ID: 969164931

View in Genome Browser
Species Human (GRCh38)
Location 4:5299293-5299315
Sequence CAGTGAAAAGGGAAGGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 800
Summary {0: 1, 1: 0, 2: 10, 3: 77, 4: 712}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969164926_969164931 12 Left 969164926 4:5299258-5299280 CCTTCTTTTTATCTTTTTTTAAA 0: 1
1: 1
2: 110
3: 1098
4: 7885
Right 969164931 4:5299293-5299315 CAGTGAAAAGGGAAGGAAACAGG 0: 1
1: 0
2: 10
3: 77
4: 712
969164925_969164931 18 Left 969164925 4:5299252-5299274 CCAGATCCTTCTTTTTATCTTTT 0: 1
1: 0
2: 8
3: 221
4: 2706
Right 969164931 4:5299293-5299315 CAGTGAAAAGGGAAGGAAACAGG 0: 1
1: 0
2: 10
3: 77
4: 712
969164924_969164931 26 Left 969164924 4:5299244-5299266 CCATCTTGCCAGATCCTTCTTTT 0: 1
1: 1
2: 3
3: 56
4: 459
Right 969164931 4:5299293-5299315 CAGTGAAAAGGGAAGGAAACAGG 0: 1
1: 0
2: 10
3: 77
4: 712

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969164931 Original CRISPR CAGTGAAAAGGGAAGGAAAC AGG Intronic
900746204 1:4362326-4362348 CAGCCAACAGGGAAGGAAGCTGG - Intergenic
901158799 1:7159351-7159373 CAGGGAGAAGGGAAGGTGACCGG - Intronic
901533911 1:9870530-9870552 CACTTAACAGGCAAGGAAACTGG - Intronic
901688037 1:10955185-10955207 CACTGGAATGGGAAGGACACAGG + Exonic
902227858 1:15008023-15008045 CATTTAAAAGGGAAGGAAGAAGG - Intronic
902689715 1:18103019-18103041 CAGAGAAAAGGGATGGACCCAGG - Intergenic
902933622 1:19748455-19748477 GAGGGAGATGGGAAGGAAACAGG - Intronic
904439986 1:30524022-30524044 GAGTGAATGGGGAAGGAAAGGGG + Intergenic
904768505 1:32868518-32868540 CATTTTACAGGGAAGGAAACAGG + Intronic
905207749 1:36352619-36352641 CAGGGGGAAGGGAGGGAAACAGG - Intronic
905788215 1:40774777-40774799 AAGTGAAAAGGGAAGTAAAAGGG - Intergenic
905890189 1:41513829-41513851 CAGTCAGCAGGCAAGGAAACTGG - Intronic
906066984 1:42988029-42988051 CAGTGAAACGGGATGGAAGGAGG - Intergenic
906367855 1:45225832-45225854 GAAGGAAAAGGGAAGGAAAAGGG + Intronic
906522212 1:46474343-46474365 CAGTGAAGTGGAATGGAAACAGG + Intergenic
906543429 1:46605232-46605254 CAGGCAACAGGGAAGGGAACAGG - Intronic
907022286 1:51080000-51080022 GAGAGAAAAGGAAAGGAAAGGGG - Intergenic
907133509 1:52118093-52118115 TATTGTAAAGGCAAGGAAACAGG + Intergenic
907753992 1:57291754-57291776 CAGAGAAAAAGAAAAGAAACAGG + Intronic
907903103 1:58759804-58759826 CATTTTACAGGGAAGGAAACTGG - Intergenic
908380931 1:63595957-63595979 CAGTGAAATGGCGAGTAAACCGG - Intronic
908767138 1:67564425-67564447 CAGTGAAAAGGACGGGAAACTGG + Intergenic
909126056 1:71671372-71671394 CAGGGTAAAATGAAGGAAACTGG + Intronic
909738692 1:79000470-79000492 CTTTGAAAAGAGAAGGAAAGGGG - Intronic
909746009 1:79097983-79098005 CAGTGAAAAAGCAAAGACACAGG - Intergenic
909990042 1:82212192-82212214 CACTGAAAAGGGAACCAAAGAGG + Intergenic
910046952 1:82929072-82929094 CAGTGAAAAGCGAAACACACTGG - Intergenic
