 1:11768516-11768538 CAGTCTCTTTATCTCTAAAATGG + Intronic
901862084 1:12080996-12081018 CAGTTTCCTCATCTGTAACATGG + Intronic
901878347 1:12179806-12179828 CAATGTCTGCATCTGTAAAATGG + Intronic
902192780 1:14775170-14775192 CACTCTCTGCATCTGTAAAATGG - Intronic
902194204 1:14785669-14785691 CAGTCTCCTCATCTCTAAGATGG + Intronic
902209870 1:14896926-14896948 CAGTTTCTTCATCTGTAAAATGG + Intronic
902254791 1:15181138-15181160 CAGTTTCTTCATCTTTAAAATGG + Intronic
902291303 1:15437059-15437081 CAGTTTCCCCATCTCTAAAATGG - Intergenic
902408506 1:16199500-16199522 CAGTTTCTGCCTCTATACCAAGG + Intronic
902628220 1:17689054-17689076 CAGTGTCTGCATCTGTAATGTGG - Intronic
902638641 1:17751613-17751635 CAGTTTCTTCATCTGTAAAATGG - Intergenic
902638866 1:17753422-17753444 CAGTTTCTTCATCTGTAAAATGG + Intergenic
902650947 1:17837211-17837233 CAGTGTCTGCATCTCCCAAATGG - Intergenic
902662399 1:17914141-17914163 CAGTTTCTTCATCTGTAAAATGG + Intergenic
902705909 1:18204213-18204235 CAGTTTCTTCATCTGTAAAATGG - Intronic
902748257 1:18488020-18488042 CAATACCTGCATCTGTAAAATGG + Intergenic
902791041 1:18768254-18768276 CAGTTTCTTCATCTTTAAAATGG - Intergenic
902821611 1:18946773-18946795 CAGTTTTAGCATCTCTAAAATGG + Intronic
902843296 1:19089195-19089217 CAGTATTTCCATCTATAAAATGG + Intronic
902990314 1:20183212-20183234 CAGTTTCCGCATCTCTAGAATGG - Intergenic
903016203 1:20363711-20363733 CAGTATCTCCATCCATAAAATGG - Intergenic
903129621 1:21270221-21270243 CAGTTGCTGCATCTATAAAATGG + Intronic
903133849 1:21296656-21296678 CAGTCTCTGCATCTGTAAAATGG - Intronic
903278519 1:22236733-22236755 CAGTATCTTCATCTGTAAAATGG + Intergenic
903343121 1:22667248-22667270 CAGTTTCTTCATCTGTCACATGG + Intergenic
903359560 1:22768268-22768290 CAGTTTCCTCATCTGTAACATGG + Intronic
903361896 1:22782192-22782214 CAGTTTCTTCATCTATAAAATGG + Intronic
903364717 1:22798936-22798958 CAGTATCTACATGTCTAAGGTGG + Intronic
903374036 1:22854612-22854634 CAGTTTCCTCATCTCTAAAATGG + Intronic
903380659 1:22894815-22894837 CAGTTTCTTCATCTGTAAAATGG + Intronic
903453298 1:23469759-23469781 CAGTTTCTTCATCTGTAAGATGG - Intronic
903464779 1:23544570-23544592 CAGTTTCTTCATCTATAAAATGG - Intergenic
903563254 1:24245121-24245143 CAGTCTTTTCATCTCTAAAATGG + Intergenic
903668815 1:25023592-25023614 CAGTTTCTTCATCTGTAAAATGG - Intergenic
903672797 1:25046443-25046465 CAGTTTCTGCATCTTTAAAATGG - Intergenic
903686847 1:25138044-25138066 CAGTTTCTGTATCTGTAAAATGG + Intergenic
903804750 1:25997475-25997497 CAGTTTCTTCCTCTCTAAAACGG - Intronic
903871750 1:26440452-26440474 CAGTTTCTTCATCTATAAAATGG + Intronic
903885105 1:26536516-26536538 CAGTTTCCCCATCTGTAACATGG - Intronic
903968677 1:27105184-27105206 CAGTTTCTGCATCTGTAAAATGG - Intronic
904131457 1:28278750-28278772 CAGTTTCCTCATCTATAACATGG + Intronic
904273191 1:29363684-29363706 CAGCTTCTGCATCTGTAAAATGG - Intergenic
904277997 1:29396597-29396619 CAGTTTCTGCCTCTGTAAAATGG + Intergenic
904403079 1:30269653-30269675 CAGTTTCTCCATCTATAAAATGG + Intergenic
904426011 1:30423656-30423678 CAGTTTCTTCATCTATAAAATGG - Intergenic
904474884 1:30758321-30758343 CAGTTTCTTCATCTGTAAAATGG - Intergenic
904483184 1:30806838-30806860 CAGTATCCTCATCTGTAAGATGG - Intergenic
904592070 1:31620455-31620477 CAGTTTCCTCATCTGTAACAGGG + Intronic
904636555 1:31886013-31886035 CAGTTTCTTCATCTATAAAATGG - Intergenic
904685289 1:32255264-32255286 CAGTCTTTGCATCTGTAAAATGG + Intronic
904698295 1:32342870-32342892 CAGTATCCTCATCTATAAAATGG + Intergenic
904978658 1:34478352-34478374 CAGTTTCTGCATCTGTAAAGTGG - Intergenic
905044616 1:34985681-34985703 CAGTATCTGCATCTGTATATGGG + Intronic
905173377 1:36122234-36122256 CAGTTTCCCCATCTCTAAAATGG - Intronic
905279439 1:36839657-36839679 CAGTTTCTGCATCTGTAAAAGGG - Intronic
905279962 1:36842775-36842797 CACTTTCTGCATCTATAAAATGG - Intronic
905337332 1:37254172-37254194 CAGTTTCTTCATCTATAAAATGG + Intergenic
905348744 1:37329828-37329850 CAGTATTTTTATCTCTAAAATGG - Intergenic
905475653 1:38225862-38225884 CAGTTTCTTCATCTGTAAAATGG - Intergenic
905621461 1:39451762-39451784 CAGTTTCTTCATCTGTAAAATGG - Intronic
905646604 1:39628990-39629012 CAGTTTCCTCATCTCTAAAATGG - Intronic
905857631 1:41324557-41324579 CAGTTTCCTCATCTATAACAAGG + Intergenic
905988566 1:42311792-42311814 CAGTTTCTTCATCTGTAACGTGG + Intronic
906015476 1:42575003-42575025 CAGTTTCTTCATCTGTAATATGG - Intronic
906110731 1:43320301-43320323 CAGTGTCTTCATCTGTAAAATGG + Intronic
906199473 1:43949826-43949848 CACTGTCAGCAGCTCTAACAGGG - Exonic
906212313 1:44019070-44019092 CAGTTTCTCCATCTCTAAAACGG + Intronic
906241320 1:44243986-44244008 CAGTTTCTTCATCTATAAAATGG + Intronic
906312383 1:44763115-44763137 CAGTTTTTGCATCTCTGAAATGG + Intronic
906490650 1:46265890-46265912 TAGTTTCTTCATCTCTAAAATGG + Intronic
906656410 1:47551690-47551712 CTGCATCTGCATCTGCAACATGG - Intergenic
906929089 1:50151062-50151084 AAGTTTCTGCATCTGTAAAATGG - Intronic
907247167 1:53115689-53115711 CAGGATCTCCATCTGTAAAATGG + Intronic
907321570 1:53606055-53606077 CAGTTTCTTCATCTATAAAATGG + Intronic
907327784 1:53652128-53652150 CAGTGTCTTCATCTGTAAAACGG + Intronic
907395410 1:54186275-54186297 CAGTTTCTTCATCTGTAAAATGG + Intronic
907716460 1:56930705-56930727 CAGTTTCTTCATCTATAAAATGG + Intronic
907732523 1:57081180-57081202 CAGTTTCTTCATCTGTAAAATGG + Intronic
907766572 1:57418419-57418441 CAGTCTCTGCATCTCTTGAATGG - Intronic
907783742 1:57591621-57591643 CAGTTTCTTCATCTGTAAAATGG + Intronic
907825233 1:58010224-58010246 CAGTGTCTGCATCTCTAAGGTGG - Intronic
907846493 1:58213218-58213240 CAGTTTCCACATCTCTAAGAGGG + Intronic
907857721 1:58320450-58320472 CAGTTTCTCCATCTCTAAAATGG - Intronic
907928842 1:58980135-58980157 CAGTTTCCCCATCTCAAACATGG - Intergenic
907978724 1:59459884-59459906 GATTATCTGCATTACTAACAGGG + Intronic
908078492 1:60547618-60547640 CTGTTTCTTCATCTCTAAAATGG - Intergenic
908104196 1:60824672-60824694 CAGTTTCTTCATCTATGACATGG - Intergenic
908113435 1:60919046-60919068 CAGTTTCTGCATATGTAAAATGG - Intronic
908148218 1:61270288-61270310 CAGTTTCTTCATCTGTAAAATGG - Intronic
908333782 1:63098697-63098719 CAGTATTTGCATCTATGAAATGG + Intergenic
908556274 1:65259733-65259755 TAGAATTTGCATTTCTAACAAGG - Intronic
908573284 1:65432378-65432400 CAGATTCTGCATTTCTAATAAGG - Exonic
908799922 1:67869034-67869056 GAGATTCTGCATTTCTAACATGG + Intergenic
909166077 1:72227165-72227187 CAGTTTCCTCATCTCTAAAATGG + Intronic
909324214 1:74329203-74329225 CAGTTTCTTCATCTTTAAAATGG + Intronic
909346991 1:74601856-74601878 CAGTTTCTCCATCTGTAACATGG + Intronic
909537914 1:76759019-76759041 CAGTTTCTTCATCTGTAAAATGG + Intergenic
909667872 1:78155631-78155653 CAGTATATGCATCTTTTTCATGG - Intergenic
909891377 1:81011818-81011840 CAGTTTCTTTATCTCTAAAATGG - Intergenic
909941748 1:81619190-81619212 CAGTCTCTGCATGTATATCAAGG - Intronic
910298536 1:85678415-85678437 CAGTTTCTCCATCTGTAAAATGG + Intronic
910366332 1:86469251-86469273 CAGTTTCTTCATCTGTAAAATGG + Intronic
910528439 1:88208284-88208306 CAGTTTCTGATTCTCTAAAATGG - Intergenic
911039288 1:93579299-93579321 CACAATCAGCATCTCTAAGAGGG - Intronic
911404545 1:97420257-97420279 CAGTATCTGCATCTGGAAGACGG - Intronic
911419181 1:97617761-97617783 GAGTTTCTGCATTTCTCACATGG - Intronic
911883191 1:103267584-103267606 CAGTATCTGCTTCTGCAGCAGGG - Intergenic
912069546 1:105792512-105792534 CAGGATTTGCATCACTAATATGG - Intergenic
912162237 1:106999301-106999323 CAGTTTTTGCATCTGTAAAATGG - Intergenic
912253649 1:108036824-108036846 CAGTTTCTCCATCTGTAAAATGG + Intergenic
912493602 1:110076972-110076994 CAGTTTCTTCATCTGTAAAATGG - Intergenic
912527903 1:110298391-110298413 CAGTTTCTTCATCTATAAGATGG + Intergenic
912570029 1:110614623-110614645 CAGTTTCTTCATCTGTAAAATGG + Intronic
912758302 1:112343265-112343287 CAGTTTCTGCATGTGTAAAATGG + Intergenic
912930158 1:113950862-113950884 CAGTTTCTTCATCTGTAAAATGG + Intronic
913014846 1:114722366-114722388 CAGTTTCTTCATCTTTAAAATGG - Intronic
913074607 1:115331225-115331247 CAGTTTCTTCATCTGTAAAAGGG - Intronic
913169512 1:116219604-116219626 CAGTTTCTTCATCTGTAAAATGG + Intergenic
913245844 1:116869352-116869374 CATTATATGCATCTCAAACTGGG + Intergenic
913288610 1:117251292-117251314 CAGTTTCTTCATCTGTAAAATGG - Intergenic
913564514 1:120058751-120058773 CAATATCTTCATCTTTAAAATGG + Intronic
913633616 1:120734813-120734835 CAATATCTTCATCTTTAAAATGG - Intergenic
914227016 1:145728948-145728970 CAGTATCTGGATCTCAAACCTGG - Intronic
914285101 1:146218100-146218122 CAATATCTTCATCTTTAAAATGG + Intronic
914380173 1:147108611-147108633 CAGCATCCTCAGCTCTAACACGG + Intergenic
914546132 1:148668839-148668861 CAATATCTTCATCTTTAAAATGG + Intronic
914620432 1:149401826-149401848 CAATATCTTCATCTTTAAAATGG - Intergenic
914954670 1:152150567-152150589 CAGTTTTTGCATCTGTAAAATGG - Intergenic
915249257 1:154576817-154576839 CAGTTTCTTCATCTGCAACATGG - Exonic
915522320 1:156454743-156454765 GAGTCTCTTCATCTCTAACATGG + Intergenic
915545201 1:156593050-156593072 CAGTATCTTCATCTGTAAAATGG - Intronic
916376825 1:164164068-164164090 CAGTTTCTGCATCTATAAAAAGG + Intergenic
916473880 1:165149783-165149805 CTGTAACTGCAGCTCTATCACGG - Intergenic
916520986 1:165563340-165563362 GAGATTCTGCATTTCTAACAAGG + Intronic
916757445 1:167786438-167786460 AAGTTTCTTCATCTCTAAAATGG - Intronic
917454872 1:175177654-175177676 CAGTTTCTTCATCTCCAAAATGG + Intronic
917523528 1:175767593-175767615 CAGTTTCTTCATCTTTAAAATGG + Intergenic
917628979 1:176874578-176874600 CAATTGCTGCATCTATAACATGG + Intronic
917687551 1:177432572-177432594 CAGTTTTTGCATCTCTGCCAAGG + Intergenic
917736985 1:177930391-177930413 CAGTTTCTGCATCTGTAAAGTGG - Intronic
917922630 1:179763738-179763760 CAGTTTCTGCATCTGTAAAATGG - Intronic
917926340 1:179792112-179792134 CAGTTTCTTCATCTGTAAAATGG + Intronic
918247591 1:182673323-182673345 CAGTTTTTTCATCTGTAACATGG - Intronic
918251821 1:182709808-182709830 CAGTTTCTTCATCTGTAAAATGG + Intergenic
918429296 1:184442108-184442130 CAGTATATTCATCTGTAAAATGG + Intronic
918450518 1:184653207-184653229 CATTATCTCCATCTTAAACAAGG - Intergenic
918595724 1:186290642-186290664 AACTATTTGCATCTCTAAAACGG - Intergenic
919102850 1:193115559-193115581 CTGTATCTTCATCTCTTTCACGG - Intergenic
919726218 1:200886219-200886241 CAGTTTCTTCATCTGTAAAATGG - Intergenic
919955139 1:202406640-202406662 GAGTTTCTTCATCTGTAACATGG + Intronic
919980802 1:202642119-202642141 CAGTATCTTCATCTGGAAAATGG - Intronic
920102821 1:203528639-203528661 CAGTGTCTTCATCTGTAAAATGG - Intergenic
920176085 1:204102797-204102819 CAGTTTCTCTATCTCTAAAATGG - Intronic
920214679 1:204353705-204353727 CAGTATCCTCATCTCTAAAATGG - Intronic
920223503 1:204421675-204421697 CAGTTTCTTCATCTGTAAAATGG + Intergenic
920518389 1:206603395-206603417 CAGTTTCTTCATCTCTGAAATGG + Intronic
920672670 1:208016362-208016384 CAGTTTCCCCATCTCTAAAATGG + Intergenic
920760116 1:208775427-208775449 CAGTTTCCTCATCTCTAAAAGGG + Intergenic
921258298 1:213362450-213362472 CAGTTTCTTCATCTGTAAAAGGG - Intergenic
921425212 1:214993466-214993488 CAGTTTCTGTATCTGTAAAATGG - Intergenic
921651096 1:217679343-217679365 CAGTTTCTTCATTTTTAACATGG + Intronic
921722087 1:218483744-218483766 CAGTTTCTTCATCTTTAAAATGG - Intergenic
921900061 1:220440670-220440692 AAGCATTTGCATTTCTAACAAGG + Intergenic
921991740 1:221374093-221374115 CAGTTTCTTCATCTCTAAAGTGG - Intergenic
922080046 1:222287099-222287121 CAGTTTCTCCATCTATAAAATGG - Intergenic
922216083 1:223521333-223521355 CAGTTTCTTCATCTGTAAAATGG - Intergenic
922412380 1:225389242-225389264 CAGTTTCCTCATCTCTAAAATGG - Intronic
922462279 1:225823071-225823093 CAGTAGCTGCATCTGTAAAATGG - Intronic
922481712 1:225943956-225943978 CAGTTTCTTCATCTATAAAAAGG - Intergenic
922560945 1:226569157-226569179 CAGTTTCTTCATCTGTAAAATGG + Intronic
922564445 1:226592478-226592500 CAGTTTCTGTATCTGTAAAATGG + Intronic
922627615 1:227065374-227065396 CACTCTCTGCTTCTCTAACTTGG - Intronic
922778140 1:228226959-228226981 CAGTTTCCTCATCTGTAACATGG + Intronic
922940013 1:229455002-229455024 CAGTTTGTTCATCTATAACAAGG - Intronic
923377724 1:233381252-233381274 CAGTTTCTTCATCTATAAAATGG + Intronic
923835610 1:237607866-237607888 CAGTTTCTGCATCTATAAAATGG + Intronic
923864170 1:237921081-237921103 CAGTTTCTTCCTCTTTAACATGG + Intergenic
924013703 1:239696162-239696184 CAGTTTCTGCATCATTAAGATGG + Intronic
924030068 1:239877594-239877616 CAGTCTCTGCATCTATAAAATGG - Intronic
924077493 1:240355517-240355539 CAGTCTCTTCATCTGTAAAATGG - Intronic
924196519 1:241613309-241613331 CAGTTTCTTCATCTGTAAAATGG - Intronic
924260153 1:242221739-242221761 CAGAATCTGAATATCTAAAATGG + Intronic
924303482 1:242663723-242663745 CAGTTTCTCCATCTGTAAAATGG - Intergenic
924812720 1:247417291-247417313 CAGTTTATGCATCTATAAAATGG + Intronic
1063168850 10:3487801-3487823 CCGTCTCTGCATCTTTAAAATGG - Intergenic
1063220117 10:3959507-3959529 CAGGCTCTGTTTCTCTAACACGG + Intergenic
1063719521 10:8565905-8565927 CAGTTTCCGCATCTGTAAAATGG + Intergenic
1063909911 10:10819111-10819133 CTGTATTCTCATCTCTAACATGG + Intergenic
1063920712 10:10929644-10929666 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1064089579 10:12372319-12372341 CAGTTTCCTCATCTCTAAAATGG - Intronic
1064112068 10:12548141-12548163 CAGTATCCTCATCTCTAAAATGG + Intronic
1064128410 10:12685413-12685435 GAGTTTCTGCATCTTTTACAAGG + Intronic
1064413088 10:15125134-15125156 CAGTTTCTTCATCTGTAAAATGG + Intronic
1064949248 10:20829100-20829122 CAGTTTCTCCATCTGTAAGATGG - Intronic
1064980637 10:21163051-21163073 CAGTATCCTCATCTGTAAAATGG - Intronic
1065292122 10:24241165-24241187 CAGTTTCTGCATCTGTAAAGTGG - Intronic
1065317453 10:24477333-24477355 CAGTTTCTCCATCTGTAAAAAGG - Intronic
1065636435 10:27740977-27740999 CATCATTTGCATCTCTTACAAGG - Intronic
1065822683 10:29540458-29540480 CACCATCTGCATCTATAAAATGG - Intronic
1065938348 10:30541742-30541764 CAGTTTCTTCATCTGCAACATGG + Intergenic
1066303755 10:34119287-34119309 CAGTATCTTCATCTGAAAAATGG - Intronic
1066453814 10:35555130-35555152 CAGTATCCAGATCTGTAACATGG - Intronic
1066473684 10:35724191-35724213 CAGTTACTGTCTCTCTAACAGGG - Intergenic
1066491854 10:35901797-35901819 CAGTCTCTTCATCTCTGAAATGG - Intergenic
1066533008 10:36360984-36361006 CACCATCTGCTTCTCTCACAAGG - Intergenic
1067173709 10:43927661-43927683 CAGTTTCCCCATCTGTAACATGG + Intergenic
1067527877 10:47049240-47049262 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1067991533 10:51218989-51219011 CAGTTTCCTCATCTCTAAAATGG + Intronic
