ID: 969164902

View in Genome Browser
Species Human (GRCh38)
Location 4:5299092-5299114
Sequence AAGGGCAAGCAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2291
Summary {0: 3, 1: 77, 2: 306, 3: 637, 4: 1268}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969164902_969164912 24 Left 969164902 4:5299092-5299114 CCACCCTGCTTCTGCTTGCCCTT 0: 3
1: 77
2: 306
3: 637
4: 1268
Right 969164912 4:5299139-5299161 CAGTTCCAGTGAGATGAACTGGG 0: 5
1: 111
2: 619
3: 1071
4: 1345
969164902_969164911 23 Left 969164902 4:5299092-5299114 CCACCCTGCTTCTGCTTGCCCTT 0: 3
1: 77
2: 306
3: 637
4: 1268
Right 969164911 4:5299138-5299160 CCAGTTCCAGTGAGATGAACTGG 0: 6
1: 131
2: 360
3: 410
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969164902 Original CRISPR AAGGGCAAGCAGAAGCAGGG TGG (reversed) Intronic
Too many off-targets to display for this crispr