910055325 1:83026722-83026744 GAGTCAAAAGGAAAGGAAAGTGG + Intergenic
910116940 1:83741812-83741834 CAGGGAAAAGGGAAAAAAAAGGG + Intergenic
910377400 1:86587527-86587549 CAATGGGAAGGGAAGGAAAATGG - Intergenic
910846838 1:91612083-91612105 AAATGAAGATGGAAGGAAACAGG + Intergenic
911090619 1:94014298-94014320 CAATGAAAAAGGAAGGAAGGAGG + Intronic
912330473 1:108815817-108815839 CAGTGAGGATGGAGGGAAACTGG - Intergenic
912445538 1:109733321-109733343 AAGAGAAGAAGGAAGGAAACAGG - Intronic
912758724 1:112346947-112346969 CAGAGAAAAGGGAAAAAGACTGG + Intergenic
912890002 1:113519968-113519990 CAGTGAAAAGACAATAAAACAGG - Intronic
912998739 1:114558193-114558215 CAGTGAGTTTGGAAGGAAACTGG + Intergenic
913334196 1:117693745-117693767 AAGGGAAAAGGGAAGGGAAAAGG - Intergenic
914320559 1:146555431-146555453 CAGGAAAAAGGAAAGGAAGCAGG + Intergenic
914756405 1:150564026-150564048 GAGTGAAGAGGAAAAGAAACTGG + Intergenic
914858164 1:151366903-151366925 CCCTGAACAGGGAAGGAAGCAGG + Exonic
915938719 1:160104721-160104743 GAGTGACAAGAGAAGGAATCTGG + Intergenic
916446943 1:164881282-164881304 CAGAGAGAAAGGAAGGAAAGAGG + Intronic
917259200 1:173148668-173148690 CAGTGAAGAGGAATGGAATCAGG + Intergenic
918133071 1:181646025-181646047 CAGTGAGTGGGGAAGGAAAGAGG - Intronic
919138838 1:193544601-193544623 AAGGGAAAACTGAAGGAAACAGG + Intergenic
919347377 1:196401649-196401671 AAGAGAAAAGGTAAGGAAAAGGG + Intronic
919425929 1:197430447-197430469 CAGAGAAATGGGATGGTAACTGG - Intronic
919443770 1:197674587-197674609 CAGAGAAAAGGGAATGAAGTTGG + Intronic
919670863 1:200336796-200336818 CAGTAAAAGTGGAAGTAAACTGG - Intergenic
919921886 1:202171090-202171112 CAGTGCATAGGGAATGAAGCCGG + Intergenic
919973056 1:202593098-202593120 CAGAGGAAAGGGAAGGGAAGGGG + Exonic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920569584 1:207006455-207006477 CAGTGAAGAGGAAAGGTAAAAGG - Intergenic
920679314 1:208060479-208060501 CAGGGAACAGGGAATCAAACAGG + Intronic
921542555 1:216433971-216433993 CAGATAACAGGGAAGGAAATGGG + Intergenic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
922045095 1:221937918-221937940 CATTTTAAAGGCAAGGAAACAGG + Intergenic
922133889 1:222806199-222806221 CAGTGAGAAGTGAAGGGAAGGGG - Intergenic
922174688 1:223188219-223188241 CATTGACAAGGGAAGGAAATGGG + Intergenic
922875932 1:228939965-228939987 CAGAGGACAGGGAAGGAAAGAGG + Intergenic
923396739 1:233573190-233573212 CAGTCAAAAGGGAAGGGAAGGGG - Intergenic
923501194 1:234566191-234566213 CAGTACAAAGGGAAGGATTCTGG - Intergenic
923571548 1:235119787-235119809 CATTGAAAAGCTAAGGAAATGGG - Intronic
923800803 1:237206260-237206282 CAGGGAAAATGGAATCAAACAGG - Intronic
923803919 1:237237902-237237924 AAGGGAAAAGGAAAGGAAAAAGG - Intronic
924197503 1:241623750-241623772 CAGAGCAAAGGGAATGAAAGAGG - Intronic
924311359 1:242746725-242746747 CAGTGAGTTGGGAAGAAAACAGG - Intergenic