1068672337 10:59736023-59736045 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1068743648 10:60503453-60503475 CAGTTTCTGAATCTGTAAAATGG - Intronic
1068805473 10:61190111-61190133 CAGTTTCTTCATCTGTAATATGG + Intergenic
1069074773 10:64027345-64027367 CAGTTTCTTCATCTCTAAAATGG + Intergenic
1069430073 10:68326740-68326762 CAGTTTCTTAATCTCTAAAATGG - Intronic
1069681076 10:70285641-70285663 CAGTCTCTTCATCTGTAAAATGG + Intergenic
1069694217 10:70374936-70374958 CAGTTTCTTCATCTATAAAATGG - Intronic
1069707511 10:70468032-70468054 CAGTCTCTTCATCTGTAAAATGG - Intergenic
1069723804 10:70565148-70565170 CAGTCTCTGCCTCTGTAAAATGG - Intronic
1070233417 10:74596304-74596326 CAGTTTCTTCATCTATAAAATGG + Intronic
1070609239 10:77922234-77922256 CAGTATCTTCATCTGTAAGATGG - Intronic
1070610924 10:77931864-77931886 CAATTTCTGCATCTCTAAAGTGG + Intergenic
1070792852 10:79200017-79200039 CAGTTTCCTCATCTCTAAAATGG + Intronic
1071578009 10:86744146-86744168 CAGTTTCTTCATCTATAAAATGG - Intergenic
1071937347 10:90546679-90546701 CAGTATCTCCAGCTTTATCAGGG - Intergenic
1071973984 10:90936785-90936807 CAGTTTCTTCATCTGTAATATGG - Intergenic
1072524344 10:96258308-96258330 CAGTATCTGCATCTGTGAAATGG - Intronic
1072681335 10:97509322-97509344 CAGTTTCTGCATCTGTAAAATGG + Intronic
1072750945 10:97978243-97978265 GAGAATCTGCATTTTTAACAAGG + Intronic
1072812872 10:98477145-98477167 CAGTGTCTTCAACTCTAAAATGG + Intronic
1073179198 10:101573865-101573887 CAGCTTCTGCATCTCCAAAAGGG + Intronic
1073406211 10:103300282-103300304 CAGGATCTGCCTCTGTAACCCGG + Intergenic
1073422200 10:103433719-103433741 CAGAATGTGCATCTCTTCCAGGG - Intronic
1073444630 10:103573394-103573416 CAGTTTCTTCATCTGTAACGTGG + Intronic
1073563270 10:104515148-104515170 CTGTATCTGCCTATCCAACACGG + Intergenic
1073606708 10:104902803-104902825 CAGTTTCCCCATATCTAACATGG - Intronic
1073751568 10:106534166-106534188 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1074144310 10:110702816-110702838 CAGTTTCTTCATCTGTAAAATGG + Intronic
1074267346 10:111917783-111917805 GAGAATCTGCATTTCTAATAAGG - Intergenic
1074370478 10:112896858-112896880 CAGTTTCTGCATCTGTAAAATGG - Intergenic
1074661984 10:115670150-115670172 CAGTTTCTTCATCTTTAAAATGG + Intronic
1074901239 10:117817905-117817927 CAGTTTCTGCATCTGCAAAATGG + Intergenic
1074973624 10:118563938-118563960 CAGTTTCTTCATCTGTAAGATGG - Intergenic
1075207923 10:120462746-120462768 CAGAATCTGCATTTTGAACAGGG + Intronic
1075223701 10:120606193-120606215 CAGTTTGTTCATCTGTAACATGG + Intergenic
1075444384 10:122503649-122503671 CAGTATCCACATCTTTAAAATGG + Intronic
1075541436 10:123317538-123317560 CAGTTTCTGCATCTGTAAAATGG - Intergenic
1075544159 10:123341714-123341736 CAGTCTCTGCATCTGTAAAATGG + Intergenic
1075608584 10:123834020-123834042 CAGTTTCTTCATCTGTAAGATGG - Intronic
1075861689 10:125682784-125682806 CAGTTTCTTCATCTGTGACATGG - Intronic
1076071294 10:127491960-127491982 CAGTTTCTTCACCTCTAAAATGG + Intergenic
1076151265 10:128163530-128163552 CAGTTTCTCCATCCCTAAAATGG + Intergenic
1076252015 10:128992678-128992700 CAGTTTCTCCTCCTCTAACATGG - Intergenic
1076301448 10:129430579-129430601 CAGTTTCCTCATCTGTAACATGG + Intergenic
1076558863 10:131348002-131348024 CAGCATCTGCCTTTCTGACAAGG - Intergenic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1077426532 11:2482050-2482072 CAGTTTCTTCATCTCTGAAACGG + Intronic
1077673960 11:4181392-4181414 CAGTTTCTTCATCTGTAACATGG - Intergenic
1077777474 11:5287465-5287487 CAGTTTCTTCATCTGTAAAATGG - Intronic
1077929632 11:6717485-6717507 CAGCATATGTACCTCTAACATGG - Intergenic
1077937560 11:6804145-6804167 TAGTATCTTCATCTATAATATGG - Intergenic
1077967796 11:7154340-7154362 CAGTTTCTCCATCTATAAAATGG - Intergenic
1078476502 11:11634686-11634708 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1078736832 11:14028105-14028127 CAGTTTCTGAATCTGTAAAATGG + Intronic
1079009409 11:16816055-16816077 CAGTTTCCTCATCTCTAATATGG + Intronic
1079016025 11:16869439-16869461 CAGGTTCTTCATCTCTAAAATGG + Intronic
1079019171 11:16894957-16894979 CAGTTTCTTCATCTGTAAAATGG - Intronic
1079341694 11:19616966-19616988 CAGTCTCCTCATCTATAACATGG + Intronic
1079357770 11:19744103-19744125 CAGTTTCTTCATCTGTAATATGG - Intronic
1079369030 11:19834269-19834291 CAATTTCTGCATCTGTAAAATGG - Intronic
1080125130 11:28724243-28724265 CAGTTTCATCATCTCTAAAATGG - Intergenic
1080161165 11:29178173-29178195 CAGTTTCTTCATCTATAAAATGG + Intergenic
1080410305 11:32017694-32017716 CAGTTTCTTCATCTGTAAAATGG - Intronic
1080492201 11:32778188-32778210 GAGAATGTGCATTTCTAACAAGG - Intronic
1080607106 11:33872323-33872345 CAGTATCCTCATCTGTAAAATGG + Intronic
1080753232 11:35169952-35169974 CAGTTTCCTCATCTCTAAAATGG + Intronic
1080775461 11:35382056-35382078 CAGTATCTTCATCTGTAAAATGG - Intronic
1080961476 11:37165888-37165910 CAGTTTCTGCATCTCTAGGTAGG + Intergenic
1081178938 11:39964462-39964484 CAGTTTCTTCATCTATAAAAGGG + Intergenic
1081487103 11:43539269-43539291 CAGTTTCTGCATCTATAAAATGG + Intergenic
1081607478 11:44536578-44536600 CAGTCTCTTCATCCCTAACAGGG - Intergenic
1081612578 11:44571417-44571439 CAGTTTCAGCATCTATAAAATGG + Intronic
1081674520 11:44960802-44960824 CAGTGTCTCCATCTGTAAAATGG + Intergenic
1081717890 11:45263852-45263874 CAGTTTCTTCATCTGTAAAATGG + Intronic
1081789090 11:45770137-45770159 CAGTGTCTTCATCTGTAAAATGG + Intergenic
1082776449 11:57248646-57248668 CAGTTTCTGCATCTGTAAACTGG - Intergenic
1083226922 11:61291110-61291132 CAGTTTCTTCATCTATAAAATGG + Intronic
1083395817 11:62391139-62391161 CATTATATGGATCTCTAGCAAGG - Intronic
1083398009 11:62404580-62404602 CAGTTTCTCCATCTTTAAAATGG + Intergenic
1083403649 11:62441891-62441913 CCATATTAGCATCTCTAACAGGG - Intronic
1083474430 11:62906776-62906798 CAGTGTCTTCATCTCTGAAACGG - Intergenic
1083830208 11:65226663-65226685 CAGTTTCTCCATTTGTAACATGG + Intergenic
1083844472 11:65322903-65322925 CAGTTTCCCCATCTCTAAAATGG + Intergenic
1083915349 11:65739504-65739526 CATTGTCTCCATGTCTAACAAGG + Intergenic
1083976332 11:66124364-66124386 CAGTGTCTTCATCTATAAAATGG + Intronic
1084029306 11:66471828-66471850 CAGTTTCTTCAACTCTAAAATGG + Intronic
1084050110 11:66593797-66593819 CACTTTCTGCATCTGTAAAATGG - Intronic
1084386668 11:68847253-68847275 CAGTTTCCTCATCTGTAACATGG + Intergenic
1084433072 11:69122281-69122303 CAGTTTCTGCCTCCCTAACGTGG + Intergenic
1084873199 11:72111485-72111507 CAGTGTCTTCATCTGTAAAATGG + Exonic
1084970214 11:72767396-72767418 CAGTTTCAGCATCTGTAAAATGG - Intronic
1085412463 11:76299460-76299482 CAGCATCCTCATCTGTAACATGG - Intergenic
1085442974 11:76579934-76579956 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1085718991 11:78896856-78896878 CAGATTCTTCATCTCTAATATGG + Intronic
1085780504 11:79403883-79403905 CAGTTTCTGCATCTTTGAAAGGG - Intronic
1085816310 11:79741112-79741134 CAGTTTCTGCATTTGTAAAATGG - Intergenic
1085950560 11:81326286-81326308 CAGTTTCTTCATCTATAAAAAGG + Intergenic
1085955134 11:81383385-81383407 CATTTTCTTCATCCCTAACATGG - Intergenic
1086152590 11:83628516-83628538 CAGTTTCTTCATCTATAAAATGG + Intronic
1086155315 11:83659243-83659265 CAGTTTCTTCATCTGTAAAATGG - Intronic
1086181843 11:83961517-83961539 CAATGTCTACATCTCTAAAATGG + Intronic
1086267435 11:85018027-85018049 AATCATCTGCATCTCTAAAAGGG - Intronic
1086289855 11:85295496-85295518 CAGTTTCTCCATCTCTAACATGG - Intronic
1086428123 11:86706985-86707007 CAGTTTTTTCATCTCTAAAATGG + Intergenic
1086543910 11:87945984-87946006 CAGCTTCTGCATCTCTGAAAAGG - Intergenic
1086858532 11:91896781-91896803 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1087203166 11:95366306-95366328 CAATATCCTCATCTCTAAAATGG + Intergenic
1087984976 11:104667039-104667061 CAGTCTCTTCATCTGTAAAATGG - Intergenic
1088155245 11:106795108-106795130 CAGCTTCTGCATCTATAAAATGG - Intronic
1088229653 11:107660684-107660706 CAATATCTGCATCTGAAAGATGG + Intronic
1088304555 11:108394232-108394254 CAGTTTCTTTATCTCTAAAAGGG - Intronic
1088777058 11:113095706-113095728 CAGTTTCTTCATCTGTAAAATGG - Intronic
1088898044 11:114092659-114092681 TAGTTTGTGCATCTCTAAAATGG + Intronic
1089537262 11:119168612-119168634 CAGTTTCTTCATCTGTAAAATGG + Intronic
1089706286 11:120280316-120280338 CAGTTTCTTCATCTTTAAAATGG - Intronic
1089903239 11:122010665-122010687 CAGTATCTGCTTCTGAAACTGGG - Intergenic
1090049489 11:123365105-123365127 CAATTTCTGCAACTATAACATGG - Intergenic
1090088581 11:123673423-123673445 CAGTTTCTTCATCTGTAACACGG - Intergenic
1090091277 11:123700754-123700776 CAGTCTCTTCATCTATAAAATGG - Intergenic
1090114241 11:123950379-123950401 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1090256091 11:125285494-125285516 CTGTATCTTCATCTGTAAAATGG + Intronic
1090478983 11:127051137-127051159 CAGTTTCCGCATCTGTAACATGG - Intergenic
1090496329 11:127216464-127216486 CAGTTTCTCCATCTCTTAAATGG - Intergenic
1090581892 11:128169558-128169580 CAATCTCTTCATCACTAACATGG + Intergenic
1090736454 11:129615524-129615546 CAGTTTCTGCATCTGTGAAACGG + Intergenic
1091443662 12:530654-530676 CTGTTTCTTCATCTCTAAAATGG + Intronic
1091572905 12:1705944-1705966 CAGTTTCTTCATCTATAAAATGG + Intronic
1091771896 12:3157502-3157524 CAGTTTCTCCATCTGTAAAATGG + Intronic
1092145557 12:6212263-6212285 CTGTTTCTTCATCTCTCACAGGG + Intronic
1092207490 12:6624096-6624118 CAGTTTCTTCATCTGTAAAATGG + Intronic
1093133254 12:15417590-15417612 CAGAATCTGCATTTTTAACAAGG + Intronic
1093195422 12:16124678-16124700 CAGTGGTTTCATCTCTAACAGGG + Intergenic
1093198846 12:16162549-16162571 GAGTGTCTGACTCTCTAACAGGG - Intergenic
1094023371 12:25937877-25937899 CAATATCTGCATGTGTAAAAGGG - Intergenic
1094229905 12:28091155-28091177 CAGTTTCTGCATCTGTAAAATGG + Intergenic
1094356072 12:29579023-29579045 CAGTTTCCTCATCTCTAATATGG - Intronic
1094726824 12:33127813-33127835 CAGTTTCTGCATCTATAACATGG - Intergenic
1095114885 12:38341371-38341393 CAATATCTTCATCTGTAAAATGG - Intergenic
1095654525 12:44653279-44653301 CAGTTTCTTCATCTTTAAAATGG - Intronic
1095736872 12:45567224-45567246 CAGTTTCTGCATTTGTAAGATGG + Intergenic
1095862677 12:46935758-46935780 CAGTTTTTTCATCTCTAAAATGG + Intergenic
1095875114 12:47071606-47071628 CAGTATCTCCATCTGTCAAATGG + Intergenic
1096468574 12:51862574-51862596 CAGTATCCTCATCTGTAAAATGG + Intergenic
1096477737 12:51918676-51918698 CAGTTTCTTCATCTGTAAAATGG + Intronic
1096521724 12:52188310-52188332 CAGTTTCTTCATCTGTAAAATGG - Intronic
1096601797 12:52734998-52735020 CAGTTTCTTCATTTGTAACACGG - Intergenic
1096810042 12:54163359-54163381 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1096908210 12:54955967-54955989 CAGTATCATCATCTATAAAATGG + Intronic
1097170329 12:57109380-57109402 CAGTTTCTTCATCTATAAAATGG - Intronic
1097237752 12:57551303-57551325 CAATTTCTGCATCTGTAAAATGG - Intronic
1097263014 12:57730225-57730247 CAGTTTCCTCATCTGTAACATGG - Intronic
1097275322 12:57809360-57809382 CAGTTTCCCCATATCTAACATGG - Intronic
1097325675 12:58273609-58273631 CAGTTTCTTCATCTCTCAAATGG + Intergenic
1097942200 12:65322799-65322821 CAGTTTCTGTATCTGTAAAATGG + Intronic
1098147647 12:67514181-67514203 CAATATCTTCATCTGTAAAATGG - Intergenic
1098170222 12:67739279-67739301 TAGTTTCTGCATCTATAAAATGG + Intergenic
1098250296 12:68561975-68561997 CAGTTTCTTCATCTATAAAATGG - Intergenic
1098254720 12:68605556-68605578 CAGTTTCCTCATCTATAACATGG - Intergenic
1098272596 12:68783384-68783406 CAGTTTCTGCATCTGTAAAATGG - Intronic
1098429049 12:70399369-70399391 CAATGTCTGCATCTATAAAATGG + Intronic
1099055708 12:77837526-77837548 CAGTTTCTCCATCTGTAAAACGG - Intronic
1099150283 12:79103003-79103025 CAGTTTCTGTATCTGTAAAATGG - Intronic
1099350666 12:81565044-81565066 CAGTATCTCCAGCTTTATCAGGG - Intronic
1100411077 12:94320607-94320629 CAGTATTTGCTTATCTAAAAAGG + Intronic
1100449493 12:94691845-94691867 CAGTTTCTAAATCTGTAACATGG - Intergenic
1100470778 12:94891028-94891050 CAGTTTTTGCATCTGTAAAATGG + Intergenic
1100479429 12:94963753-94963775 CAGTTTCCTCATCTGTAACACGG - Intronic
1100527968 12:95437870-95437892 GAGGATTTGCATCTCTAACAAGG - Intergenic
1100591761 12:96036182-96036204 CAGAACCTGCATCTCTCAAACGG + Intronic
1100682447 12:96942194-96942216 CAGTTTCTGCATCTATAAAATGG - Intronic
1101245446 12:102880044-102880066 CAGTTTCTTCATCTGTAAAACGG - Intronic
1101320837 12:103671560-103671582 CAGTTTCTTCATCTGTAAAATGG + Intronic
1101443429 12:104720294-104720316 CAGTTTCTTCATCTGTAAAAAGG - Intronic
1101594460 12:106151658-106151680 CAGTTTCTGCATCTACAAGATGG + Intergenic
1101645287 12:106625843-106625865 CAGTTTCTTCATCTGTAAAATGG - Intronic
1101738982 12:107485099-107485121 CAGTTTCTTCATCTCTAAAATGG - Intronic
1101897030 12:108764693-108764715 CAGTTTCTTCATCTCTGAAATGG + Intergenic
1102012446 12:109626909-109626931 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1102014399 12:109638157-109638179 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1102247807 12:111366246-111366268 CTGTTTCTGCATCTGTAAAATGG + Exonic
1102252443 12:111396820-111396842 CAGTTTCCGCATCTGTAAAATGG - Intergenic
1102253210 12:111401470-111401492 CAGTGTCTGCATCTGTAAAAGGG + Intergenic
1102256163 12:111416401-111416423 CAGTTTCTCCATCTGTAAGAGGG - Intronic
1102300588 12:111768091-111768113 CAGTCTCTTCATCTGTAAAATGG - Intronic
1102469243 12:113150288-113150310 CAGTATCAGCATCTGTAAAATGG + Intronic
1102514720 12:113438665-113438687 CAGTTTCTGCATCTGTAAAATGG - Intergenic
1102515046 12:113440729-113440751 CAGTGTCCTCATCTGTAACATGG + Intergenic
1102582237 12:113897136-113897158 CAGTATCTGCATCTATAAAATGG - Intronic
1102586303 12:113925458-113925480 CAGTTTCTTCATCTGTAACATGG - Intronic
1102673392 12:114638963-114638985 CAGTTTCTTTATCTCTAAGATGG - Intergenic
1102688807 12:114744460-114744482 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1102710141 12:114918712-114918734 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1102728548 12:115087865-115087887 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1102783166 12:115583147-115583169 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1102801686 12:115740664-115740686 CAGTTTCTCCATCTGTAAAATGG + Intergenic
1102955403 12:117055451-117055473 CAGTTTCACCATCTCTAAAATGG - Intronic
1102961076 12:117093620-117093642 CAATGTCTGCATCTGTAAAATGG + Intronic
1103010004 12:117450792-117450814 CAGTATCTGCATGTCTGTCCTGG - Intronic
1103037017 12:117664805-117664827 CAGTTTCTTGATCTGTAACATGG + Intronic
1103054151 12:117805438-117805460 CAGTTTCTTCATCTGTAAGATGG + Intronic
1103106752 12:118234037-118234059 CAGTTTCTTCATCTGTAAAATGG + Intronic
1103189978 12:118993096-118993118 CAGTTTCTTCATCTTTAAAATGG - Intronic
1103205280 12:119124053-119124075 CAGTTTCTTCATCTGTAAGATGG + Intronic
1103370351 12:120414587-120414609 CAGTTTCTTCATCTTTAAAATGG - Intergenic
1103480491 12:121247269-121247291 CAGCATCTGCCTCTCAAGCATGG + Intronic
1103535576 12:121631585-121631607 CAGTTTCTTCATCTTTAAAATGG + Intronic
1103571721 12:121849399-121849421 CAGTTTCTTCATCTGTAAAATGG - Intronic
1103596714 12:122028705-122028727 CTGTTTCTGCATCTGTAAAAAGG + Intronic
1103825464 12:123734492-123734514 CAGTTTCTTCATCTGTAAAAGGG + Intronic
1103983138 12:124749873-124749895 CAGTTTCCTCATCTCTAAAATGG - Intergenic
1105243356 13:18626934-18626956 CACTTTCTTCATCTGTAACATGG + Intergenic
1105322037 13:19335203-19335225 CAGAATCTGCACTACTAACAAGG + Intergenic
1105585684 13:21740815-21740837 CAGTTTCTTTATCTCTAAAATGG - Intergenic
1105876429 13:24559091-24559113 CAGAATCTGCACTTCCAACAAGG - Intergenic
1106127910 13:26915673-26915695 CAGATTCTTCACCTCTAACATGG + Intergenic
1106319046 13:28621399-28621421 CAGTTTCTTCATCTGTAAGATGG - Intergenic
1106449093 13:29863774-29863796 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1107438267 13:40401361-40401383 TAGCATCTGCATCTATAAAATGG - Intergenic
1107595886 13:41962434-41962456 CAGTTTCTTCATCTGTAAAACGG - Intergenic
1107732553 13:43363023-43363045 CAGTTTCTTCATCTGTAATATGG + Intronic
1107894921 13:44952035-44952057 CAGTAAAGGCATCTCTAATAAGG - Intronic
1108386328 13:49902442-49902464 CAGTTTCTCCATCTATAAAATGG + Intergenic
1108447505 13:50524626-50524648 CAGTATACCCATCTATAACATGG - Intronic
1108449039 13:50541817-50541839 CAGTTCCTGCATCTGTAACATGG - Intronic
1108456190 13:50616220-50616242 CAGTTTCTTCATCTGTAAAATGG + Intronic
1108582702 13:51840356-51840378 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1109205255 13:59476154-59476176 GAGAATCTGCCTCTCTAAGAAGG + Intergenic
1109669056 13:65581061-65581083 TAATTACTGCATCTCTAACAAGG + Intergenic
1110012876 13:70360911-70360933 CAGTTTCTGCATCTATAAAATGG + Intergenic
1110185183 13:72665854-72665876 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1110213644 13:73002622-73002644 TAGTATCTGCATTTTTAATAAGG - Intronic
1110289759 13:73790783-73790805 CAGTACCTACATCTGCAACATGG - Intronic
1110324445 13:74198175-74198197 CAGTGTCTGCCTCTCTGACCAGG - Intergenic
1110678138 13:78275530-78275552 CAGTGTTTGCATCTTTAAAATGG - Intergenic
1110693560 13:78460198-78460220 TATTAATTGCATCTCTAACATGG - Intergenic
1110827922 13:79994827-79994849 CAGTTTCTTCATCTATAAAATGG - Intergenic
1111647879 13:91054748-91054770 CAGTTTCTTCATCTTTAATAGGG - Intergenic
1111784113 13:92765637-92765659 GAGAATTTGCATTTCTAACAAGG - Intronic
1111987970 13:95084224-95084246 CAGTGTCTCCATCTGTAAAATGG - Intronic
1112319195 13:98391716-98391738 CAGTATCTCCATCTTTATAAAGG - Intronic
1112428232 13:99324656-99324678 CAGTTTCTTCATCTATAATAGGG - Intronic
1112640156 13:101264571-101264593 CAGAATCTGTATCTTTAACACGG + Intronic
1112695430 13:101943079-101943101 CAGTTTCCTCATCTCTAAAATGG - Intronic
1112727735 13:102324385-102324407 CAGTTTCTTCATCTGTAAAATGG + Intronic
1114064224 14:19046984-19047006 CAGGAGCTGCATTTCAAACAAGG + Intergenic
1114098035 14:19353014-19353036 CAGGAGCTGCATTTCAAACAAGG - Intergenic
1114187894 14:20416992-20417014 GAGAGTCTGCATTTCTAACAAGG - Intergenic
1114526738 14:23371240-23371262 CAGTTTCCTCATCTGTAACATGG + Intergenic
1114891855 14:26934658-26934680 CAGTTTCTTCATCTATAAAATGG + Intergenic
1115148207 14:30251735-30251757 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1115351803 14:32403619-32403641 CAGTTTCTTCATCTGTAAGATGG + Intronic
1115454592 14:33587470-33587492 CAGTTGCTTCATCTATAACATGG + Intronic
1115645604 14:35366799-35366821 CAGTCTCTTCATCTGTAAAATGG + Intergenic
1115645609 14:35366840-35366862 CAGTCTCTTCATCTATAAAATGG + Intergenic
1115800832 14:36991603-36991625 CAGTTTCTTCATCTATAACATGG - Intronic
1116060368 14:39916759-39916781 CGGTTTCTGCATCTGTAAAATGG + Intergenic
1116203311 14:41826778-41826800 AAGTATCTTCATCTATAATATGG + Intronic
1116470309 14:45279107-45279129 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1116747128 14:48834192-48834214 CAGTCTCTTCATCTGTAAAATGG + Intergenic
1116764454 14:49053250-49053272 CAGTTTCTTCATCTTTAAAATGG + Intergenic
1116960800 14:50966282-50966304 CAGTTTCTTCATTTCTAAAATGG + Intergenic
1117099016 14:52326378-52326400 CAGTGTCTGCATTTGTAAAATGG + Intronic
1117534385 14:56689799-56689821 CAATCTCTTCATCTATAACATGG - Intronic
1117645314 14:57845321-57845343 CAATTTTTTCATCTCTAACATGG + Intronic
1117793849 14:59370722-59370744 CTCTATCTGCACCTTTAACATGG - Exonic
1118173539 14:63413523-63413545 CAGTTTATGCATCTATAAAATGG + Intronic
1118541020 14:66825561-66825583 GAGAATCTGTATTTCTAACAAGG + Intronic
1118609248 14:67527277-67527299 CAGTCTATGCATCTATAAAATGG + Intronic
1119252014 14:73164566-73164588 CAGTGTCTTCATCTGTAAAATGG - Intronic
1119379402 14:74218886-74218908 CAGTATATTCATCTGTAAAATGG + Intergenic
1119559246 14:75577663-75577685 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1119631841 14:76238875-76238897 GAGAATTTGCATTTCTAACAGGG + Intronic
1119682880 14:76606071-76606093 CAGTTTCTTCATCTCTTAAATGG - Intergenic
1119867124 14:77983128-77983150 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1120179366 14:81327981-81328003 CAGTTTTTTCATCTATAACATGG + Intronic
1120205866 14:81586817-81586839 CAGTTTCTTCATCTTTAAAATGG + Intergenic
1120210655 14:81630533-81630555 CAGACTCTGCATCCCTGACAAGG + Intergenic
1120528618 14:85606394-85606416 CAGTTTCTGCATCCCTAAAATGG + Intronic
1120667114 14:87319181-87319203 CAGCATCTTCATCTCTAACATGG + Intergenic
1121000772 14:90450829-90450851 CAATATCCTCATCTATAACATGG + Intergenic
1121009993 14:90514139-90514161 CAGTCTCTTCATTTCTAACAAGG + Intergenic
1121037121 14:90715588-90715610 CAGTTTCTTCATCTGTAACTGGG - Intronic
1121292974 14:92792713-92792735 CAGTGTCTTCATCTGTAAAATGG + Intergenic
1121441126 14:93950087-93950109 CAGTCTCTTCATCTATAAAATGG + Intronic
1121638070 14:95467036-95467058 TAGTTTCTCCATCTCTAACATGG + Intronic
1121889712 14:97578004-97578026 CAGTTTCTGCATCTCTATGTTGG + Intergenic
1121948836 14:98150988-98151010 CAGTTTCTTCATCTTTAAAATGG - Intergenic
1122067239 14:99182290-99182312 CAGTTTCTTCATCTGTAAAATGG - Intronic
1122154222 14:99740743-99740765 CAGTTTCTTCATCTTTAAAATGG + Intronic
1122163957 14:99807342-99807364 CAGTTTCCTCAGCTCTAACAAGG + Intronic
1122166904 14:99832483-99832505 CAGCAATTGCATCTCTGACATGG - Intronic
1122839347 14:104447798-104447820 CAGTCTCTGCTACTCTAGCATGG - Intergenic
1123388471 15:19844451-19844473 TTGTATCTGAATTTCTAACAGGG - Intergenic
1123487941 15:20757688-20757710 CACTTTCTTCATCTGTAACATGG - Intergenic
1123492390 15:20792193-20792215 CAGGAGCTGCATTTCAAACAAGG - Intergenic
1123544442 15:21326758-21326780 CACTTTCTTCATCTGTAACATGG - Intergenic
1123548892 15:21361275-21361297 CAGGAGCTGCATTTCAAACAAGG - Intergenic
1123629361 15:22250635-22250657 CAGTTTCTTCATCTGTAAAAGGG + Intergenic
1123966520 15:25465407-25465429 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1124120120 15:26882000-26882022 TAGTATTTGCATTTTTAACAGGG + Intronic
1124496496 15:30190863-30190885 CAGTATCTTCATCTGGAAAATGG - Intergenic
1124747079 15:32347785-32347807 CAGTATCTTCATCTGGAAAATGG + Intergenic
1126399233 15:48252300-48252322 CAGTTTCTTCATCTGTAAAATGG - Intronic
1126575962 15:50196518-50196540 CATTTTCTGAATCTCTAAAATGG - Intronic
1126576117 15:50198431-50198453 CATTTTCTGAATCTCTAAAATGG - Intronic
1126579954 15:50233557-50233579 CAGTTTCTTCATCTGTAAAATGG + Intronic
1126651286 15:50924139-50924161 CAGTTTCTGCATCTATAAAATGG + Intronic
1126685491 15:51245814-51245836 CAGTTTCTCCATCTGTAAAATGG - Intronic
1126733850 15:51712090-51712112 CAGTGTCTTCATCTGTAAAATGG + Intronic
1127318772 15:57821902-57821924 CAGTTTCTTCATCTCTACAATGG - Intergenic
1127430614 15:58903725-58903747 AAGAATGTGCATCTCTAACAAGG + Intronic
1127622924 15:60751741-60751763 CAGTTTCTTCATCTATAAGAAGG - Intronic
1127690147 15:61387341-61387363 CAGTCTCTTCTTCTCTGACAAGG - Intergenic
1127717423 15:61662861-61662883 CAGTTTCCTCATCTCTAAGATGG - Intergenic
1127862852 15:63008854-63008876 CAGTTTCCTCATCTCTAAAATGG - Intergenic
1127914504 15:63444393-63444415 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1128328992 15:66743376-66743398 CGGTTTCTGCATCTGTAAAATGG + Intronic
1128366230 15:67005458-67005480 CAGTCTCTCCATCTGTAAAATGG - Intergenic
1128369427 15:67029525-67029547 CAGTTTCTGCATCTGTAAAATGG - Intergenic
1128417682 15:67461749-67461771 CAGTGTCTTCATCTGTAAAATGG + Intronic
1128417863 15:67463542-67463564 CAGTTTCTTCATCTGTGACATGG + Intronic
1128451659 15:67809322-67809344 CAGTTTCTTCATCTGTAAAACGG - Intergenic
1128522503 15:68385121-68385143 CAGTTTCTTCATCTGTAAAATGG - Intronic
1128610483 15:69069167-69069189 CAGTTTCTTCATCTCTAAAATGG - Intergenic
1128659206 15:69485384-69485406 CAGTGTATGCATCTGTAACCAGG + Intergenic
1128683999 15:69670526-69670548 CAGTTTCTTCATCTATAAAATGG + Intergenic
1128800437 15:70493478-70493500 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1128814552 15:70598171-70598193 CAGTTTCCGCATCTGTAAAATGG + Intergenic
1128929273 15:71689683-71689705 CAGTTTCTGCATCCATAAAATGG + Intronic
1129234325 15:74214554-74214576 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1129277850 15:74459090-74459112 CAGTTTCTTCATCCCTAACGTGG + Intronic
1129517454 15:76165352-76165374 CAGTTTCTGCATCTCTCAAATGG + Intronic
1129694070 15:77730747-77730769 CAGTCTCCACATCTGTAACATGG + Intronic
1129760562 15:78127025-78127047 CAGTTTCTGCATCTGTAAAGTGG + Intronic
1129853303 15:78807604-78807626 CAGTTTCTCCATCTGTAAAATGG + Intronic
1130173818 15:81546839-81546861 CAGTTTCTGCATCCGTAAAATGG - Intergenic
1130707966 15:86251156-86251178 CAGTTTCTTCATCTATAAAAAGG - Intronic
1130752924 15:86732063-86732085 CAGTAGCTGCCTCTGTAAAATGG - Intronic
1130993910 15:88893615-88893637 CAGTTTCTTCATCTTTAAAATGG + Intronic
1131093989 15:89644803-89644825 CAGTTTTTTCATCTCTAAAATGG - Intronic
1131124977 15:89852164-89852186 CAGTTTCTTCATCTGTAAAATGG + Intronic
1131353180 15:91720119-91720141 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1131667222 15:94583379-94583401 CAGTTTCTTCATCTGTAAGATGG + Intergenic
1131767189 15:95691046-95691068 GAGAATGTGCATTTCTAACATGG - Intergenic
1131837333 15:96404110-96404132 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1131865023 15:96699183-96699205 CTGTTTCTTCATCTCTAAAATGG - Intergenic
1131894564 15:97012384-97012406 AAGATTCTGCATTTCTAACAAGG - Intergenic
1132073354 15:98798928-98798950 CAGTTTCTTCATTTATAACATGG - Intronic
1132415802 15:101618100-101618122 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1202952785 15_KI270727v1_random:54027-54049 CACTTTCTTCATCTGTAACATGG - Intergenic
1202957228 15_KI270727v1_random:88514-88536 CAGGAGCTGCATTTCAAACAAGG - Intergenic
1132889823 16:2197941-2197963 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1133114617 16:3570015-3570037 CAGTGTCTTCATCTGTAAAATGG - Intronic
1133222641 16:4325343-4325365 CAGTTTTTGCATCTGTAAAATGG + Intronic
1133369214 16:5235289-5235311 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1133429346 16:5723161-5723183 GAGTGTATGCATCTGTAACATGG + Intergenic
1133516703 16:6516342-6516364 CAGTTTCTTCATCTGTAAAATGG + Intronic
1133576760 16:7098889-7098911 CAGTTTCTTCATCTTTAAAATGG + Intronic
1133611361 16:7436558-7436580 CAGTTTATGCATCTTTAAAATGG - Intronic
1133620053 16:7517929-7517951 CGGTTTCTGCATCTGTAAAATGG + Intronic
1133750310 16:8720252-8720274 TAGTTTCTGCATCTGTAAAATGG - Intronic
1133755296 16:8758198-8758220 CAGTTTCTGCATCTGAAAAATGG - Intronic
1133806358 16:9128482-9128504 CACTATCCCCATCTCTAAAATGG + Intergenic
1133846930 16:9463748-9463770 CAGTTTCTTTATCTCTAAAATGG + Intergenic
1133923060 16:10171859-10171881 CAATGTCTTCATCTCTAAAATGG - Intronic
1134013242 16:10870703-10870725 CAGTTTCTTCATCTCTGAAATGG + Intergenic
1134028157 16:10970456-10970478 CTGTTTCTACATCTATAACATGG - Intronic
1134062059 16:11205257-11205279 CAGTTTCTGCATCTGTAGAATGG - Intergenic
1134082126 16:11332205-11332227 CAGTTTCTTCATCTGTAAAATGG + Intronic
1134219498 16:12342684-12342706 CAGTTTCTGCATCTGAAAAATGG - Intronic
1134393996 16:13845694-13845716 CAGTGTCTGCATCTATAAATGGG - Intergenic
1134661405 16:15987303-15987325 CAGTTTCCGCATCTGTAAAATGG - Intronic
1134682594 16:16136786-16136808 CAGTTTCTGTATCTGTAAAACGG + Intronic
1134805167 16:17118075-17118097 CAGTTTCTTCATCTGTAAAATGG - Intronic
1134914903 16:18061274-18061296 CAGTTTCCTCATCTCTAAAATGG - Intergenic
1135008663 16:18852897-18852919 CAGTGTCTTCACCTTTAACAAGG - Intronic
1135051303 16:19195217-19195239 CAGTTTCTTCATCTATAAAATGG - Intronic
1135129484 16:19840667-19840689 CAGTTTCTTCATCTATAAAATGG - Intronic
1135147579 16:19976048-19976070 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1135169006 16:20166443-20166465 CAGTTTCTTCATCTATAAAACGG - Intergenic
1135546396 16:23369853-23369875 CAGTTTCTCCATCTGTAAAATGG + Intronic
1135587419 16:23681399-23681421 CAGAATCTGGATTTTTAACAAGG + Intronic
1135605909 16:23824410-23824432 CAGTTTCTTCATCTTTAAAAGGG + Intergenic
1135620261 16:23949804-23949826 CAGTGTCTTCATCTGTAAAATGG - Intronic
1135743222 16:24994683-24994705 CAGTTTCTTCCTCTGTAACACGG - Intronic
1135804674 16:25532015-25532037 CAGAATCTGCATCTTTAACAAGG + Intergenic
1135868685 16:26128716-26128738 CAGTTTTTGCATCTCTATAATGG + Intronic
1135871346 16:26154186-26154208 CAGTGTCTGCATCTATGAAATGG - Intergenic
1136015926 16:27401195-27401217 CAGTCTCTCCATCTGTAAAATGG + Intergenic
1136099158 16:27980573-27980595 CAGTTTCTTCATCTGTAAAATGG - Intronic
1136412883 16:30086976-30086998 CAGTTTCTTCATCTATAAAATGG - Intronic
1136427847 16:30181088-30181110 CAGTTTCTGCATCTGTAAAATGG + Intergenic
1136622633 16:31440120-31440142 CAGTTTCTTCATCTATAAAATGG - Intronic
1136623293 16:31444137-31444159 CAATTTCTTCATCTGTAACATGG + Intergenic
1137352726 16:47727778-47727800 CAGCTTCTTCATCTCTAAGATGG - Intergenic
1137871791 16:51956735-51956757 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1137889745 16:52146685-52146707 CTGCATCTCCATCTCTAAAATGG - Intergenic
1137891633 16:52169309-52169331 TAGAGTCTGCATCTCTAATAAGG - Intergenic
1137946770 16:52740526-52740548 CAGTATCTTCATCTGAAAAATGG + Intergenic
1138067358 16:53956104-53956126 CAGTTTCATCATCTATAACATGG - Intronic
1138291036 16:55846972-55846994 CAGTATCTGCATGTATAAAATGG - Intronic
1138330159 16:56207134-56207156 CAGTTTCTTCATCTGTAAAATGG - Intronic