1063799787 10:9561706-9561728 AAGAGAATAGGGAAGGAAAGTGG - Intergenic
1063886113 10:10580768-10580790 CAGAGAAAAGGGAATCAAAGTGG + Intergenic
1063901266 10:10734668-10734690 AAGAGAAAAGGGAAGGAAATAGG + Intergenic
1064000018 10:11655714-11655736 TAGTGGACAGGGAAGGAAGCTGG - Intergenic
1064008264 10:11714952-11714974 CAGTGAGAAGGGCAGGAGAGGGG + Intergenic
1064297766 10:14093877-14093899 CAGTGAACAGTGAGGGAAAGAGG - Intronic
1065178729 10:23104223-23104245 AAGAGAAAAGGGAACGGAACCGG + Exonic
1066539522 10:36430403-36430425 CAGTAAAAAGGGAAAAAAAGTGG - Intergenic
1066553291 10:36583216-36583238 CTGTGAAGAGGGAAGAAAATTGG - Intergenic
1066987689 10:42482635-42482657 CAGTGAAAAAAAAAGAAAACTGG - Intergenic
1067574311 10:47398775-47398797 GAGTGTAAAGAGAAGGAAATTGG + Intergenic
1067718203 10:48705543-48705565 ATTTGAAAAGAGAAGGAAACAGG - Intronic
1067724573 10:48760284-48760306 CAGTGAAAATAGAAAGAAACTGG + Intronic
1068297006 10:55084122-55084144 CTGGGAAAAAGGAAGGAAACTGG + Intronic
1068664104 10:59654362-59654384 CAATGAAAAAGGAAAGAATCTGG - Exonic
1069087357 10:64156824-64156846 AAGTCAAAAGGGAAGGAAGATGG + Intergenic
1070448611 10:76534425-76534447 CAGTGGAAAGGGAAAGAATGTGG - Intronic
1070699577 10:78591288-78591310 CAGTGAACAAAGAAGGAAACAGG + Intergenic
1070714813 10:78711739-78711761 GAGGGAAAAGAGAAGCAAACCGG - Intergenic
1070806964 10:79276378-79276400 CAGTGAACAGTGAAAGAAAATGG + Intronic
1070976225 10:80608131-80608153 CAGTGAACAGAGAGAGAAACCGG + Intronic
1072015111 10:91338941-91338963 CAGTGAAAAGGAAGGGAAACTGG + Intergenic
1072381233 10:94873073-94873095 CAGTGAAAGGAGAAGCAAACAGG + Intergenic
1072382152 10:94884366-94884388 GAGTGAAAAGAGAAAGAAATGGG + Intergenic
1072429444 10:95357758-95357780 CAGTGAAGAGGGAATCAGACGGG - Exonic
1073082299 10:100867919-100867941 CATTGAAAAGATGAGGAAACGGG + Intergenic
1073856300 10:107678634-107678656 AAGTGACAATGGAAAGAAACTGG - Intergenic
1074211879 10:111342816-111342838 CAATGAAAAGTGAATGAAAGTGG - Intergenic
1074674336 10:115831164-115831186 TAGGGAAAAGGGAAGCAAACCGG - Intronic
1075237977 10:120748913-120748935 TAGAGAAAAGGGCAGGCAACTGG + Intergenic
1075251838 10:120885243-120885265 CAGTGGAAAGAGTAAGAAACAGG + Intronic
1075312247 10:121424195-121424217 CAGTGGAAAGAGAACTAAACTGG - Intergenic
1075552503 10:123402437-123402459 GAGGGAAGAGGGAAGGAAACAGG + Intergenic
1075710335 10:124527301-124527323 AAGTGAAGAAGGAAGGAAAGGGG + Intronic
1076319043 10:129564741-129564763 CAGGGGAAAGGGAAGAAAACAGG - Intronic
1076413548 10:130268376-130268398 CAGGGCAAAGGGGAGGACACAGG + Intergenic
1076435991 10:130441752-130441774 CAGGGAAAAGGTAAGAAAAAAGG + Intergenic
1076640317 10:131911530-131911552 CAGGGAAAAGGGAAAGAAAAAGG - Intronic
1077462457 11:2717475-2717497 CAGGGAAAAGGGTGGAAAACTGG - Intronic