1138453443 16:57107051-57107073 CAGTTTCCTCATCTCTAAAATGG + Intronic
1138488401 16:57361472-57361494 CTGTTTCTCCATCTCTACCATGG - Intronic
1138512050 16:57514570-57514592 CAGTTTCTTCATCTGTAAAATGG - Intronic
1138533336 16:57646755-57646777 CAGTGTCCGCATCTGTAAAATGG + Intronic
1138560977 16:57800982-57801004 CATTATCTCCATCTATAAAATGG + Intronic
1138563233 16:57814571-57814593 CAGTTTCTTCATCTGTAACATGG - Intronic
1138631099 16:58294770-58294792 CAGTTTCTGAATCTGTAAAATGG - Intronic
1138906919 16:61347756-61347778 CAGAATCTTCATCTATAAAATGG - Intergenic
1139064604 16:63297346-63297368 CAGTCTCTTCATCTGTAAAATGG + Intergenic
1139360742 16:66398231-66398253 CAGTTTCTCCATCTGTAAAATGG - Intronic
1139400816 16:66679986-66680008 CTGTTTCTGCATCTGTAAAATGG + Intronic
1139428613 16:66899143-66899165 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1139448173 16:67011437-67011459 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1139930111 16:70519426-70519448 CAGGATTTGCATTTCTAACAAGG + Intronic
1140031420 16:71342186-71342208 CAGTTTCTTCATCTGTAATATGG - Intergenic
1140035249 16:71366860-71366882 CAGTTTCTTTATCTCTAAAATGG - Intronic
1140296641 16:73715494-73715516 CAGTGTCTTCATCTATAAAATGG - Intergenic
1140832268 16:78762795-78762817 CAGTATCTGTATCTGTAATATGG + Intronic
1140912592 16:79467638-79467660 GAGAATCTGCATTTCTATCAAGG - Intergenic
1141149765 16:81555864-81555886 CAGTGTCCTCATCTCTAAAATGG + Intronic
1141189170 16:81811216-81811238 CAGTGTCTGCATCTGTCAAATGG + Intronic
1141473557 16:84256038-84256060 CAGTTTCCTCATCTCTAAAATGG + Intergenic
1141556200 16:84838305-84838327 CAGTTTCCGCATCTGTAAAATGG + Intronic
1141666317 16:85467295-85467317 CAGTTTCCTCATCTCTAAAAGGG + Intergenic
1141810404 16:86371958-86371980 CAGTATCCCCATCCATAACATGG - Intergenic
1141867694 16:86762040-86762062 CAGTATCTGCTGCACTAACATGG + Intergenic
1141879732 16:86849901-86849923 CAGAACCTGCGTCTCCAACAGGG - Intergenic
1141917922 16:87112914-87112936 CAGTCTCTTCATCTTTAAGATGG - Intronic
1141974192 16:87503801-87503823 CAGTTTCTTCATCTGTAAAAGGG - Intergenic
1142135468 16:88450017-88450039 CAGTTTCTGCATCTGTAATATGG + Intergenic
1142146228 16:88494003-88494025 CAGTTTCCGCATCTGTAAAATGG + Intronic
1142592759 17:1013522-1013544 CAGTTTCTGCATCTGTGAAATGG - Intronic
1142874985 17:2846691-2846713 CAGTGTCTTCATCTGTAAAATGG - Intronic
1143045872 17:4078966-4078988 TAATAGCTGCATCTCTAGCAAGG + Intronic
1143324402 17:6089142-6089164 CAGTTTCTCCATCTGTAAAATGG - Intronic
1144762515 17:17715375-17715397 CAGTGTCTGCATCTCTCAAATGG + Intronic
1144765872 17:17732140-17732162 CAGTTTCTTCATCTGTAAAATGG - Intronic
1144841997 17:18192535-18192557 CAGTTTCTTCATCTGTAATAAGG - Intronic
1144950763 17:18992287-18992309 CAGTTTCTGCATCTCTCACATGG - Intronic
1145014180 17:19386208-19386230 CAGTTTCTTCATCTTTAAAATGG - Intronic
1145243195 17:21251587-21251609 CAGTTTCCTCATCTGTAACACGG + Intronic
1145767227 17:27467082-27467104 CAGTTTCTTCATCTGTAAAATGG - Intronic
1146017752 17:29247408-29247430 CAGTATCCTCATCTGTAAAATGG + Intronic
1146551647 17:33785428-33785450 CAGTGTCTTCATCTATAAAATGG - Intronic
1146637646 17:34518183-34518205 CAGTGTCTGCATCTGTTAAATGG + Intergenic
1146778155 17:35640694-35640716 AAGTATTTGCATGTCTTACAAGG + Intronic
1146937728 17:36822996-36823018 CAGTTTCTTAATCTCTAAAATGG - Intergenic
1146939892 17:36837101-36837123 CAGTTTCTTCATCTGTGACATGG - Intergenic
1147039571 17:37708062-37708084 CAGTTTCTTCATCTGTAAAATGG - Intronic
1147043593 17:37736440-37736462 CAGTTTCTTCATCTGTAAAATGG - Intronic
1147122640 17:38344549-38344571 CAGTGTCTGCATCTGTGAAATGG - Intergenic
1147171126 17:38619569-38619591 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1147213385 17:38885255-38885277 CAGTTTCTTCATCTGTAAAACGG + Intronic
1147385609 17:40079753-40079775 CAGTTTCTTCATCTATAAAATGG - Intronic
1147446999 17:40480553-40480575 TTGTTTCTGCATCTTTAACAAGG - Intronic
1147450063 17:40498875-40498897 CAGCATCTTCATCTGTAAAATGG - Intronic
1147485892 17:40813840-40813862 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1147872670 17:43598548-43598570 CAGTTTCTCCATCTGTAAGATGG + Intergenic
1147924714 17:43939147-43939169 CCGTATCTGTGTCTCTACCACGG - Intergenic
1147990954 17:44333118-44333140 CAGTTTCTTCATCTTTAAAATGG + Intergenic
1148003574 17:44406233-44406255 CAGTATCTGCATTTCTAATTAGG + Intronic
1148190844 17:45677724-45677746 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1148343608 17:46888905-46888927 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1148691995 17:49534010-49534032 CAGTTTCCGCATCTGTAAAATGG + Intergenic
1148923181 17:51058378-51058400 CAGTTTCCTCATCTCTACCATGG - Intronic
1149294977 17:55253851-55253873 AAGTATCTGCCTTTTTAACAAGG - Intergenic
1149357874 17:55862441-55862463 CAGTTTCTTCATCTGTAACGTGG - Intergenic
1149361235 17:55898090-55898112 CAGTTTATGCATCTCTAAAATGG + Intergenic
1149700675 17:58652886-58652908 CAATTTCTTCATCTGTAACATGG + Intronic
1150143232 17:62747518-62747540 CAGTTTCTGCAACTGTAAAATGG + Intronic
1150229353 17:63541684-63541706 CAGAGTCTTCATCTCTAAAATGG - Intronic
1150327141 17:64266223-64266245 CAGTTTCTGCATCCATAAAAAGG - Intergenic
1150439786 17:65181781-65181803 CAGTTTCCTCATCTCTAACAGGG + Intronic
1150646677 17:66982972-66982994 CAGTTTCTGCATCTACACCATGG - Intronic
1150649235 17:66999120-66999142 CAGTTTCTTCATCTGTAAAATGG + Intronic
1151166574 17:72209021-72209043 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1151211665 17:72548991-72549013 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1151228925 17:72667844-72667866 CAGTTTCTTCATCTATAAAATGG - Intronic
1151293717 17:73168162-73168184 CAGTTTCCACATCTCTAAAATGG + Intronic
1151344554 17:73493618-73493640 CAGTTTCTGTATCTATAAAATGG + Intronic
1151427839 17:74042638-74042660 CAGCATCCTCATCTCTAAAATGG + Intergenic
1151464875 17:74278139-74278161 CAGTTTCTTCATCTCGAAAATGG + Intronic
1151981066 17:77508950-77508972 CAGTTTCTCCATCTATAAAATGG + Intergenic
1152109893 17:78352240-78352262 CAGTTTCTCCATCTCTGAAATGG + Intergenic
1152368283 17:79870028-79870050 CAGTATCTACCTCTCTGCCAGGG - Intergenic
1153059571 18:981351-981373 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1153187616 18:2502261-2502283 CAGTTTCTTCATCTTTAAAATGG + Intergenic
1153356837 18:4146265-4146287 TAGTATCTTCATCTGTAAAATGG - Intronic
1153510773 18:5849512-5849534 CTGTTTCTGCATCTATAAAATGG - Intergenic
1153595784 18:6724042-6724064 CAGTTTCTTCAACTGTAACATGG + Intergenic
1153687291 18:7558952-7558974 CAGTCTCCTCATCTCTAAAATGG + Intergenic
1153939394 18:9964830-9964852 CAGGTTCTGCATCTGTAAAAAGG + Intergenic
1153996828 18:10450103-10450125 CAGTTTCCCCATCTATAACATGG - Intergenic
1154445580 18:14432954-14432976 CACTTTCTTCATCTGTAACATGG - Intergenic
1154449933 18:14466740-14466762 CAGGAGCTGCATTTCAAACAAGG - Intergenic
1154486674 18:14877418-14877440 CAGTTTCTGCATCCATAGCATGG + Intergenic
1154533774 18:15375629-15375651 TTGTATCTGAATTTCTAACAGGG + Intergenic
1155107883 18:22685835-22685857 CACTTTCTGTTTCTCTAACATGG + Intergenic
1155346275 18:24860258-24860280 CAGTCTCAGCATCTGTAAAATGG + Intergenic
1155679383 18:28471320-28471342 TACTATCTGCATTTCTCACATGG + Intergenic
1155984653 18:32217401-32217423 CAGTATCTTCATCTAGAAAATGG - Intronic
1156134939 18:34026309-34026331 CAGTCTCTCCATCTCCAGCATGG + Intronic
1156353723 18:36323051-36323073 CAGTTTCTGCATCTGTAAGGTGG + Intronic
1156461320 18:37322873-37322895 CAGCCTCTCCATCTCTAAAATGG - Intronic
1156638866 18:39065594-39065616 CAGTCTCTTCATCTTTAAGAAGG + Intergenic
1156699221 18:39805048-39805070 CAGTTTCCCCATCTCTAAAATGG + Intergenic
1156830124 18:41481946-41481968 CAGTTTCTCCATCTGTAAAATGG + Intergenic
1156844232 18:41645392-41645414 CATTTTTTTCATCTCTAACATGG + Intergenic
1157128114 18:44976934-44976956 CAGTTTCTGTATCTCTAAAATGG + Intronic
1157291917 18:46415724-46415746 CAGTTTCTTCATCTCTAAAATGG + Intronic
1157429235 18:47610606-47610628 CAGTCTCCTCATCTATAACACGG - Intergenic
1157722779 18:49938264-49938286 TAATATCTTCATCTGTAACAAGG + Intronic
1157882958 18:51339543-51339565 CAGTTTCTGCATCTTTAAAATGG - Intergenic
1157921404 18:51716500-51716522 GAGAATTTGCATTTCTAACAAGG - Intergenic
1157938988 18:51905665-51905687 CAGTTTCTCCATCTGTAAAATGG + Intergenic
1157985899 18:52436976-52436998 CAGTTTCTCCATCTATAAAATGG - Intronic
1158095689 18:53767851-53767873 CAGTATTTGCTTCTCTGAAAAGG - Intergenic
1158200847 18:54938695-54938717 CAGTTTCTACATCTGTAAAATGG - Intronic
1158404832 18:57151769-57151791 GAGACTCTGCATTTCTAACAAGG + Intergenic
1159052038 18:63429412-63429434 CTGTTTCTGCATCTGTAAAATGG + Intergenic
1160863550 19:1247850-1247872 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1160964995 19:1743450-1743472 CAGTTTCTCCATCTGTAAAATGG - Intergenic
1161074605 19:2279190-2279212 CGGTTTCCCCATCTCTAACATGG + Intronic
1161263846 19:3353752-3353774 CAGTTTCTGCATCTGCAAAATGG + Intergenic
1161338402 19:3727127-3727149 CAGTTTCCTCATCTGTAACATGG + Intronic
1161344427 19:3761051-3761073 CAGTTTCTTCATCTGTAAAATGG - Intronic
1161613983 19:5259906-5259928 CAGTATCTCCATCACTAAGGAGG + Intronic
1162046506 19:8004060-8004082 CAGTTTCTTCATCTCTAAAATGG + Intronic
1162181352 19:8871294-8871316 CAGTTTCTTCATCTGTAAAATGG + Intronic
1162524538 19:11199731-11199753 CAGTTTCTACATCTGTAAAATGG - Intronic
1162750060 19:12823914-12823936 CAGTTTCTTCATCTTTAAAATGG - Intronic
1162840058 19:13349747-13349769 CAGTTTCTTCATCTGTAAAATGG + Intronic
1163157410 19:15447042-15447064 CAGTTTCCCCATCTCTGACACGG + Intronic
1163257308 19:16164555-16164577 CAGTCCCTGCATCTGTAAAATGG - Intronic
1163371093 19:16901707-16901729 CAGTTTCTCCTTCTGTAACATGG + Intronic
1163473059 19:17508767-17508789 CAGTTTCTGCATCTGTACAATGG - Intergenic
1163481420 19:17558836-17558858 CAGTTTCCTCATCTGTAACATGG - Intronic
1163494599 19:17638959-17638981 CAGTATCTTCTTCTATAAAATGG - Intronic
1163584116 19:18154751-18154773 CAGTTTCCCCATCTGTAACAGGG + Intronic
1163629837 19:18412682-18412704 CAGTTTCCCCATCTGTAACATGG + Intergenic
1163630162 19:18414308-18414330 CAGTTTCCCCATCTGTAACATGG + Intergenic
1164051780 19:21590099-21590121 CAGTCTCCTCATCTGTAACATGG + Intergenic
1164917946 19:32066876-32066898 CAGTCTCTGCATCTGTAAAATGG + Intergenic
1164961828 19:32438540-32438562 GTGTATCTACATCTCAAACAAGG - Intronic
1165106709 19:33474332-33474354 CAGTTTCTTCATCTGTAGCATGG + Intronic
1165251331 19:34538564-34538586 CAGTTTCTCCATCTATAAAATGG - Intergenic
1165268828 19:34687021-34687043 CAGTTTCTCCATCTGTAAAATGG + Intergenic
1165310820 19:35028547-35028569 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1165767285 19:38359458-38359480 CTGTCCCTGCAGCTCTAACAAGG + Exonic
1165858983 19:38897105-38897127 CAGATTCTGCATCTGTAAAATGG + Intronic
1165885793 19:39077295-39077317 CAGTTTCTCCATCTATAAAATGG + Intergenic
1165954305 19:39492431-39492453 CAGTTTCCTCATCTCTAAAATGG + Intronic
1166051792 19:40264975-40264997 CAGTTTCTTCATCTATAAAATGG + Intronic
1166075646 19:40412372-40412394 CAGTTTCTCCATCTGTAAAATGG + Intronic
1166166017 19:40989374-40989396 CAATATCTCCATCTATAAAATGG + Intergenic
1166698997 19:44871207-44871229 CTGTCTCTGCATCTCTGGCAGGG + Intronic
1166824496 19:45600694-45600716 CAGTTTCTCCATCTATAAAATGG + Intronic
1166833049 19:45649632-45649654 CTGTATCATCATCTCTAAAATGG - Intergenic
1166876465 19:45900896-45900918 CAGTTGCTGCATCTGTAAAATGG - Intronic
1167005929 19:46776641-46776663 CAGTTTCTCCATCTGTAAAACGG - Intronic
1167018797 19:46859755-46859777 CAGTCTCTTCATCTATAAAATGG - Intergenic
1167193371 19:48007832-48007854 TAGTTTCTGCATCTATAAAATGG + Intronic
1167580885 19:50341865-50341887 GAGAATTTGCATTTCTAACAAGG + Intronic
1167645118 19:50701583-50701605 CAGTTTCTTCATCTGTAAAATGG - Intronic
925973409 2:9123905-9123927 CAGTTTCTTCATCTGTAAAAAGG - Intergenic
925982091 2:9185119-9185141 CAGTTTCTTCATCTATAAAATGG + Intergenic
926369856 2:12168808-12168830 CAGTCTCTTTATCTCTAAAATGG + Intergenic
926562062 2:14428460-14428482 CAGTTTCTTCATTTCTAAAATGG + Intergenic
926695699 2:15768994-15769016 CACTCTCTGCATCTGTAATAAGG + Intergenic
926801289 2:16663272-16663294 CAGTTTCTCCATCTTTAAAATGG - Intronic
926938033 2:18105622-18105644 GAGAATTTGCATTTCTAACAAGG + Intronic
927050564 2:19324109-19324131 CAGTGTCTACATCTGTAAAATGG + Intergenic
927446457 2:23166270-23166292 CAGTTCCTTCATCTCTAAAATGG - Intergenic
928151960 2:28839140-28839162 CAATTTCTTCATCTCTAAAATGG - Intronic
928159170 2:28906196-28906218 TATTAACTACATCTCTAACATGG + Intronic
928208356 2:29304194-29304216 CAGATTCTGCATTTCTAACAAGG - Intronic
928314424 2:30234648-30234670 CAGTTTCTTCATCTGTAAAATGG + Intronic
928664131 2:33533574-33533596 CAGTTTCTGCATCTGGAAAATGG - Intronic
928915487 2:36465785-36465807 CAGTTTCTACATCTCTAAAATGG + Intronic
929060479 2:37919267-37919289 CAGTTTCTGCTTCTTTAAAAGGG + Intergenic
929216684 2:39421543-39421565 CAGTTTCTGTATCTGTAAAATGG + Intronic
929250220 2:39745982-39746004 CAGTTTCTTCATCTGTAAAATGG + Intronic
929254881 2:39799422-39799444 CAGTATCCTCATCTGTAAAATGG + Intergenic
929336225 2:40749499-40749521 CTTTATCTGCACCTCTAATACGG - Intergenic
929493657 2:42420353-42420375 CAGTTTCTTCATCTGTAAGAGGG + Intronic
929919611 2:46162981-46163003 CAGTATGTGCATCACTGCCATGG - Intronic
929977883 2:46652866-46652888 CAGTCTCTTCATCTGTAAAATGG - Intergenic
930536973 2:52655171-52655193 CAGTATCTGCTTCTGAAACCAGG + Intergenic
930793466 2:55360027-55360049 AAGTATCTTCATCTATAAAATGG + Intronic
930865755 2:56120631-56120653 CAGTTTCTTCATCTGTAAAATGG - Intergenic
931067154 2:58599779-58599801 CCATCTCTGCATCTCTTACAGGG - Intergenic
931258280 2:60594409-60594431 CAGTTTCTGAAACTCTAAAATGG + Intergenic
931260165 2:60610992-60611014 CAGTGCCTTCATCTCTAAAATGG + Intergenic
931648720 2:64449709-64449731 CAGTATCTGCATCATGAAGAGGG - Intergenic
931666452 2:64612755-64612777 CAGTTTCTGCATCTGTAAAATGG - Intergenic
931936749 2:67206682-67206704 GAGATTCTGCATTTCTAACAGGG + Intergenic
932035988 2:68247338-68247360 GAGAATGTGCATTTCTAACAAGG + Intronic
932245115 2:70190476-70190498 CAGTTTCCTCATCTCTAAGATGG - Intronic
932314422 2:70770034-70770056 CAGTCTCTTCATCTATAAAATGG - Intergenic
932870866 2:75396308-75396330 CAGTATCTGCTTCTGAAACTGGG + Intergenic
933267165 2:80193491-80193513 CAATTTCTGCATCTGTAAAATGG - Intronic
933720935 2:85397266-85397288 CAGAACATGCATCTCTAACAAGG - Intronic
934862943 2:97779602-97779624 TAGAATTTGCATTTCTAACAAGG - Intronic
935264545 2:101383308-101383330 CAGTTTCTTCATCTGTAAAATGG - Intronic