1077923173 11:6656033-6656055 CGGGGAGAAGGGAAGGGAACCGG - Intergenic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1081207743 11:40294117-40294139 CAGAGAAAGGGAAAGGAAAAGGG - Intronic
1081266393 11:41028604-41028626 CACTGAAATGGGAATGAAACAGG + Intronic
1081618654 11:44605437-44605459 CAGTGAAGAGGGAGGGAGAGAGG - Intronic
1081838456 11:46177045-46177067 CTGTGAGAAGGAAAGGAGACTGG - Intergenic
1082734138 11:56837942-56837964 TGGTGAAAAAGGAAGCAAACAGG + Intergenic
1082751487 11:57022868-57022890 CAGTGATACGGAAAGGAGACAGG - Intergenic
1082798062 11:57392806-57392828 CAATTAGAAGGGAAGGAAACAGG + Intronic
1083743333 11:64722500-64722522 AAGTGGAGAGGGAAGGAAAGGGG - Intronic
1083973569 11:66099045-66099067 CATTGAAAAGGGAAGGGAAAAGG - Intronic
1083973863 11:66101239-66101261 AAGTGAAAAGAAAAGGAAATGGG - Intronic
1084208685 11:67610969-67610991 CAGGGAAATGGGAAGAGAACTGG - Intronic
1085029100 11:73258828-73258850 CACCCAAAAGGCAAGGAAACTGG - Intergenic
1085583826 11:77681430-77681452 CAGGGAAGAGGGAAGGAAAGGGG - Intronic
1085638291 11:78174770-78174792 AAGGGAAAAGGAAAGGAAAAAGG + Intronic
1085794977 11:79530960-79530982 AGGTGAAAAGAGAAGGAAACTGG - Intergenic
1086151458 11:83615231-83615253 TTGGGAGAAGGGAAGGAAACAGG + Intronic
1086775306 11:90823795-90823817 CAGTAAAAGGTGAAGGAGACAGG + Intergenic
1087923226 11:103890669-103890691 CTGAGGAAAGGGAATGAAACAGG - Intergenic
1088814070 11:113409782-113409804 CAGTGGAAGGGAAGGGAAACAGG + Exonic
1089009744 11:115122695-115122717 TGGTGAAAAGGGATAGAAACAGG + Intergenic
1089119073 11:116119102-116119124 CAGGGAGAAGGGAAGGAAAGGGG - Intergenic
1089453930 11:118614809-118614831 CAGAGACAAGGGAAGCAAGCTGG - Intronic
1089768142 11:120783437-120783459 CAGACAAGAGGGAAGGGAACAGG - Intronic
1090039321 11:123276487-123276509 AAGTGAAAAGGGAAGGGAGAAGG - Intergenic
1090080443 11:123608980-123609002 TGGTGAAAAGGGAGGGCAACAGG - Intronic
1090402486 11:126458068-126458090 CAGGGAAAAAGGATGGGAACTGG - Intronic
1090668680 11:128931073-128931095 GAGTGGAACAGGAAGGAAACAGG - Intergenic
1091671426 12:2454797-2454819 ACGTGAAAGGGGAAGGAGACGGG - Intronic
1092034672 12:5322603-5322625 CTGGGAAAAGGGGAGGAAAGTGG + Intergenic
1092367972 12:7892769-7892791 AAGAGAAAAGGGAAGGAGAGAGG + Intergenic
1092697244 12:11186353-11186375 CAGAGAAAAGGGGATAAAACTGG + Exonic
1092733961 12:11561792-11561814 CAATGAAAAGTGAAGAAAATAGG - Intergenic
1092910598 12:13141649-13141671 CAGTGGAAGGGGAAAAAAACTGG - Intronic
1092916892 12:13197396-13197418 AAGTGAATAGGGAAGCAAACAGG - Intronic
1092992721 12:13918613-13918635 CATTGAAAATGAAAGGGAACTGG - Intronic
1093246911 12:16750106-16750128 CAGTCAAGAGGGAAGAAAAGTGG + Intergenic
1093603762 12:21064539-21064561 CAGAGAAAAGGCCAAGAAACTGG + Intronic
1094111792 12:26870121-26870143 ATGGGAAACGGGAAGGAAACAGG + Intergenic
1094303221 12:28989498-28989520 CAGAGAATAGAAAAGGAAACAGG - Intergenic
1094307097 12:29032468-29032490 CCCTGAAAAGGGAAGAAGACTGG - Intergenic
1094373781 12:29768320-29768342 CACTGAGAAGGCAAGCAAACAGG + Intronic
1094395400 12:29999897-29999919 AAGTGAAAAGGGCAGGCAAGAGG + Intergenic
1095256164 12:40038782-40038804 AAGGGAAAAGGAAAGGAAAAGGG + Intronic
1095302784 12:40606145-40606167 CAGTGAAAATGTAGAGAAACTGG + Intergenic
1095783753 12:46087915-46087937 CAGGCAAATGGGAAGTAAACTGG + Intergenic
1096327265 12:50675202-50675224 CACTTGAAAGAGAAGGAAACTGG + Intronic
1096384137 12:51183550-51183572 GAGTGAAAAGGGAAGGCTAGGGG - Intergenic
1096644324 12:53021851-53021873 CAGGATAAAGGTAAGGAAACTGG + Exonic
1097210029 12:57360657-57360679 AAGAGGAAAGGGAAGGAAAAAGG + Intronic
1097561392 12:61210398-61210420 CAGTTAGAAGGGGAAGAAACAGG - Intergenic
1097706134 12:62870275-62870297 TAGTGAAAAGGGATGGAGCCAGG + Intronic
1098474943 12:70889866-70889888 CAGTGAAACGGCATGGAAATGGG - Intronic
1098521368 12:71438358-71438380 TAGGGAAAAGTGAAGGAAAAGGG + Intronic
1098661770 12:73103097-73103119 TAGTAAAAAAGGAAAGAAACTGG - Intergenic
1098889448 12:75994248-75994270 GAGTGACAAGGCAAGGACACAGG + Intergenic
1099544806 12:83965201-83965223 CAAAGAAAGGGGAAGCAAACAGG + Intergenic
1099841198 12:87969693-87969715 AAGCGAAAAGGGAAGGTAATGGG + Intergenic
1100337142 12:93641950-93641972 CAGTGAACTGGCAAGGAGACAGG + Intergenic
1100351069 12:93783115-93783137 AAGTAAAAAGGAAAGGAAAGAGG - Intronic
1100399653 12:94217704-94217726 CAATGAAAAGGGAAAGAACGAGG - Intronic
1102068754 12:110000027-110000049 CACTGGACAGAGAAGGAAACAGG + Intronic
1102274995 12:111575072-111575094 AATTAAAAAGGGAGGGAAACAGG - Intronic
1102552507 12:113702094-113702116 GAGAGAAAAGGGAAGGAGAAAGG - Intergenic
1102812188 12:115833843-115833865 AAGAGAAAAGGGAAGGATTCAGG + Intergenic
1103044550 12:117724981-117725003 CAGTAAACAGGAAAGAAAACTGG + Intronic
1103100572 12:118170872-118170894 CATTGAAATGAGAAGGAAAAAGG - Intronic
1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG + Intronic
1104176502 12:126338031-126338053 CAGTAACAAAGGAAGGAAGCTGG + Intergenic
1104565925 12:129883043-129883065 CAGGGAAAAGGGAAAGAAGGAGG + Intronic
1105679864 13:22714929-22714951 CATTAAAAAGGGAAGGATAGTGG - Intergenic
1105685538 13:22777501-22777523 TATTTAAAATGGAAGGAAACAGG - Intergenic
1105726152 13:23164424-23164446 CATTTAACACGGAAGGAAACTGG + Intergenic
1105995526 13:25667792-25667814 CAGTGAAAAGGGAATCAAAAGGG - Intronic
1106293382 13:28387547-28387569 CACTGAAAAGTGAAAGAACCTGG - Intronic
1107442255 13:40438543-40438565 CAGCAAAAAGAAAAGGAAACTGG - Intergenic
1107962189 13:45568322-45568344 AAGTGAAAACAGATGGAAACTGG - Exonic
1107996052 13:45862184-45862206 GAGAGAAAGGGGAAGGAAAAGGG + Intergenic
1108830568 13:54472935-54472957 CAGAAGAAAGGAAAGGAAACAGG + Intergenic
1108863512 13:54892864-54892886 CAGGGAGAAGGAAAGGAGACTGG - Intergenic