935315326 2:101827751-101827773 CAGTATCTTCATATTGAACATGG + Intronic
935934411 2:108166350-108166372 CAGTTTCTGCCTCTGTAACATGG + Intergenic
936030136 2:109064142-109064164 CAGTCTCTTCATGTCTAAAATGG - Intergenic
936560642 2:113536440-113536462 CAGTTTCTGCATCTATAAAATGG - Intergenic
936560710 2:113537130-113537152 CAGTTTCTGCATCTGTAAAATGG + Intergenic
936991768 2:118374239-118374261 CAGTTTTTTCATCTTTAACATGG + Intergenic
937036907 2:118789647-118789669 CAGTTTCTCCAACTATAACATGG + Intergenic
937347479 2:121135352-121135374 CAGTCTCTCCATCTGTAAAATGG - Intergenic
937701264 2:124865640-124865662 AAGAATCTGCATTTCTAACAGGG - Intronic
937865642 2:126749541-126749563 CAGTGTCTCCATCTTTAAAATGG + Intergenic
937865783 2:126750965-126750987 CAGTGTCTCCATCTTTAAAATGG - Intergenic
937866334 2:126754102-126754124 CAGGATCTGCATTTCAGACATGG - Intergenic
937884845 2:126892649-126892671 CAGTTTCTTCATCTTTAAAATGG - Intergenic
938051953 2:128181853-128181875 CAGTTTCTTCATCTGTAAAATGG - Intronic
938122887 2:128646058-128646080 CAGTTTCTTCATCTTTAAAATGG - Intergenic
938532514 2:132202882-132202904 TTGTATCTGAATTTCTAACAGGG + Intronic
938569057 2:132545565-132545587 CAGCATCTGGATCTGGAACAGGG - Intronic
938609090 2:132928194-132928216 CAGTATCTCCACCTGTAAAATGG + Intronic
938635003 2:133214315-133214337 CAGTTTCTTCATCTATAAAATGG - Intronic
938694006 2:133818907-133818929 CAGTTTCTTCATCTGTAAAATGG + Intergenic
938818930 2:134933901-134933923 CAGTTTCTGCATCTGTAAAATGG - Intronic
939024059 2:136990764-136990786 CAGTATCTCCATCTCAAACAAGG - Intronic
939147300 2:138431413-138431435 CAGTGTTTGCATCTTTAAAAGGG - Intergenic
939783607 2:146480517-146480539 CTGATTCTGCATTTCTAACAGGG - Intergenic
939957857 2:148541573-148541595 CAGCAACTCCATCTCTAATATGG + Intergenic
940047117 2:149421436-149421458 CAGTTTCTGTATCTGTAAAATGG + Intronic
940859034 2:158753307-158753329 CAGTTTCCTCATCTCTAAAATGG - Intergenic
941313255 2:163960840-163960862 CAGTTTCTGCATCTGTAAGATGG + Intergenic
941741022 2:169035345-169035367 CAGTTTCTTCATCTGTAAAATGG + Intergenic
942040552 2:172057757-172057779 CAGTATCTTCAACTGTGACATGG + Intronic
942124318 2:172808710-172808732 CAGTATCTTCATTTGTAAAATGG - Intronic
942131194 2:172881629-172881651 CAGTTTCATCTTCTCTAACAAGG + Intronic
942403607 2:175629664-175629686 GAGAATCTGCATTTGTAACAAGG - Intergenic
942605012 2:177681489-177681511 CAATTTCTTAATCTCTAACACGG + Intronic
942631564 2:177955582-177955604 GAGATTCTGCATTTCTAACAAGG + Intronic
942639599 2:178047823-178047845 CAGAATCTCCATATATAACATGG - Intronic
942671993 2:178385805-178385827 TATTGTCTGCATCTGTAACATGG + Intronic
943003394 2:182358779-182358801 CAGTTTCCTCATCTGTAACACGG - Intronic
943219037 2:185080157-185080179 CAGTATCTCCTTCTTTAACAAGG - Intergenic
943733407 2:191327476-191327498 CAGTGTCTTCATCTCCAACATGG - Intronic
944170487 2:196771599-196771621 CAGTTTCTTGATCTCTAAAATGG - Intronic
944215094 2:197246807-197246829 CAGTTTCCTCATCTCTAAAATGG - Intronic
944436259 2:199693670-199693692 CAGTATCCTCATCTGTAAAATGG + Intergenic
944513228 2:200484850-200484872 CAGTTTCTCCATCTGTAAAATGG + Intergenic
944708246 2:202312377-202312399 CAGTTTCTGCAGCTATAAAATGG + Intergenic
945036139 2:205705695-205705717 CAGTATCTACATCTGTTAAATGG - Intronic
945166176 2:206949187-206949209 CAGTTTCTTCATCTCTGAAATGG + Intronic
945501781 2:210584637-210584659 CAGTTTCTTCATCTATGACATGG - Intronic
945569255 2:211443760-211443782 CAATATCTTCATCTATAAAATGG + Intronic
946048281 2:216839336-216839358 CAGTTCCTGCATCTGTAAAATGG - Intergenic
946184503 2:217972173-217972195 CAGCTTCTTCATCTGTAACATGG - Intronic
946283860 2:218687714-218687736 CAGTTTCTTCATCTATAAAATGG + Intronic
946623418 2:221584217-221584239 CAGTTTCTTCATCTCTAAAATGG + Intergenic
946718611 2:222579939-222579961 CAGTTTCTTCATCTGTAAAATGG - Intronic
946807279 2:223483679-223483701 AAGAATCTGCATTTCTAACATGG - Intergenic
946888039 2:224244195-224244217 CACTTTCTGCATCTGTAAAATGG + Intergenic
947302506 2:228704194-228704216 CAGTTTCTTCATCTCTGAAATGG + Intergenic
947812593 2:233013828-233013850 CTGTTTCTGCATCTTTAAAATGG - Intronic
947841705 2:233211940-233211962 CAGTTTCTCCATCTGTAAAAAGG + Intronic
948303659 2:236929955-236929977 CAGTTTCCTCATCTCTAAGATGG + Intergenic
948685775 2:239668956-239668978 CAGTATATGCATGTATATCAGGG - Intergenic
1168796474 20:613104-613126 CCGTATCTTCATCTGTAAAATGG - Intergenic
1168842987 20:921576-921598 CAGTTTCCTCATCTATAACATGG + Intergenic
1168951904 20:1808129-1808151 CAGTTTCTGCATCTGTCAAATGG + Intergenic
1168964254 20:1889603-1889625 GAAAATCTGCATTTCTAACAAGG - Intergenic
1169100002 20:2939366-2939388 CATTCTCTGCAGCTGTAACATGG + Intronic
1169454504 20:5740303-5740325 CAGTTTCTTCATCTGTAAAAGGG + Intergenic
1169921090 20:10734969-10734991 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1169987091 20:11457296-11457318 CAGTTTCTTCATCTCTAAAATGG + Intergenic
1170020839 20:11835068-11835090 CAGCCTCTGCATCTCTAAAATGG - Intergenic
1170037070 20:12000910-12000932 CAGTTTCCACACCTCTAACATGG + Intergenic
1170120807 20:12909629-12909651 CAGTTTCTTCATCTATAAAAAGG + Intergenic
1170459787 20:16566623-16566645 CAGTTTCTTCATCTGTAAAATGG - Intronic
1170538340 20:17363860-17363882 CAGTTTCTTCATCTGTAAAATGG - Intronic
1170605854 20:17874621-17874643 CAGTTTTTGCATCTGTAAAATGG + Intergenic
1170794136 20:19531939-19531961 CAGTTTCCTCACCTCTAACATGG - Intronic
1170941278 20:20850034-20850056 CAGTCTCTGCCTTTCTAATAAGG - Intergenic
1171103308 20:22407336-22407358 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1171260319 20:23726358-23726380 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1171983527 20:31643724-31643746 CAGTTTCGTCATCTCTAAAATGG + Intronic
1172011191 20:31846815-31846837 CAGTTTCCCCATCTCTAACATGG + Intergenic
1172028645 20:31966899-31966921 TAGTTTCTGCATCTGTAAAATGG + Intergenic
1172106664 20:32521283-32521305 CAGTCTATCCATCTCTAAGAGGG - Intronic
1172114310 20:32564662-32564684 CAGTTTCTTCATCTGTAAAATGG + Intronic
1172226139 20:33306429-33306451 CAGTTTCTCCATCTGTAAAATGG + Intronic
1172280757 20:33706233-33706255 CAGTTTCTACATCTGTAAAATGG + Exonic
1172425088 20:34850649-34850671 CAGTCTCTTCATCTTTAAAATGG - Intronic
1172600855 20:36181923-36181945 CAGTGTCTTCATCTATAAAATGG + Intronic
1172613084 20:36266191-36266213 CAGTTTCTTCATCTGTAAAATGG + Intronic
1172640758 20:36439215-36439237 CAGTTTCCTCATCTCTAAAATGG - Intronic
1172673331 20:36649405-36649427 CTGTTTCTGCATCTATAAAATGG + Intergenic
1172683734 20:36737567-36737589 CAGTTTCTTCATCTGTAAAATGG - Intronic
1172806589 20:37616198-37616220 CAGTTTCTTCATCTTTAACGTGG - Intergenic
1172870359 20:38131906-38131928 CAGTTTATTCATCTGTAACATGG - Intronic
1173004535 20:39129714-39129736 CAGTTTCTCTATCTCTAAAATGG - Intergenic
1173006658 20:39144943-39144965 CAGTGTCTTCATCTATAACATGG + Intergenic
1173057616 20:39631209-39631231 CAGTATCCTCATCTGTAAAATGG - Intergenic
1173146513 20:40529340-40529362 CAGTTTCTTCATCTTTAAAATGG - Intergenic
1173163814 20:40671996-40672018 CACTTTCTGCATATGTAACATGG - Intergenic
1173338283 20:42130978-42131000 CAGTGTCTTCATCTGTAAAATGG - Intronic
1173472023 20:43331532-43331554 CAGTTTCTTCATCTGTAAAACGG - Intergenic
1173605552 20:44328593-44328615 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1173620844 20:44434756-44434778 CAGTTTCATCATCTCTAAAATGG - Intergenic
1173835193 20:46120323-46120345 CAGTTTCTCTATCTCTAAAATGG - Intronic
1173836096 20:46126881-46126903 CAGTTTCTTCATCTGTAAAATGG + Intronic
1173840930 20:46156674-46156696 CAGTTTCTGTATCTATAAAATGG + Intergenic
1173848357 20:46202042-46202064 CAGTGTCTTCATCTGTAAAATGG - Intronic
1173854673 20:46242432-46242454 CAGTTGCTTCATCTGTAACATGG + Intronic
1173913115 20:46684995-46685017 CAGTTTCTCCATCTATAAAATGG + Exonic
1173930731 20:46816041-46816063 CAGTATCTGCATCTTTACCTGGG - Intergenic
1173971434 20:47155539-47155561 CAGTTTCCCCATCTCTAACATGG - Intronic
1174039549 20:47689157-47689179 CAGTTTCTTCATCTGTAAAATGG + Intronic
1174128214 20:48324172-48324194 CAGTTTCCCCATCTCTAAAATGG + Intergenic
1174169961 20:48610476-48610498 GAGTTTCTGCATCTATAAAATGG - Intergenic
1174211952 20:48886780-48886802 CAGTTTCTTCATCCGTAACATGG - Intergenic
1174282382 20:49448573-49448595 CAGTTTCCTCATCTCTAAAATGG - Intronic
1174283588 20:49456623-49456645 CAGGATCTGCATCCCTAACAAGG - Intronic
1174420176 20:50394318-50394340 CAGTGTCCGCATCTGTAAAATGG + Intergenic
1174423753 20:50417548-50417570 CAGTTTCCACATCTATAACATGG - Intergenic
1174466369 20:50720731-50720753 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1174514303 20:51079689-51079711 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1174524844 20:51162716-51162738 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1174621805 20:51880822-51880844 TAGTTTCTGCATCTCTAAAATGG + Intergenic
1174708175 20:52678135-52678157 CAGTGTCTTCATCTGTAAGATGG - Intergenic
1174709073 20:52686073-52686095 CAGTTTCTTCATCTCTAAAATGG + Intergenic
1174709411 20:52688974-52688996 CAGTTTCTGCATCTGTAAAACGG - Intergenic
1174768590 20:53276544-53276566 CAGTTTCTTCATCTATAAGATGG + Intronic
1174774800 20:53333818-53333840 CAGCGACTGCATCTCTAGCATGG + Intronic
1174819570 20:53714769-53714791 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1174858195 20:54066394-54066416 CAGGTTCTGCATCTGTAAAATGG - Intronic
1174928948 20:54792731-54792753 CCTTATCTGCATCTCTTTCAGGG + Intergenic
1175221071 20:57416774-57416796 CAGTGTCTGCATCTATAAAGTGG - Intergenic
1175272118 20:57741742-57741764 CAGTCTCTTCCTCTCTAAAATGG + Intergenic
1175279795 20:57795348-57795370 CAGTTTCTGCCTCTGTAAGACGG - Intergenic
1175517390 20:59577958-59577980 CAGTTTCTGCATCTGTGAAATGG + Intronic
1175530144 20:59669150-59669172 CAGTTTCTGCAGCTGTAAAATGG + Intronic
1175610429 20:60346888-60346910 CAGTGTCTGCATTTCTAGAATGG + Intergenic
1175681433 20:60991675-60991697 CAGTATTTGCATCTCTCACCTGG + Intergenic
1175772760 20:61634063-61634085 CGGTTTTTCCATCTCTAACAGGG + Intronic
1175806556 20:61832309-61832331 CAGTTTCCTCATCTGTAACAGGG + Intronic
1176446243 21:6823612-6823634 CAGGAGCTGCATTTCAAACAAGG + Intergenic
1176450398 21:6856907-6856929 CACTTTCTTCATCTGTAACATGG + Intergenic
1176794628 21:13361981-13362003 CAGTTTCTGCATCCATAGCATGG - Intergenic
1176824412 21:13688642-13688664 CAGGAGCTGCATTTCAAACAAGG + Intergenic
1176828567 21:13721925-13721947 CACTTTCTTCATCTGTAACATGG + Intergenic
1176935000 21:14857379-14857401 CAGTATTCTCATCTCTAATATGG + Intergenic
1176983622 21:15411034-15411056 CAGTATCTTCATCTGTAAAATGG + Intergenic
1177126632 21:17201839-17201861 CAGCATCTGCTTCTCACACAGGG + Intergenic
1178012254 21:28302006-28302028 CAGTATCTGCATCTGTAACTGGG - Intergenic
1178376049 21:32068251-32068273 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1178398333 21:32262126-32262148 CAGTTTCTGCATGTGTAAAATGG + Intergenic
1178486257 21:33021535-33021557 CAGTATCTTCATCTGTAAAATGG + Intergenic
1178492808 21:33064085-33064107 CAGTTTCCTCATCTCTAAAATGG - Intergenic
1179293526 21:40040759-40040781 CAGTTCCTGCATCTGTAAAATGG - Intronic
1179313666 21:40220996-40221018 CAGTTTCTGCATCTGTGAAATGG - Intronic
1179524855 21:41969191-41969213 CAGTTTCCTCATCTGTAACATGG + Intergenic
1179600660 21:42475603-42475625 CAGGCTCTGCATGTCTGACAGGG + Intronic
1179711101 21:43263679-43263701 CAGCTTCTGCATCTGTAAAATGG + Intergenic
1180482717 22:15769617-15769639 CAGGAGCTGCATTTCAAACAAGG + Intergenic
1180511129 22:16091379-16091401 TTGTATCTGAATTTCTAACAGGG - Intergenic
1180899287 22:19359111-19359133 CAGTTTCCCCATCTGTAACACGG + Intronic
1181138924 22:20789219-20789241 CAGTATCCTCATCTGTAAAATGG + Intronic
1181733931 22:24867318-24867340 CAGTTTCCCCATCTGTAACATGG + Intronic
1181786083 22:25228173-25228195 CAGTTTCTTCATCTGTAAAATGG + Intronic
1181818258 22:25456003-25456025 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1181895415 22:26103159-26103181 CACTATCTTCATCACCAACATGG - Intergenic
1181910901 22:26237475-26237497 CAGTTTCTTCATCTATAAGATGG + Intronic
1181969678 22:26680741-26680763 CAGTTTCTCCATCTGTAAAATGG + Intergenic
1181986356 22:26802500-26802522 CAGTCTCTTCATCTGTAAAATGG - Intergenic
1182022705 22:27094566-27094588 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1182044159 22:27261317-27261339 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1182097783 22:27637691-27637713 CAGTTTCTGCATCTGTGAAATGG - Intergenic
1182161958 22:28131718-28131740 CAGTTTCTTCATCTGTAAAATGG + Intronic
1182239369 22:28902718-28902740 CAGTTTCTGCATCTGTAAAATGG + Intronic
1182438147 22:30344510-30344532 CTGTTTCTGCTTCTCAAACATGG + Intronic
1182671331 22:31998320-31998342 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1182730709 22:32489326-32489348 CAGTTTATGCATTTCCAACAGGG - Intronic
1182773219 22:32810956-32810978 CAGTTTCCTCATCTCTAAAATGG + Intronic
1182779176 22:32853837-32853859 CAGTTTCTTCATCTGTAAAATGG - Intronic
1183022767 22:35040381-35040403 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1183272759 22:36872223-36872245 CAGTTTCTACATCTGTAAAATGG + Intronic
1183536598 22:38405210-38405232 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1183649242 22:39144892-39144914 CAGTTTCTCCATCTGTAAAATGG - Intronic
1183781641 22:40002683-40002705 CTGTTTCTGCATCTCTAACATGG + Intronic
1184062102 22:42089734-42089756 CAGTTTCTTCATCTTTAAAATGG - Intronic
1184166811 22:42734323-42734345 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1184372281 22:44090149-44090171 CAGTTTCCCCATCTGTAACATGG - Intronic
1184431946 22:44446178-44446200 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1184520818 22:44992926-44992948 CAGTCCCTGCATCTGTAAAATGG - Intronic
1184589909 22:45475268-45475290 CAGTCTCTCCATCTCTAAAGTGG + Intergenic
1184642886 22:45881535-45881557 CAGTTTCTTCATCTTTAACATGG - Intergenic
1184874430 22:47264326-47264348 CAGTTTCTTCATCCGTAACATGG + Intergenic
1185018567 22:48359836-48359858 CAGTTTCTTCATCTCTAAATGGG - Intergenic
949415523 3:3809720-3809742 CAGTATCTACATCTGCAAAATGG + Intronic
949774581 3:7618240-7618262 CAGTTTCTTCATTTGTAACATGG + Intronic
949795823 3:7849659-7849681 CAGTTTCTTCATCTATAAAATGG + Intergenic
949924970 3:9033799-9033821 CAGTCTCTGCCTCTGTAAAATGG - Intronic
950023450 3:9805287-9805309 CAGTTTATTAATCTCTAACATGG - Intronic
950172265 3:10847119-10847141 CAGTTTCCTCATCTCTAAAATGG - Intronic
950189202 3:10964969-10964991 CAGTTTCCTCATCTGTAACATGG + Intergenic
950230871 3:11274737-11274759 CAGTTTCCTCATCTCTAAGAAGG + Intronic
950393937 3:12719089-12719111 CAGTTTCTTCATCTCCAAAATGG + Intergenic