1108899769 13:55387435-55387457 GTGTGAAAAGGAAAAGAAACAGG + Intergenic
1109151075 13:58847909-58847931 CATAGAACAGGGAAGGAAATAGG + Intergenic
1109616546 13:64841379-64841401 CTGGGGAAAGGGAAAGAAACAGG + Intergenic
1110120234 13:71870487-71870509 CAGTGACAGGGAAATGAAACAGG + Intergenic
1110370745 13:74737579-74737601 CATTGAGAAGGGAAGGGAGCAGG + Intergenic
1110680619 13:78307975-78307997 AACAGAAAATGGAAGGAAACTGG + Intergenic
1111425981 13:88082917-88082939 CAGGGAAAAGTGAAGCAACCAGG + Intergenic
1112722072 13:102256954-102256976 ATGTGAAAAGTGAAGGAAAATGG - Intronic
1113019752 13:105871631-105871653 CAGTGAGAAGAAAAAGAAACAGG - Intergenic
1113077562 13:106482524-106482546 AAGTGAAAGAGGAAGGAAATTGG + Intergenic
1114042168 14:18689083-18689105 CATTTAGAAGGGGAGGAAACTGG - Intergenic
1114851876 14:26391972-26391994 CAGTGAAATGGGAAGCTCACTGG - Intergenic
1114862319 14:26539614-26539636 GAGAGAAATGGGAAGAAAACAGG + Intronic
1114887287 14:26869486-26869508 CAGTCACAATGGAAGGAAACTGG + Intergenic
1115102757 14:29722934-29722956 CAGTGAAAAAGTCAGGGAACAGG + Intronic
1115127411 14:30012910-30012932 CACAGAAAAGGGTGGGAAACTGG + Intronic
1115175262 14:30554822-30554844 CATTGAAAAGGAAATGAAAGAGG - Intergenic
1115313371 14:32002240-32002262 AAAAGAAAATGGAAGGAAACTGG - Intergenic
1116371805 14:44144211-44144233 CAGGGAAGAGGACAGGAAACAGG + Intergenic
1116676269 14:47910049-47910071 CAGTGAAATAGGAAGAAAAATGG - Intergenic
1117111762 14:52464551-52464573 CATTCAAAAGGGAAGGAAGGTGG + Intronic
1117661731 14:58013677-58013699 CAGGGAAAAGATGAGGAAACTGG + Intronic
1118284448 14:64458737-64458759 AATAGAAAAGAGAAGGAAACAGG + Intronic
1118629423 14:67689216-67689238 CTGTGAGATGGGAAGGAAACTGG - Intronic
1121499532 14:94423420-94423442 GAATGAAAAGAAAAGGAAACCGG - Intergenic
1122251647 14:100444210-100444232 CCGTGAAAATGGAAGGAAATTGG + Intronic
1122392028 14:101396191-101396213 AAGTGAAAATGGAGTGAAACGGG - Intergenic
1123655030 15:22508307-22508329 CAGTGCAGAGGGATGGAAAAAGG + Intergenic
1123692282 15:22848240-22848262 AAGTGAAAATGCAAGGAAAATGG - Intronic
1124119188 15:26874520-26874542 CCCTGAAAAGGGAAGGAATGGGG + Intronic
1124702789 15:31931317-31931339 CACAGCACAGGGAAGGAAACAGG - Intergenic
1125028059 15:35050584-35050606 CATTGAGAAGAGAATGAAACAGG - Intergenic
1125671401 15:41475810-41475832 CATTGAAGAGGTAAGAAAACTGG + Exonic
1125680648 15:41528151-41528173 GAGTGAAAAGGGCAGGAGATGGG + Intronic
1126199084 15:45965206-45965228 AAGTGATAAGGAAATGAAACAGG - Intergenic
1126567175 15:50112831-50112853 TAGGGAAACGGAAAGGAAACTGG - Intronic
1126856160 15:52841401-52841423 CAGGGAAAGAGGAAGGAAAAGGG - Intergenic
1127311392 15:57754832-57754854 GACTTAGAAGGGAAGGAAACTGG + Intronic
1127601738 15:60544305-60544327 CAGGGAAAAGGGATAGAAAGTGG + Intronic
1127784773 15:62346050-62346072 AATTGAAAAGGGAAGAAAACAGG + Intergenic