950452088 3:13071274-13071296 CAGTTTCCCCATCTCTAAAATGG + Intronic
950481819 3:13248758-13248780 CAGTTTCCTCATCTATAACATGG - Intergenic
950502130 3:13371272-13371294 CAGTTTCTTCATCTGTCACATGG + Intronic
950504904 3:13388644-13388666 AAGTATCTGCATTTTTCACAAGG - Intronic
950536633 3:13582680-13582702 CAGTTTCTGCATCTGTACAATGG + Intronic
950580814 3:13861017-13861039 CAGTTTCTGCATCTGTAAAATGG - Intronic
950586740 3:13897676-13897698 CAGTTTCTTCATCTATAAAATGG + Intergenic
950644947 3:14371536-14371558 CTGTTTCTGCATCTATAAAATGG + Intergenic
950667842 3:14508033-14508055 CAGTTTCTTCATCTGTAAAATGG + Intronic
950716512 3:14851308-14851330 CAGTTTCCTCATCTATAACATGG - Intronic
950811921 3:15657434-15657456 CAGTTTCTTCATCTGTAAAATGG - Intergenic
950905803 3:16536874-16536896 CAGTTTCTTCTTCTCTAAAATGG + Intergenic
951026607 3:17837735-17837757 CAGTTTTTTCATCTCTAACATGG + Intronic
951063709 3:18239653-18239675 TAGTTTCTGCATCTCTAAAATGG - Intronic
951708638 3:25568318-25568340 CAGTTTCTTCATCTGTAAAATGG + Intronic
952090826 3:29883359-29883381 CAGTGTCTTCATCTATAAAATGG + Intronic
952157079 3:30655063-30655085 CAGTCTCTTCATCTGTAAAATGG + Intronic
952324471 3:32308592-32308614 CAGTTTCTCCATCTGTAAAATGG + Intronic
952354104 3:32569134-32569156 CAGTTTCTTCATCTTTAAAATGG - Intronic
952544693 3:34406333-34406355 CAGTTTGTTCATCTATAACATGG - Intergenic
952828444 3:37543415-37543437 CAGTCTCTGCATCTCTAAAATGG + Intronic
953131635 3:40145097-40145119 CAGTTTCTTCATCTATAAGATGG - Intronic
953574598 3:44102914-44102936 CAGTTTCTCCATCTGTAAAATGG - Intergenic
953707131 3:45239808-45239830 GAGAATTTGCATCTCGAACAAGG + Intergenic
953897776 3:46815411-46815433 CAGTATCTGCTTCTGAAACTGGG + Intergenic
953957644 3:47244134-47244156 CTGTTTCTGCATCTCCAAAATGG - Intronic
954446305 3:50548727-50548749 CAGTTTCTTCATCTGTAAAATGG - Intergenic
954637685 3:52080121-52080143 CAGTTTCTTCATCTGTAAAATGG - Intronic
954812443 3:53256333-53256355 CAGTTTGTCCATCTCTAAAATGG - Intergenic
954882078 3:53843336-53843358 CTGTTTCTCCATCTGTAACATGG - Intronic
955229599 3:57086932-57086954 CAGTTTCTTCATCTGTAAGATGG - Intergenic
955322825 3:57986448-57986470 CAGTGTCTTCATCTGTAAAATGG - Intergenic
955512675 3:59697099-59697121 CAGTTTCTACAACTCTAAAATGG + Intergenic
955530495 3:59867884-59867906 CAGTCTCTTCAACTATAACAAGG - Intronic
955578698 3:60395342-60395364 CAGTGTCTGCATCTATAAAATGG - Intronic
955665928 3:61349088-61349110 CAGTTTCTTCATCTGTAAAATGG - Intergenic
955684696 3:61538174-61538196 AGGAATCTGCATTTCTAACAAGG + Intergenic
955819283 3:62878737-62878759 CAGTATCCTCATCTGTAAAATGG + Intergenic
955887449 3:63615710-63615732 AAGTATCTGTATATATAACAAGG - Exonic
956187617 3:66577455-66577477 CAGTTTTTGCATCTGTAAAACGG + Intergenic
956267883 3:67418141-67418163 CAGTTTCTTCATCTTTAAAATGG + Intronic
956432692 3:69203652-69203674 CAGTGTCTGCATCTGTAAAATGG + Intronic
956498773 3:69859028-69859050 CAAGATCTGCATCTATAAGATGG - Intronic
956515452 3:70041473-70041495 CAGTTTCTTCATCTAAAACATGG + Intergenic
956713203 3:72056552-72056574 CAGTGTCTGCATCTGTAAAATGG - Intergenic
956784244 3:72629169-72629191 CAGCTTCTGCATCTATAAAATGG - Intergenic
956949108 3:74259384-74259406 AAGAATCTTCATCTCTAAAATGG - Intergenic
957754230 3:84466459-84466481 CAGTATCTGCTTCTGTAGCCAGG - Intergenic
958194366 3:90223874-90223896 CAGTAGTTTGATCTCTAACATGG - Intergenic
958499462 3:94887201-94887223 CAGTATCTGCTTCTGAAACCAGG - Intergenic
958964501 3:100543912-100543934 CAGTTTCTTCATCTGTAAAATGG + Intronic
959142123 3:102498999-102499021 CAGTTTCCTCATCTCTAAGATGG + Intergenic
959324869 3:104924385-104924407 GAGAATCTGTATTTCTAACAAGG - Intergenic
959330037 3:104993010-104993032 CAGTATTTGCATCTCTCAGCTGG - Intergenic
959544420 3:107577523-107577545 CAGTATCCTCATCTATAAAATGG + Intronic
959820451 3:110729407-110729429 CAGTTTCCCCATCTCTAAAATGG - Intergenic
959896495 3:111612569-111612591 CAGTATCTTCATCTGTAAAGTGG - Intronic
960034158 3:113086344-113086366 CAGCCCCTGCATCTCCAACAGGG - Intergenic
960137971 3:114124632-114124654 CAGTTTCCTCATCTATAACATGG + Intergenic
960958424 3:123051712-123051734 TAGTGTCTGCATCTGTAAAATGG - Intergenic
961013612 3:123450623-123450645 CAGTTTCTGCATCTATAAGCTGG - Intergenic
961122178 3:124382120-124382142 CAGTTTCTTCATCTGTAAAATGG + Intronic
961476762 3:127151521-127151543 CAGTTTCTTCATCTGTAAGAGGG - Intergenic
961532609 3:127548272-127548294 CAGTGTCCTCATCTGTAACACGG + Intergenic
961658789 3:128457510-128457532 CAGTTTCTGCATCTGCAAAATGG + Intergenic
962113838 3:132480685-132480707 AAGTAACTGTATCTCTAATATGG + Intronic
962919815 3:139940380-139940402 CAGTTTCCTCATCTCTAAAATGG + Intronic
962946932 3:140180456-140180478 CTGTATCTGATTCTCTAAGAAGG - Intronic
963006337 3:140729335-140729357 CAGTTTCTTCATCTATAAAATGG - Intergenic
963535194 3:146519562-146519584 CAGTAATTGAATCTCTAAGAAGG - Intronic
963611438 3:147473555-147473577 CAGTTTCTGCTTCTCTTACTTGG - Intronic
963629928 3:147720299-147720321 CAGTATCTGCTTCTGAAACCAGG - Intergenic
963718669 3:148834557-148834579 CAGTATCTTCTGCTTTAACACGG - Exonic
963836509 3:150063104-150063126 CAGTTTCTTCATCTATAAAATGG + Intergenic
963861837 3:150319431-150319453 CAGTTTCTCCATCTGTAAAATGG - Intergenic
963905822 3:150772970-150772992 CAGTATCTTCATCTGGAAAATGG + Intergenic
964476427 3:157101886-157101908 CAGTTTCTTCATCTGTAAGATGG - Intergenic
964881471 3:161428029-161428051 CAGTGTCTTCACCTGTAACATGG - Intergenic
964948249 3:162253321-162253343 CAGTCTCTTCATCTGTAAAATGG - Intergenic
965182048 3:165416349-165416371 CAGTATTTGCATGTCTGAAAAGG - Intergenic
965406248 3:168273223-168273245 CAGTTTCCTCATCTGTAACATGG + Intergenic
965420123 3:168447709-168447731 CAGTTTCTTCATCTATAAAATGG - Intergenic
966192052 3:177280344-177280366 AAGGATCAGCATCTTTAACAAGG + Intergenic
966219167 3:177533491-177533513 CAGTTTCCTCATCTCTAAAATGG + Intergenic
966307686 3:178555436-178555458 CAGTTTCTACATCTATAAAATGG + Intronic
966412401 3:179657099-179657121 CAGTTTCTCCATCTGTAAAATGG + Intronic
966429265 3:179814375-179814397 CAGTTTCCTCATCTGTAACATGG - Intronic
966438566 3:179918030-179918052 CAGTTTCTGCATCTTTAAAATGG - Intronic
966560506 3:181314842-181314864 CAGTTTCTTCATCTCTGAAATGG - Intergenic
966567880 3:181403357-181403379 GAGTTTGTGCATTTCTAACAAGG - Intergenic
966608470 3:181845233-181845255 CAGTATCAGCATCTTTAAACAGG - Intergenic
966710115 3:182963185-182963207 CAATTTCTTCATCTCTAAAATGG + Intronic
966779637 3:183572958-183572980 CAGTTTCTTCATCTATAAAATGG + Intergenic
966794014 3:183697436-183697458 CAGTTTCTTCATCTGTAAAATGG + Intergenic
966818006 3:183904995-183905017 CAGTTTCTCCATCTGTAAAATGG - Intergenic
966913509 3:184572282-184572304 CAGTTTCCCCATCTGTAACATGG - Intronic
967047362 3:185750113-185750135 TAGAATTTGCATTTCTAACAAGG + Intronic
967299187 3:187995629-187995651 CAGTATCTTCATCTGCAAGATGG + Intergenic
967808151 3:193733065-193733087 CAGTTTCTACATCTGTAAAATGG + Intergenic
967940437 3:194762141-194762163 CATTCTCTGCATCTGTAAAATGG - Intergenic
968188598 3:196650996-196651018 CAGCATCTGCAGCTGTAAGAGGG - Intronic
968264629 3:197353476-197353498 CAGTTTCTTCATCTGTAAAATGG + Intergenic
968377711 4:57381-57403 CAGGATCTGCAGCTCCATCAGGG + Intronic
968394006 4:216397-216419 CAGGATCTGCAGCTCTACCAGGG + Intergenic
968411086 4:390703-390725 CAGGATCTGCAGCTCTACCAGGG + Intergenic
968878525 4:3286768-3286790 CAGTTTCTGCATCTGTAAACGGG + Intergenic
969109058 4:4830003-4830025 CAGTTTCCACATCTCTAAAATGG - Intergenic
969118612 4:4890104-4890126 CAGTTTCCTCATCTCCAACATGG + Intergenic
969160702 4:5256131-5256153 CAGTATCTGCATCTCTAACATGG - Intronic
969217313 4:5732638-5732660 CAGTTTCTGCATCTGTAAAATGG + Intronic
969841733 4:9887770-9887792 CAGCTTCAGCATCTATAACATGG + Intronic
970167628 4:13256475-13256497 CAGTTTCTCCATCTTTAAAATGG - Intergenic
970195780 4:13548527-13548549 CAGTTTCTTCATCTGTAAAACGG - Intergenic
970258024 4:14189669-14189691 CAGTTTCTTCATCTCTAAAATGG + Intergenic
970313591 4:14808325-14808347 CAGTTTCTTCATCTATAAAAAGG - Intergenic
970583340 4:17493057-17493079 CAGTTGCTGCATCTGTAAAATGG + Intronic
970670867 4:18395405-18395427 CAGTTTCTCCATCTGTAAAATGG - Intergenic
971040133 4:22742782-22742804 CAGTATCCTCATCTGTAAAATGG - Intergenic
971060918 4:22968484-22968506 CAGGATCTTCATCTTTAAGATGG - Intergenic
971120439 4:23698447-23698469 CAGTATCTCCATCTGTAAAATGG + Intergenic
971127714 4:23772538-23772560 CAGTTTCTTCATCTGTAAAATGG - Intronic
971328150 4:25661215-25661237 CAGTTTCTCCATCTATAAAATGG - Intronic
971343763 4:25793703-25793725 CAGTTTCTGCATCCATAAAATGG + Intronic
971783070 4:31063862-31063884 CAGTTTCTCCATCTATAAAATGG - Intronic
972084854 4:35204122-35204144 CAGTATCTGCTTCTGAAACTGGG - Intergenic
972378778 4:38499408-38499430 CAGTTTCTGCCCCTGTAACATGG - Intergenic
972454002 4:39234047-39234069 CAGTTTCTGGATCTCTAAAATGG + Intronic
972456143 4:39257361-39257383 AAGTATCTTCATCTCAACCAGGG - Intronic
972573601 4:40332096-40332118 CAGTTTCTTCATCTATAAAATGG - Intergenic
972601500 4:40576875-40576897 CAGTTTCTTCATCTATAAAATGG - Intronic
972736562 4:41847674-41847696 CAGTTTCTTCATCTGTAAGATGG - Intergenic
972946187 4:44258894-44258916 CAGTTTCTTCATCTGTAAAATGG + Intronic
973110593 4:46392243-46392265 CAGTAAATGCATCTCTAAATCGG - Intronic
973118056 4:46486125-46486147 CAGTATCTGCTTCTGAACCAGGG - Intergenic
973686615 4:53377105-53377127 CAGGATATGCATCTGTAGCAAGG + Intergenic
973720151 4:53715648-53715670 CAGTTTCTTCATCTCTAAAATGG - Intronic
974088390 4:57285103-57285125 CAGTCTCTGCATCTATAAAATGG - Intergenic
974577296 4:63743107-63743129 CAGTGTCTGCATCAATAAAAGGG + Intergenic
974660555 4:64882845-64882867 CAGTTTCTGTATGTCTAACAAGG + Intergenic
974700530 4:65439068-65439090 CAGTATCTTCACCTGTAAAATGG - Intronic
974803758 4:66853831-66853853 CAGTTTCTCCATCTATAAAATGG - Intergenic
975469864 4:74753344-74753366 CAGTTTCTTCATCTATAAAATGG - Intronic
975498140 4:75056960-75056982 CAGTTTCTTCATCTGTAAAATGG + Intergenic
975537272 4:75464309-75464331 CAGTTTCTTCATCTATAAAATGG - Intergenic
975606767 4:76162804-76162826 CAGTTTCTTCATCTGTAAAATGG - Intronic
975927287 4:79472660-79472682 CAGTTTCTCCATCTATAAAATGG + Intergenic
976641082 4:87338901-87338923 CAGTTTCTTTATCTGTAACATGG - Intronic
977801357 4:101236916-101236938 TAGTATCTTCATCTGTAAAATGG + Intronic
978424508 4:108567974-108567996 CAGTAACTCCATGTCTCACATGG - Intergenic
978535864 4:109761841-109761863 CAGTACCTTCATCTATAAAAGGG + Intronic
978970768 4:114802738-114802760 TAGTATCTTTTTCTCTAACAAGG - Intergenic
979097068 4:116563985-116564007 TTGTTTCTTCATCTCTAACAAGG - Intergenic
979471164 4:121098634-121098656 CAGTTTCTTCATCTCTTAAATGG - Intergenic
979802946 4:124934351-124934373 CAGTTTCTTTATCTCTAAAAGGG - Intergenic
981232805 4:142378142-142378164 CAGTTTCTCCAGCTCTAAAATGG - Intronic
981559409 4:146030533-146030555 CAGTTTCTACATCTATAAAATGG + Intergenic
981651482 4:147064182-147064204 CAGTATCATCATCTGTAAAATGG + Intergenic
982032255 4:151312596-151312618 CCGACTCTGCATTTCTAACAAGG - Intronic
982782882 4:159509567-159509589 CAGAAACTCCATCTCTACCAAGG - Intergenic
983073423 4:163295886-163295908 CAGCTTCTGTATCTGTAACATGG - Intergenic
983171109 4:164537574-164537596 CAGTTTCTGCATCTGCAAAATGG - Intergenic
983785306 4:171722202-171722224 CAGTATCTGCAGCTTCATCAGGG + Intergenic
984104022 4:175521774-175521796 CAGTTCCAGCTTCTCTAACATGG + Intergenic
984594570 4:181653300-181653322 AAGAATCTGCGTTTCTAACAAGG + Intergenic
984724816 4:183010323-183010345 CAGTATCCTCATCTATAAAATGG + Intergenic
984730394 4:183063117-183063139 CAGTTTCTTCACCTGTAACATGG - Intergenic
984884940 4:184441817-184441839 CAGTTTCTTCATCTATAAAATGG - Intronic
985016823 4:185644619-185644641 CAGTCTCTTCATCTGTAACATGG + Intronic
985024166 4:185722995-185723017 CAGTATCTGCATCTGTATATGGG + Intronic
985321473 4:188716518-188716540 CAGTATGTTCATCTATAACATGG - Intergenic
986069120 5:4265130-4265152 CAATATCTCCATCTGTAAAATGG - Intergenic
986444393 5:7808532-7808554 CAGTTTCTCCATCTTTAAAATGG - Intronic
986456888 5:7928481-7928503 CAGTGTCTTCATCTTTCACACGG + Intergenic
986957156 5:13166694-13166716 CAGTGTCTGCATCTTTGCCAGGG - Intergenic
987070709 5:14334701-14334723 CTGTGTCTGCATCTCTATCATGG - Intronic
987150621 5:15036028-15036050 CAGTTTCTCCATCTGTATCATGG + Intergenic
987203708 5:15603423-15603445 CAGTTTCTTCATCTGTAAAATGG - Intronic
987738784 5:21878407-21878429 CAGTTTCTTCATCTATAAAATGG + Intronic
987795153 5:22617992-22618014 CAGTTTCTGCATCTGTCAAATGG - Intronic
988290630 5:29280463-29280485 CAATATCTAGAGCTCTAACAAGG + Intergenic
988427836 5:31084433-31084455 CAGTATCCTCATTTCTAAAATGG + Intergenic
988563104 5:32298468-32298490 CAGTATCTTCATCTGTCTCAAGG - Intronic
988906848 5:35799113-35799135 AAGGATCTGCATGTCTAGCAAGG - Intronic
989450367 5:41579940-41579962 TAGTATCTCCATCTGTAAAATGG + Intergenic
989669358 5:43896947-43896969 CAGTATCCTCATCTATAAAATGG - Intergenic
990327365 5:54691660-54691682 CAGTTTCTTCATCTGTAAAATGG + Intergenic
990980807 5:61601114-61601136 CAGTTTCTTCATCTGTAAAATGG + Intergenic
991020236 5:61972513-61972535 CAGTTTCTGTATCTTTAAAATGG + Intergenic
991212768 5:64125352-64125374 CAGTTTCTGCATCTGAAAAATGG - Intergenic
991408036 5:66320564-66320586 CAGTCTCTGCATCTGTGAAATGG + Intergenic
991596782 5:68314673-68314695 CAGTTTCTTCATCTATAAAATGG + Intergenic
991614114 5:68478301-68478323 CAGTTTCTTCATCTGTAAAATGG - Intergenic
991680318 5:69133383-69133405 CAGTTTCTGCATCAGTAAAATGG - Intergenic
992210742 5:74477668-74477690 CAGTATCTTCAGCTGTAAAATGG + Intergenic
993012027 5:82493491-82493513 CAGTTTCTTCATCTCTAAAGAGG + Intergenic
993972257 5:94433647-94433669 CAGTTTCCTCATCTCTAAAAGGG + Intronic
994144772 5:96382750-96382772 CAGTTTCTTCATCTGTAAAATGG - Intergenic
995247473 5:109950808-109950830 CAGTTTCTGAAGCTCTAAAATGG + Intergenic
995420024 5:111953950-111953972 GAGTATCAGCATGTTTAACATGG + Intronic
995662547 5:114501138-114501160 CAGTATTTTCATCTGTAAAATGG - Intergenic
995680325 5:114710699-114710721 CAGTATTTTCATCTATAAAAGGG - Intergenic
996107337 5:119519620-119519642 CAGTCTCTGCATCTAAAACATGG - Intronic
996122085 5:119684009-119684031 CAGTTTCTTCATCTGTAAAATGG + Intergenic
996401177 5:123064367-123064389 TAGTATCTTCATCTCTAAAAAGG + Intergenic
996465636 5:123799423-123799445 CAGTATCAGCATCACTTAGATGG - Intergenic
996522580 5:124443640-124443662 CAGTATCTTCATGTGTAAAACGG + Intergenic
996704911 5:126487747-126487769 CAGTTTCTTCATCTGTAAAATGG - Intronic
997127799 5:131245933-131245955 CAGTTTCTCCATCTCTCACTTGG + Intronic
997199093 5:131998941-131998963 CTGTATCAGCCTCTCTAATAGGG + Intronic
997261324 5:132467462-132467484 CAGTTTCTGCACCTGTAAAATGG - Intronic
997262111 5:132473383-132473405 CAGTTTCTTCATCTGTAAAATGG - Intronic
997293434 5:132754276-132754298 CAGCATCTCCATCTGTAAAATGG - Intronic
997486769 5:134237429-134237451 TAGTATCTTCATCTGTAACATGG + Intergenic
997538034 5:134637908-134637930 CAGTTCCTGCATCTGTAAAATGG + Intronic
997893908 5:137698957-137698979 CAGTTTCTTCATCTGTAAAATGG - Intronic
997935542 5:138107392-138107414 CAGTTTCTTCATCTATAAAATGG - Intergenic
998212658 5:140212085-140212107 CAGTCTCCTCATCTCTAAAATGG - Intronic
998298844 5:140998921-140998943 CAGTTTCTTCATCTGTAAAATGG - Intronic
998384774 5:141750477-141750499 CAGTGTCTGCATCTATCAAATGG + Intergenic
998416906 5:141952706-141952728 CAGTTTCCTCATCTCTAATAGGG + Intronic
998431086 5:142070557-142070579 CAGTTTCTGCATCTGTAAAATGG + Intergenic
998460709 5:142308018-142308040 CAGTGTCTGCATCTCTAAGAGGG + Intergenic
998546910 5:143036700-143036722 CAGTTTCTTCATCTGTAATATGG + Intronic
998824702 5:146089466-146089488 CAGTATCCTCATCTGTAAAATGG - Intronic
998919384 5:147051278-147051300 CAGTTTCCTCATCTATAACATGG + Intronic
999005329 5:147970225-147970247 CAGTTTCTACATCTGTAAAATGG + Intergenic
999065932 5:148685520-148685542 CAGTTTCTTCATCTTTAAAAGGG - Intergenic
999085115 5:148881387-148881409 CAATTTCTGCATCTGTAAAATGG - Intergenic
999178397 5:149648649-149648671 CAGTTTCTCCATCTGTAAAACGG - Intergenic
999328115 5:150656094-150656116 CAGTTTCTGCTTCTGTAAAATGG - Intronic
999344340 5:150802127-150802149 CAGTTTCTACATCTGTAAAATGG + Intergenic
999775650 5:154811195-154811217 CAGTTTCTTCATCTGTAAAACGG - Intronic
999820943 5:155227967-155227989 CAGTTTCTGTATCTATAAAACGG + Intergenic
999881482 5:155869494-155869516 CAGTATCCACATCTATAAAATGG - Intergenic
999996963 5:157101555-157101577 CAGTATCTTCATCTGAAAAATGG - Intronic
1000035080 5:157440596-157440618 CAGTATCTCCATCTGTAAAATGG - Intronic
1000045742 5:157520610-157520632 CAGTTTCCTCATCCCTAACACGG + Intronic
1000135603 5:158347329-158347351 CAGTTTCTTCATCTTTAAAATGG + Intergenic
1000137181 5:158364303-158364325 CAGTTTCTCCATCTGTAAAAGGG - Intergenic
1000154569 5:158537942-158537964 CAGTTTCCTCATCTCTAAAATGG + Intergenic
1000198774 5:158987219-158987241 CAGTTTCTTCATCTGTAATATGG + Intronic
1000252149 5:159505949-159505971 CAGTTTCCTCATCTCTAAAATGG - Intergenic
1000277550 5:159752096-159752118 CAGTTTCTTCATCTTTAAAATGG - Intergenic
1000351033 5:160353129-160353151 CAGTATCCTCATCTGTAACATGG + Intronic
1000512705 5:162203667-162203689 CAGTATCTGAAGATCTAATAAGG + Intergenic
1000681238 5:164187626-164187648 GAGAATTTGCATTTCTAACAGGG - Intergenic
1000974855 5:167753597-167753619 CAGTTTCTTCATCTGTAATATGG - Intronic
1001002024 5:168016460-168016482 CAGTTTCTGCATCTATAAAGTGG - Intronic
1001044168 5:168358612-168358634 CAGTTTCTACATCTATAAAATGG + Intronic
1001146076 5:169185958-169185980 CTGTTTCTGTATCTCTAAAATGG + Intronic
1001218224 5:169875648-169875670 CAGTTCCTTCATCTGTAACATGG + Intronic
1001227443 5:169957286-169957308 CAGTTTCTGCATCCATAGCATGG + Intronic
1001287247 5:170432798-170432820 CAGTTTATGCATCTGTAAAATGG - Intronic
1001380490 5:171303300-171303322 CAGTTTTCTCATCTCTAACATGG - Intergenic
1001400414 5:171443049-171443071 CAGTTTCTTCATCTGTAAAATGG + Intronic
1001446406 5:171787346-171787368 CAGTTTCTTCATCTGTAAAATGG - Intronic
1001518883 5:172376820-172376842 CAGTATCTTCATCTGCAAAATGG - Intronic
1001686143 5:173596408-173596430 CAGTATCCTCATCTGTAAAATGG - Intergenic
1001694433 5:173659531-173659553 CAGAAGCTGCATCTCTCCCAAGG - Intergenic
1001710279 5:173772843-173772865 CAGTCTCTGCATCTCTAAAGTGG - Intergenic
1001725314 5:173891885-173891907 CAATTTCTGCATCTGTAAAATGG - Intronic
1001766898 5:174256403-174256425 CAGTTTCTTCATCTGTAAAACGG + Intergenic
1001967565 5:175922220-175922242 CCATTTCTGCATCTCTAAAATGG + Intronic
1002044664 5:176535193-176535215 CAGTATCTTCATCTGTAAAATGG + Intronic
1002060743 5:176624356-176624378 CAGTCTCTTCATCTGTAAAACGG + Intronic
1002096159 5:176832256-176832278 CATTTACTGCATCTCTAAAACGG - Intronic
1002102643 5:176865006-176865028 CAGTTTCTTCATCTGTAAAATGG + Intronic
1002106810 5:176883420-176883442 CAGTTTCCTCATCTCTAAGATGG - Intronic
1002178824 5:177419038-177419060 CTGGATCAGCATCTCTCACAAGG + Intronic
1002278350 5:178117118-178117140 CAGTTTCTGCATCTCTGAAGCGG - Intronic
1002311178 5:178314770-178314792 CAGTTTCTTCATCTATAAAATGG - Intronic
1002372987 5:178769526-178769548 CAGTTTCCTCATCTCTAAGATGG - Intergenic
1002845555 6:941475-941497 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1002994348 6:2268820-2268842 GTGTCTCTGCATTTCTAACAAGG + Intergenic
1003020247 6:2503406-2503428 CAGTGTCTTCATCTGTAAAATGG - Intergenic
1003251232 6:4430716-4430738 AAGAATTTGCATTTCTAACAAGG - Intergenic
1003378682 6:5602972-5602994 CAGTTTCTTCATCTATAAAATGG - Intronic
1004126675 6:12880999-12881021 CAGTTTCTTCATCTGTAAAATGG + Intronic
1004142328 6:13029975-13029997 CAGTTTCTGCATCTGTAAAATGG + Intronic
1004210243 6:13633513-13633535 CAGTTTCTTCATCTGTAAAATGG - Intronic
1004487236 6:16078180-16078202 CAGTCTCTTCATCTGTAAAATGG - Intergenic
1005251961 6:23956836-23956858 CAGTGTTTTCATCTCTAAAATGG + Intergenic
1005654502 6:27920380-27920402 CAGTTTCTACATCTATAGCATGG - Intergenic
1006169474 6:32084906-32084928 CAGTTTCTCCATCCCTCACAAGG + Intronic
1006259702 6:32857537-32857559 CAGTTTCTGCATCTGTAAAGTGG + Intronic
1006390718 6:33756746-33756768 CAGTTTCTCCATCTATAAAATGG - Intergenic
1006512882 6:34531197-34531219 CAGTTTCTCCATCTGTAAAATGG - Intronic
1006555578 6:34863247-34863269 CAGTTTCTTCATCTGTAAAATGG + Intronic
1006559025 6:34893113-34893135 CAATTTCTGCATCTGTAAAATGG + Intronic
1006620384 6:35359806-35359828 CAGTATCCTCATCTCTAAAAGGG - Intronic
1006716955 6:36126574-36126596 CAGTCTCTCCATCTGTACCAGGG + Intergenic
1006738152 6:36289771-36289793 CAGTTTCTGCGTCTGTAAAATGG + Intronic
1006786106 6:36668444-36668466 CAATATCTTCATGTCTAAAATGG - Intergenic
1006798158 6:36743885-36743907 CAGTTTCCTCATCTCTAACACGG - Intronic
1006800741 6:36758154-36758176 CAGTCTCCTCATCTCTAAAATGG + Intronic
1006905757 6:37532329-37532351 CAGTTTCCACATCTGTAACATGG + Intergenic
1006942824 6:37764174-37764196 CAGTTTCCTCATCTCTAAAATGG + Intergenic
1006948486 6:37801505-37801527 CAGTTTCTTCATCTCTAAAATGG + Intergenic
1006988910 6:38196260-38196282 CAGTCTCTTCATCTGTAAAATGG + Intronic
1007075229 6:39061989-39062011 CAGCTTCTGCATCTGTAAAATGG + Intronic
1007107163 6:39291531-39291553 CGGTTTCTCCACCTCTAACATGG - Intergenic
1007270076 6:40629635-40629657 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1007342120 6:41197926-41197948 CATTATCTTCATCTGTAAAATGG + Intronic
1007348330 6:41249811-41249833 CATTATCTTCATCTGTAAAATGG - Intergenic
1007401202 6:41603475-41603497 CAGTCTCTTCATCTATAAAATGG - Intergenic
1007481196 6:42151229-42151251 CAGTTTCTCCATCTGTAAAATGG + Intergenic
1007703675 6:43778676-43778698 CAGTTTCTACATCTGTAAAATGG + Intronic
1007738943 6:43999579-43999601 CAGTGACTGCATCTGTAAAATGG - Intergenic
1007788512 6:44295827-44295849 CAGTTTCTTCATCTATAACGTGG + Intronic
1007995265 6:46301275-46301297 CAGTGTCTGCATCTGTAAAATGG + Intronic
1008476123 6:51937709-51937731 CAGTTTCTCCATCTGTAAAATGG + Intronic
1009873680 6:69479649-69479671 CAGTCTCTGCATGTCTAATGTGG + Intergenic
1011801031 6:91016566-91016588 CAGTTTCCTCATCTCTAAAAGGG + Intergenic
1011872315 6:91911405-91911427 CAGCTTCTGCATCTGTAAAATGG + Intergenic
1011899753 6:92277334-92277356 CAGTTTCTACATCTGTAAAATGG - Intergenic
1011993675 6:93557184-93557206 CAGTTTCTTCATCTGTAAGATGG + Intergenic
1012490476 6:99778211-99778233 CAGTATTTGCATATCTGAAAAGG + Intergenic
1013104786 6:107017891-107017913 CAGTTTCTGGATCTGTAAAATGG - Intergenic
1013488869 6:110625230-110625252 CAGAATCTACATTTTTAACAAGG + Intronic
1013866968 6:114710428-114710450 CAGAATCTGAAACTTTAACAAGG - Intergenic
1013879387 6:114877063-114877085 CAGTTTCTGCATCTGTAGAATGG + Intergenic
1014139940 6:117929982-117930004 CAGTATCTTCATCTTTAAATTGG - Intronic
1014652073 6:124052176-124052198 CAGATTCTTCATCTATAACATGG - Intronic
1014737944 6:125116909-125116931 CAGTTTCTTCATCTGTAAGATGG + Intergenic
1014997269 6:128164570-128164592 CAATATCTTCATCTTTAAAAAGG + Intronic
1015680083 6:135797432-135797454 CAGTTTTTTCATCTCTAAAATGG - Intergenic
1015715226 6:136185407-136185429 CAGTTTCTTCATCTGTAAAATGG + Intronic
1015716620 6:136199327-136199349 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1015841620 6:137483174-137483196 CAGAATCTGTATTTCTAACAAGG + Intergenic
1016236371 6:141872208-141872230 TAGTTTCTTCATCTCTAAAATGG + Intergenic
1016254514 6:142088403-142088425 CAACATCTTCATCTCTAACCTGG - Exonic
1016478034 6:144449890-144449912 CAGTACCTTCATCTCTAAAGGGG + Intronic
1016512533 6:144859701-144859723 CAGTATGTGCTTCTGGAACAGGG - Intergenic
1016749720 6:147619419-147619441 GAGTATCTGCATATCTGCCATGG - Intronic
1016760513 6:147731097-147731119 CAGTTTCTTCATCTATAAAATGG - Intronic
1017090028 6:150750947-150750969 CAGTGTCTTCATCTGTAACATGG + Intronic
1017135129 6:151141234-151141256 CAGTTTTTGCATCTATAATATGG - Intergenic
1017212308 6:151870610-151870632 CATTTTCTGCTTCTGTAACATGG + Intronic
1017912066 6:158801906-158801928 CAGTGTCTGCAGCTCCATCATGG - Intronic
1018325842 6:162667807-162667829 CAGTTTCTTCATCTATAAGATGG + Intronic
1018449483 6:163893808-163893830 CAGTTTCTTCATCTATAAAATGG + Intergenic
1019114026 6:169742263-169742285 CAGTTTCTTCATCTATAAAATGG - Intronic
1019322651 7:422680-422702 CAGTGGCTGCATCTGTCACATGG - Intergenic
1019827861 7:3299626-3299648 CAGTTTCTCCATCTGTACCAGGG + Intergenic
1020246713 7:6435102-6435124 CAGTTTCTGAGTCTCTACCACGG + Intronic
1020464964 7:8466968-8466990 TAGTTTCTGCATCTGTAAAATGG + Intronic
1021043359 7:15890782-15890804 CAGTTTCCACATCTCTAAAATGG - Intergenic
1021121994 7:16806414-16806436 CAGTTTCTCCATCTATAATATGG + Intronic
1021348059 7:19552041-19552063 CAGTTTCCGCATCTCTAAAAAGG - Intergenic
1021417664 7:20406720-20406742 CAGTTTCCCCATCTATAACATGG - Intronic
1021857422 7:24871043-24871065 CAGTTTCTTCATCTGTAAAATGG - Intronic
1022012124 7:26317399-26317421 TAGTATCTTCATCTGTAAAATGG + Intronic
1022336654 7:29428143-29428165 CAGTTTCCTCATCTCTAAAATGG + Intronic
1022574122 7:31481404-31481426 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1022639382 7:32166975-32166997 CAGTTTCTTCATCTCTAAAATGG + Intronic
1022896565 7:34755921-34755943 CAGTTTCTGCAGGTCTAACATGG - Intronic
1022896791 7:34758087-34758109 CAGTTTCTTCATCTGTAAAATGG + Intronic
1023086300 7:36573011-36573033 CTGTTTCTGCATCTGTAAAATGG - Intronic
1023092928 7:36633195-36633217 AAGGATGTGCATCTCTAGCAAGG - Intronic
1023118791 7:36888578-36888600 CAGTTTCTTCATCTATAAAATGG + Intronic
1024282728 7:47732836-47732858 CAGAATCTGCATCTCAAAATGGG - Intronic
1024504192 7:50147408-50147430 CAGTTTCTCCATCTATAAAATGG + Intronic
1024675528 7:51634773-51634795 AAGAATCTACATTTCTAACAAGG + Intergenic
1025115196 7:56251969-56251991 CAGTTTCCTCATCTCTAAAATGG - Intergenic
1025247380 7:57327606-57327628 CAGTTTCCACATCTATAACATGG + Intergenic
1026583490 7:71637034-71637056 CAGTTTCTTCATCTGTAAAATGG + Intronic
1026650470 7:72211828-72211850 CAGTTTCTACATCTCTCAAATGG + Intronic
1026835197 7:73634110-73634132 CAGTTTCTGTATCTGTAAAATGG + Intergenic
1026951941 7:74353558-74353580 CAGCATCTTCATCTGTAAAAGGG - Intronic
1027217826 7:76195454-76195476 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1027958994 7:84919633-84919655 CAGTGTCTGCAGCTCTTCCAGGG + Intergenic
1029252960 7:99250174-99250196 CAGTCTCTTCATCTGTAAAATGG - Intergenic
1029478022 7:100796715-100796737 CAGAATCTGCATTTTCAACAAGG + Intronic
1029631400 7:101753119-101753141 CAGTTTCTTCAACTCTAAAATGG - Intergenic
1030235469 7:107255699-107255721 TAGTTTCTGCATCTATAAAATGG - Intronic
1030274218 7:107702300-107702322 CAGTTTCTTCATCTGTAATATGG + Intronic
1031001819 7:116424445-116424467 TATTATCCGCATCTCTAAGATGG + Intronic
1031025655 7:116676905-116676927 CTGTATCTTCATCTTTAACATGG - Intronic
1031068774 7:117138727-117138749 TAGTTTCTTCATCTCTAAAATGG + Intronic
1031467998 7:122137227-122137249 CAGTTTCTTCATCTATAAAATGG - Intronic
1031474809 7:122208252-122208274 CAGTATCTGCTTCTGAAACTGGG + Intergenic
1031722937 7:125200171-125200193 GAGTTTCTGAATTTCTAACAAGG + Intergenic
1031804431 7:126291692-126291714 CAGTTTCTGCATCTGTATTAAGG - Intergenic
1031977621 7:128103995-128104017 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1031994308 7:128219090-128219112 CAGTTTCTTCATCTATAAAATGG + Intergenic
1032498521 7:132381184-132381206 CAGTTTCCCCATCTATAACAAGG - Intronic
1032608529 7:133385671-133385693 CAGTTTCTCCATCTCTAAAATGG - Intronic
1032985903 7:137336903-137336925 CAGTGTTTTCATCTCTAACATGG - Intronic
1033590387 7:142803738-142803760 CAGTTTCCACATCTATAACATGG - Intergenic
1034234876 7:149558828-149558850 CAGTTTCTGCATCTGTCAAATGG + Intergenic
1034641447 7:152607185-152607207 CAGTTTCTCCATCTATAAAATGG - Intergenic
1034641669 7:152608852-152608874 CAGTTTCTCCATCTATAAAATGG + Intergenic
1034849250 7:154478599-154478621 CAGTTTCTTCATCTGTAAAATGG - Intronic
1035087833 7:156276469-156276491 GAGTATTTGCATCTCTGAAAGGG + Intergenic
1035190884 7:157167457-157167479 CAGTTTCTGCATCTTTAAACTGG + Intronic
1035825499 8:2640297-2640319 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1036040655 8:5076616-5076638 CTGTATATGCATCTCATACATGG - Intergenic
1036208121 8:6820046-6820068 CAGTTTTTGCATCTCTGAAATGG - Intronic
1036486305 8:9182504-9182526 CAGTTTCTGCATCTGCAAAATGG + Intergenic
1036676966 8:10842044-10842066 CAGATTCTGCATTTATAACAGGG + Intergenic
1036692829 8:10955585-10955607 CAGTTTCTTCATCTGTAAAATGG - Intronic
1036702541 8:11022664-11022686 CAGTGTTTGCATCTGTAAAAGGG - Intronic
1036752194 8:11450414-11450436 CAGTCTCTTCATCTGTAAAATGG - Intronic
1037778297 8:21849875-21849897 CAGTCTTTTCATCTCTAAAATGG + Intergenic
1038290093 8:26241518-26241540 CGGTTTCTGCATCTGTAAAATGG + Intergenic
1038447211 8:27612329-27612351 CAGTTTCTTCATCTGTAAAATGG + Intronic
1038464938 8:27753187-27753209 CTGTTTCTGCATCTGTAAAAGGG - Intronic
1038547788 8:28439215-28439237 CAGTTTCTTCATCTGTAAAATGG - Intronic
1038599986 8:28930425-28930447 CAGTATCTACACGTCTAAGATGG - Intronic
1039610758 8:38917531-38917553 CAGCTTCTGCATCTGTAAAACGG - Intronic
1039906249 8:41788550-41788572 CAGTTTCCTCATCTGTAACATGG + Intronic
1040088678 8:43372204-43372226 CAGTATCTGCTGCTCCATCATGG + Intergenic
1040751719 8:50717689-50717711 CATTTTCTTCATCTCTAAAATGG + Intronic