1128338729 15:66805072-66805094 CAGTGCAAAGGCAGGGATACTGG + Intergenic
1128667672 15:69550478-69550500 CTTTTAAAAGAGAAGGAAACTGG + Intergenic
1128681274 15:69653652-69653674 CAGTGAATAGGAAAGGAGGCTGG + Intergenic
1129411297 15:75352007-75352029 GGGTGCAAGGGGAAGGAAACTGG - Intronic
1129741254 15:77990732-77990754 CAGTGCTGAGGGCAGGAAACGGG + Intronic
1130185474 15:81677356-81677378 CAGTGAAAAGGAACGGGATCAGG - Intergenic
1130602629 15:85287069-85287091 CAGTGAAAATGGCAAGAAAGAGG - Intergenic
1131769916 15:95726157-95726179 AAGTGAAAAGGGCAGAAAAAGGG + Intergenic
1131923701 15:97358442-97358464 AAGAGAAAAGAGAAGGCAACAGG - Intergenic
1132152783 15:99474394-99474416 AAGTGAAAGGGGAAGGGAAGGGG + Intergenic
1133280194 16:4660778-4660800 CAGTGGAGTGGGCAGGAAACAGG + Intronic
1133344034 16:5058442-5058464 CAGGGGAAGGGGAAGGAAAAAGG - Intronic
1133489598 16:6254833-6254855 CAGAGAACAGGGCAGGAAAGAGG - Intronic
1134102789 16:11464225-11464247 CTGTAAAAAGGGAAGGAGAAGGG - Intronic
1135077616 16:19407642-19407664 GGGTGAAAAGGGAAGAAAAGGGG + Intergenic
1135848236 16:25938728-25938750 CAGTAAAAGGGGAAGTAGACAGG - Intronic
1135912376 16:26572941-26572963 GAGTGAACAAGGAAGGAAAGTGG + Intergenic
1136416427 16:30107029-30107051 CAGGAAAAAGGAAAGGAAAAGGG - Intronic
1139028275 16:62846770-62846792 TAGTGAAATGGGAAGGATGCAGG - Intergenic
1139191505 16:64868613-64868635 CATGGAGAAGGGAAGGAAATAGG + Intergenic
1140012974 16:71154675-71154697 CAGGAAAAAGGAAAGGAAGCAGG - Intronic
1140082858 16:71766288-71766310 CATTGAAAAGACAAGAAAACAGG - Intronic
1140362795 16:74358722-74358744 CAGTTACAAGGGGAGAAAACAGG + Intergenic
1140592861 16:76373911-76373933 AAAAGAAAAGGAAAGGAAACAGG + Intronic
1140867421 16:79075823-79075845 TAGTTATAAGGGAAGGAAACAGG - Intronic
1140960297 16:79905475-79905497 GAGTCAGAAGGGAAGGAAAAAGG - Intergenic
1141464896 16:84198897-84198919 CAGTGTACAGGTGAGGAAACTGG + Intergenic
1141948666 16:87326786-87326808 CAGGTCAAAGGGAAGGACACAGG + Intronic
1143373195 17:6453195-6453217 CAGGGAAGAGGGAATGTAACTGG + Exonic
1143785592 17:9253263-9253285 CAGTGAGAAGGTAGGGATACGGG + Intronic
1144833229 17:18143370-18143392 CAGAGAAAAGGGGAGGGAAAAGG - Intronic
1145781009 17:27563260-27563282 AAATGGAAAGGAAAGGAAACAGG - Intronic
1145851690 17:28105179-28105201 CAGCTAAAGGGAAAGGAAACAGG + Intronic
1146308072 17:31745945-31745967 CAGTGTCAAGTGAAGAAAACTGG - Intergenic
1146560575 17:33865331-33865353 TTGTGAAAAAGGAAGGAAACAGG - Intronic
1146561759 17:33876210-33876232 CAGTGAGAATGAAATGAAACAGG + Intronic
1146636120 17:34506468-34506490 CAGAGAAAAGGAAAGGAAAGAGG + Intergenic
1146919314 17:36699495-36699517 GAGTGCAATGGAAAGGAAACAGG - Intergenic
1147156977 17:38548933-38548955 CAGAGAACATGGAAGGAAAGAGG - Intronic
1147189568 17:38730674-38730696 CAGTGGAAAGGGAAGGACACGGG - Intronic