1041058756 8:54015703-54015725 CAGTATCAGCATATCTAACAAGG + Intronic
1041400871 8:57443362-57443384 CAGTTCCTTCATCTCTAAAATGG + Intergenic
1041650382 8:60296434-60296456 CAGTTTCCTCATCTCTAAAATGG - Intergenic
1041957442 8:63571728-63571750 CAGCATCTGCCTTTCTAACTGGG + Intergenic
1042511030 8:69611130-69611152 CAGTTTCTTCATCTGTAAAATGG + Intronic
1042511217 8:69613575-69613597 CAGTCTCTTCATATCTAAAATGG - Intronic
1043175020 8:77014339-77014361 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1043488794 8:80727030-80727052 CAGTTTCTCCATCTGTAAAATGG - Intronic
1044508371 8:93047716-93047738 CAGTATTTGCTTCTCTGAAAAGG + Intergenic
1044524328 8:93234553-93234575 CAGTAGCTTCTTCTCTAACGTGG + Intergenic
1044573209 8:93742261-93742283 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1044859707 8:96511041-96511063 CAGAATCTCCATTTCTAACAAGG - Intronic
1045327135 8:101126015-101126037 CAGAATCTGCATTTCTGACAAGG + Intergenic
1045350787 8:101337230-101337252 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1045642576 8:104268293-104268315 CAGAATATGCATTTCCAACAAGG + Intergenic
1046768941 8:118099661-118099683 CAGTTTCTTCATCTGTAAAATGG + Intronic
1046926463 8:119794599-119794621 CAGTTTCTTCATCTATAAAATGG + Intronic
1047075627 8:121399267-121399289 CAGTATCCTCATCTGTAAAATGG - Intergenic
1047096868 8:121635274-121635296 CAGTTTCTCCATCTATAAAATGG + Intronic
1047158957 8:122354860-122354882 CAGTTTCTGCATCTATGAAATGG - Intergenic
1047293159 8:123547713-123547735 CAGTCTCTTCATCTGTAAAATGG - Intergenic
1047445238 8:124913544-124913566 CAGTATCTTCATTTGTAAAATGG + Intergenic
1047493883 8:125396058-125396080 CAGTTTCCTCATCTCTAAAATGG - Intergenic
1047577443 8:126172881-126172903 CAGTTTCTTCATCTATAAAATGG - Intergenic
1047714159 8:127580194-127580216 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1047721470 8:127644346-127644368 CAGTGTCTTCATCTGTAAAAAGG + Intergenic
1047796234 8:128258551-128258573 CAGTTTCTCCATCTGTAAAATGG - Intergenic
1047871592 8:129088793-129088815 CAGTTTTTGCATCTCTAAAATGG + Intergenic
1048018975 8:130520919-130520941 CAGTATCCTCATCTCCAAAATGG - Intergenic
1048352919 8:133630412-133630434 CAGTATCTCCATCTGGAAAATGG - Intergenic
1048430150 8:134362649-134362671 CAATTTCTGCATCTCTAAAATGG - Intergenic
1048496737 8:134941910-134941932 CAGCATCTGCATCTGTGACAGGG + Intergenic
1048555399 8:135470953-135470975 CAGTTTCTTCATCTGTAAAATGG + Intronic
1049204092 8:141355338-141355360 CAGTTTCTTCATTTGTAACATGG + Intergenic
1049891969 9:78192-78214 CAGTTTCTGCATCTGTAAAATGG - Intergenic
1049892038 9:78882-78904 CAGTTTCTGCATCTATAAAATGG + Intergenic
1049906172 9:218923-218945 CAGTTTCTCCATCTGTAAAACGG - Intronic
1050131957 9:2422228-2422250 CAGTTTCTGCACCTGTAAAATGG - Intergenic
1050138646 9:2494868-2494890 CAGTATCTGCATCCAGAATAGGG + Intergenic
1050173467 9:2846309-2846331 CAGTTTCTGCATATGTAAAATGG + Intergenic
1050250539 9:3739424-3739446 GAGAATTTGCATTTCTAACAGGG - Intergenic
1050283168 9:4073749-4073771 CAGTTTCTTCATCTCTCATATGG + Intronic
1050324589 9:4487422-4487444 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1050675837 9:8052206-8052228 CATTATCTCCATCTCTTTCAGGG + Intergenic
1050953172 9:11623230-11623252 CAGTTTCTTCATTTCTAAAATGG + Intergenic
1051150512 9:14073987-14074009 CAGTATCTTCATCTATGAAAAGG - Intergenic
1051495499 9:17718419-17718441 CAGAATCTGCATTTTTAACACGG - Intronic
1052192977 9:25679224-25679246 AAGAATCTACATGTCTAACAGGG + Intergenic
1052345176 9:27402073-27402095 CAGTTTCTTCATCTATAAAATGG + Intronic
1052842006 9:33300027-33300049 CAGTTTCTTCATCTGTAAAATGG + Intronic
1052865768 9:33463858-33463880 CATGAGCTGCTTCTCTAACATGG + Exonic
1053286386 9:36852036-36852058 CAGTTTCTTCATCTATAAAATGG + Intronic
1053297624 9:36926079-36926101 CAGTTTCTTCATCTGTAAAATGG - Intronic
1053300072 9:36942668-36942690 CAGTTTCTGCATCTGCAAAAAGG - Intronic
1053431811 9:38046960-38046982 CAGTGTCTGCATTTGTAAAAAGG - Intronic
1053447938 9:38167314-38167336 CAGTTTCTGCATCACTGAAATGG - Intergenic
1053449903 9:38184776-38184798 CATTTTCTTCATCTGTAACAGGG - Intergenic
1053464081 9:38292174-38292196 CAGTTTCTTCATCTATAAAATGG - Intergenic
1053711132 9:40809471-40809493 TTGTATCTGAATTTCTAACAGGG + Intergenic
1053733393 9:41079291-41079313 CAGTTTCTGCACCTGTAAAATGG - Intergenic
1053733460 9:41079981-41080003 CAGTTTCTGCATCTATAAAACGG + Intergenic
1054421042 9:64930288-64930310 TTGTATCTGAATTTCTAACAGGG + Intergenic
1054694961 9:68351584-68351606 CAGTTTCTGCATCTATAAAATGG - Intronic
1054695031 9:68352274-68352296 CAGTTTCTGCATCTGTAAAATGG + Intronic
1055188401 9:73486486-73486508 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1055440980 9:76335877-76335899 CAGTTTCTTCATCTGTAAAATGG - Intronic
1055578029 9:77679449-77679471 CAGTAACTTCATCTGTAAAATGG - Intergenic
1055591590 9:77820836-77820858 CAGTTTCTTCATCTATAAGATGG + Intronic
1055632089 9:78235375-78235397 TAGTTTCTGCATATCTCACACGG - Intergenic
1055923955 9:81490815-81490837 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1056064013 9:82914994-82915016 CAGTTTCTCCATCTATAAGATGG + Intergenic
1056538089 9:87548356-87548378 CAGTATCACCATCTGTAAAATGG + Intronic
1056589961 9:87958930-87958952 CAGTATCTAAATTTCTAGCATGG + Intergenic
1056594911 9:87999576-87999598 CAGACTCTGCATTTTTAACAAGG + Intergenic
1056835182 9:89949178-89949200 GAGATTCTGCATTTCTAACAAGG + Intergenic
1057431055 9:94994494-94994516 CAGTTTCTTCATCTGTAAAATGG - Intronic
1057566344 9:96169095-96169117 GAGAATCAGCATTTCTAACAAGG + Intergenic
1057698446 9:97344554-97344576 CAGTTTCTTCATCTGTAAAATGG - Intronic
1057888761 9:98852155-98852177 CAGTAACTCCATCTTGAACAGGG - Intergenic
1057911033 9:99020907-99020929 CAGTTTCTCCATCTGTAAAATGG + Intronic
1057918367 9:99075120-99075142 CAGTTTCTTCATCTGTAAAAGGG + Intergenic
1058401135 9:104620785-104620807 CACTATCTTCATCTATAACATGG + Intergenic
1058420054 9:104824801-104824823 CAGTTTCCTCATCTCTAAAATGG - Intronic
1058561909 9:106239414-106239436 CAGTTTCTTCATCTATAAAATGG - Intergenic
1058572009 9:106357184-106357206 TAGTATTTGCATATCTAAAAAGG + Intergenic
1058702748 9:107614399-107614421 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1058730637 9:107846647-107846669 CAGTTTCTACATCTGTAAAATGG - Intergenic
1058890018 9:109353584-109353606 CAATTTCTGCATCTGTAAAATGG + Intergenic
1058900282 9:109436295-109436317 CAGTTTCTCCATCTGTAAAATGG + Intronic
1058914493 9:109552641-109552663 CAGTTTCCTCATCTCTAAAATGG - Intergenic
1059358135 9:113717310-113717332 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1059379670 9:113913230-113913252 CAGTATCCTCATCTGTAAAAGGG - Intronic
1059417944 9:114173624-114173646 CAGTTTCTGCCTCTATAAAATGG + Intronic
1059586661 9:115614639-115614661 CAGTATCTGCATCTATTGAATGG + Intergenic
1059684682 9:116623607-116623629 CTGTATCTGCATCTGTGAAACGG - Intronic
1059943470 9:119381171-119381193 CAGTATCTTCATCTTCAACATGG + Intergenic
1059961873 9:119573573-119573595 CAGTTTCTTCATCTGTAATATGG + Intergenic
1059962447 9:119578512-119578534 CAGTTTCTTCATCTATAAAATGG - Intergenic
1059975661 9:119714060-119714082 CAGTTTCTGCAACTGTAACATGG + Intergenic
1059983710 9:119800964-119800986 CAGTTTCTACATCTATAAAATGG - Intergenic
1060014792 9:120077781-120077803 CAGTTTCTTCATCTATAAAATGG - Intergenic
1060043097 9:120318616-120318638 CAGTTTCTTCATCTGTAATATGG + Intergenic
1060063323 9:120481153-120481175 CAGTTTCCTCATCTCTAAAATGG - Intronic
1060096404 9:120794227-120794249 CAGTTTCCCCATCTCTAAAAAGG - Intergenic
1060114090 9:120927416-120927438 CAGATTCTGCATCTGTAAAATGG + Exonic
1060152062 9:121295199-121295221 CAGTTTCCTCATCTCTAAAAGGG - Intronic
1060232274 9:121834434-121834456 CAGTATCTGCATCTGTAAAGTGG + Intronic
1060246214 9:121948612-121948634 CAGTTTCTGCATCTGTAAACTGG - Intronic
1060287684 9:122268595-122268617 CAGTTTCAGCATCTGTAAAATGG + Intronic
1060650391 9:125321042-125321064 CAGTTTCTTCATCTATAAAATGG - Intronic
1060724804 9:125999671-125999693 CAGTTTCTGCCTCTATAAAATGG - Intergenic
1060762437 9:126267233-126267255 CAGATTCTGCATTTCTAACAAGG + Intergenic
1060956082 9:127641097-127641119 CAGTTTCTCCATCTGTAAAATGG - Intronic
1061051368 9:128197896-128197918 CAGTTTCTTCATCTGTAAAAGGG - Intronic
1061052554 9:128204907-128204929 CAGTGTCCCCATCTCTAACATGG + Intronic
1061085354 9:128394911-128394933 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1061175728 9:128995450-128995472 CAGCATCTGGTACTCTAACAAGG - Exonic
1061373076 9:130208812-130208834 CAGTCTCTTCATCTGTAAAATGG - Intronic
1061613322 9:131762878-131762900 CAGTTTCTGCACCTGTAAAATGG + Intergenic
1061889128 9:133608591-133608613 CAGTTTCTGCATCTGTGAAATGG + Intergenic
1062718190 9:138021724-138021746 CAGTATCTTCATCTGTGAAATGG + Intronic
1062725978 9:138073826-138073848 CAGTTTCTTTATCTCTAACTCGG - Intronic
1203518784 Un_GL000213v1:27610-27632 CACTTTCTTCATCTGTAACATGG - Intergenic
1203522947 Un_GL000213v1:60918-60940 CAGGAGCTGCATTTCAAACAAGG - Intergenic
1203571526 Un_KI270744v1:136866-136888 CAGGATCTGCATCTCCATCAGGG - Intergenic
1185942494 X:4337228-4337250 AAGTATCTGAATATCTGACATGG - Intergenic
1186049276 X:5573090-5573112 GAGAAACTGCATTTCTAACAAGG + Intergenic
1186693568 X:12005280-12005302 AAGAATCTGGATCTCTAATATGG + Intergenic
1186766353 X:12774234-12774256 CAGTTTATTCATCTGTAACATGG + Intergenic
1186883352 X:13888403-13888425 CAGAAGCTGCATCTGTCACATGG + Intronic
1186973129 X:14871931-14871953 CAGTTTCTCCATCTATAAAATGG - Intronic
1186993572 X:15095457-15095479 CAATATCTTCATCTGTAAAATGG + Intergenic
1187044823 X:15636846-15636868 CAGTTTCTCCATCTGCAACAGGG - Intronic
1187252745 X:17613549-17613571 CAGTTTCTGAAGCTCTAAGAAGG - Intronic
1187258128 X:17659822-17659844 CAGTTTCTTCATCTGTAAAATGG - Intronic
1187515958 X:19970397-19970419 CAGCTTCCTCATCTCTAACATGG + Intergenic
1187626430 X:21119473-21119495 CAGTCTCTACATCTATAAAATGG + Intergenic
1187682686 X:21783751-21783773 CAGTTTCTACATCTATAAAATGG - Intergenic
1188306713 X:28568117-28568139 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1188829508 X:34878973-34878995 CAGTCTCTCCAACTCTAAAATGG + Intergenic
1189110437 X:38284782-38284804 CAGTTTCTTCATCTCTAAAATGG - Exonic
1189386460 X:40540726-40540748 CAGTTTCTGCATCTGTAAAATGG + Intergenic
1189605651 X:42674934-42674956 CAGTTTCTGCATATGTAAAATGG - Intergenic
1189902978 X:45727049-45727071 AAGTTTCTGCATCACTTACATGG + Intergenic
1190089356 X:47424194-47424216 CAGTTTCTGCATCTGTAAAATGG + Intergenic
1190301112 X:49058147-49058169 CAGCTTCTGCATCTATAAAATGG + Intronic
1190372899 X:49759838-49759860 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1190465340 X:50720558-50720580 CAGTTTCTTCATCTGTAAAATGG - Intronic
1190823402 X:53995404-53995426 CAGTTTCCTCATCTCTAAAATGG - Intronic
1190827484 X:54030869-54030891 CAGTTTCTGCATCTGTGAAATGG + Intronic
1191736288 X:64391764-64391786 CAGTTTCTTCATCTATAAGATGG - Intronic
1191736397 X:64393220-64393242 CAGTTTCCTCATCTGTAACATGG + Intronic
1192090410 X:68149370-68149392 CAGTAGCTTCATATCTACCATGG - Intronic
1192494889 X:71609532-71609554 CAGTTTCTTCATCTGTAAAATGG + Intronic
1192594253 X:72389569-72389591 CAGTTTCTTCATCCCTAAAATGG - Intronic
1192673614 X:73171289-73171311 CAGTATCTGCTTCTGAAACCAGG + Intergenic
1192698621 X:73444979-73445001 CAGTTTCTACATCTCTAAAATGG + Intergenic
1192864076 X:75111462-75111484 CAGTTTCTTCATCTGTAAAATGG - Intronic
1193145315 X:78069876-78069898 CAATATCTTCATCTGTAAAATGG - Intronic
1193636998 X:83963414-83963436 CAGCATTTGCATATCTAAAAAGG + Intergenic
1193750915 X:85342547-85342569 CAGTTTCTACATCTCTAAAAGGG - Intronic
1194152593 X:90344087-90344109 CATTATTTACATGTCTAACAAGG + Intergenic
1194491449 X:94555038-94555060 CAGTATCTGCTTCTCAAGCCAGG - Intergenic
1194666695 X:96684500-96684522 CAGTTTCCCCATCTCTAAAATGG + Intergenic
1194692022 X:96998830-96998852 CAGTCTCTTCATCTATAAAATGG + Intronic
1195086107 X:101416130-101416152 AAGAATCTGCATATCTCACAAGG - Intergenic
1195089136 X:101441859-101441881 AAGAATTTGCACCTCTAACAAGG - Intronic
1195544355 X:106098758-106098780 CAGTATTTGCTTGTCTAAAAAGG + Intergenic
1195682154 X:107555440-107555462 AAGAATTTGCATTTCTAACAAGG - Intronic
1195748166 X:108138874-108138896 GAGTTTCTGCATTTCTAACTAGG + Intronic
1195918393 X:109958118-109958140 CAGTTTCTTCCTCTCTAACATGG - Intergenic
1196403874 X:115344434-115344456 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1196578413 X:117349784-117349806 CAGTTTCTTCATCTTTAAAATGG + Intergenic
1196689245 X:118541611-118541633 GAGTCTCTGCATCTGTAAAATGG + Intronic
1196899452 X:120368540-120368562 CAGTTTCTGCATCTGTAAAATGG - Intronic
1197027955 X:121778239-121778261 GAGTATCTAAATCTCTAGCAAGG + Intergenic
1197169560 X:123416043-123416065 TAGTTTCTCCATCTCCAACATGG + Intronic
1197268277 X:124399213-124399235 CAGTTTCTTCATCTGTAAAATGG + Intronic
1197463545 X:126772787-126772809 CAGTGTCTAGATCTCTAGCAAGG - Intergenic
1197699072 X:129583495-129583517 CAGTTTCTTCATCTGTAAAATGG + Intronic
1197961772 X:132014370-132014392 CAGTTTCCTCATCTCTAAAATGG + Intergenic
1198047591 X:132918004-132918026 CAGTTTCATCATCTCTAAAATGG - Intronic
1198157249 X:133973329-133973351 CAGTTTCTTCATCTGTAAAATGG + Intronic
1198428233 X:136540924-136540946 CAGTTTCCTCATCTCTAAAATGG + Intronic
1198429625 X:136552679-136552701 CAGTTTCTTCATCTATAAAATGG - Intronic
1198522176 X:137464200-137464222 CAGTTTCTTCATCTCTAAAATGG - Intergenic
1198631006 X:138638496-138638518 CTCTATCTACATCTCTAGCATGG + Intronic
1198662306 X:138982812-138982834 CAATTTCTCCATCTCTAAAATGG + Intronic
1199574229 X:149297900-149297922 CAGTTTCTTTATCTGTAACAAGG + Intergenic
1199685995 X:150266184-150266206 CAGTTTCTTCATCTGTAAAATGG + Intergenic
1199799156 X:151232277-151232299 CAGTTTCTTCATCTGTAAAATGG - Intergenic
1199936427 X:152578524-152578546 CAGTTTCTCCATCTTTAAAATGG - Intergenic
1199980096 X:152916183-152916205 CACAATCTCCATCTCTAACAGGG - Intronic
1200183457 X:154166240-154166262 CAGTTTCCACATCTGTAACATGG - Intergenic
1200189111 X:154203368-154203390 CAGTTTCCACATCTGTAACATGG - Intergenic
1200194866 X:154241177-154241199 CAGTTTCCACATCTGTAACATGG - Intergenic
1200200516 X:154278298-154278320 CAGTTTCCACATCTGTAACATGG - Intronic
1200254303 X:154571531-154571553 CAGTTTCCTCATCTGTAACAAGG + Intergenic
1200263466 X:154632877-154632899 CAGTTTCCTCATCTGTAACAAGG - Intergenic
1200498940 Y:3920836-3920858 CATTATTTCCATGTCTAACAAGG + Intergenic
1200954199 Y:8928672-8928694 CTGTATCTGCATCTATATTAAGG + Intergenic
1201559634 Y:15302343-15302365 CAGTTTCTGCATCTGCAAAACGG - Intergenic