1147966202 17:44195524-44195546 CAGAGAAAAGAGAAGGACAGGGG + Intronic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148322569 17:46766449-46766471 CACTGAACAGAGGAGGAAACTGG + Intronic
1148350588 17:46939175-46939197 AAGTGGAAAGGAAAGGAAAGAGG + Intronic
1148565694 17:48631697-48631719 CAGTGACAAGGGATGAAACCAGG - Intronic
1148770664 17:50064196-50064218 CAGTGAAAAGTGAGGGGAAGGGG + Exonic
1149365608 17:55940521-55940543 CAGGGAAAATGGAACCAAACTGG + Intergenic
1149809622 17:59655257-59655279 CTGAGGAAAGGGAAAGAAACGGG + Intronic
1150657197 17:67046993-67047015 CAGAGAAAAGAGAGGGAAAAAGG - Intronic
1150791310 17:68201638-68201660 CATTGCACAGGGTAGGAAACAGG - Intergenic
1150867570 17:68869968-68869990 CAGAAAAATGTGAAGGAAACTGG - Intronic
1151161799 17:72172211-72172233 CAGAGCAAAGAAAAGGAAACTGG - Intergenic
1151227267 17:72656506-72656528 GCGTGGAAAGGGAAGGAGACGGG + Intronic
1151315596 17:73320147-73320169 CAGTAAAAAGAGAAGGAAGGAGG - Intergenic
1151452711 17:74208604-74208626 CAGTGATAAAGTAAGGAGACGGG - Intronic
1151664161 17:75535907-75535929 CAGTGAGGAGGGAAGGAAACAGG + Intronic
1152231232 17:79115104-79115126 TAGTGGAAAGTGAAGGAGACGGG - Intronic
1153072783 18:1125229-1125251 TAGGGAAAAGGCAAGGAAAATGG - Intergenic
1153664755 18:7358927-7358949 CAGTGAAAAGTGCAGGAATGTGG + Intergenic
1155043903 18:22087427-22087449 GAGTGAAATGGGAAGAAAAAAGG - Intergenic
1155218647 18:23664834-23664856 AAGTGTAACGGAAAGGAAACAGG - Intergenic
1155281383 18:24243669-24243691 CAGTAAAAGGGGTTGGAAACAGG + Intronic
1155436174 18:25815427-25815449 CAGAGAAGAGGGAAGGCTACTGG + Intergenic
1156045441 18:32872155-32872177 CAGAGAAGAGGGAAGGAAACAGG + Intergenic
1156226889 18:35118303-35118325 CAGTGGATTGGGAGGGAAACCGG + Intronic
1156546107 18:37965209-37965231 GAGAGAAAAGGGATGGAAAGGGG - Intergenic
1157192923 18:45596413-45596435 CAATTAAAAGGGAAGGAAGATGG + Intronic
1157410590 18:47459727-47459749 CAGAGAAGGGGGAAGTAAACTGG + Intergenic
1157673439 18:49549986-49550008 AAGTGAGAAGGGATGGAATCTGG + Intergenic
1157685332 18:49638749-49638771 CAATGGAAAGGGGAGGAATCTGG + Intergenic
1157850444 18:51044147-51044169 CAGTAGAAAGGAAAGGAATCGGG - Intronic
1157878309 18:51294321-51294343 GAGTGAAAAGGGAAGGAGTAAGG - Intergenic
1157879589 18:51307915-51307937 CAGTGGAAGGGGAAGCAAACAGG + Intergenic
1157943563 18:51955077-51955099 CTGTGTAAAGGGAGGGAAAAGGG + Intergenic
1157988944 18:52472293-52472315 GCCTGAAAAGGGAAGGAAGCTGG - Intronic
1158127557 18:54118595-54118617 CAGTGAAAAAGCAGGGTAACTGG + Intergenic
1158547134 18:58405873-58405895 AAAAGAAAAGGGAAGGAAATGGG + Intergenic
1158837435 18:61345876-61345898 GATTGACATGGGAAGGAAACAGG + Intronic
1159136510 18:64343157-64343179 CAATTAGAAGGGAAGAAAACGGG + Intergenic
1159367192 18:67483610-67483632 CAAAGAAAAGGGAAGGCAAAAGG - Intergenic
1159463715 18:68752407-68752429 CAGGGAAAGGGGAAGGGAAAAGG + Intronic
1160513854 18:79467731-79467753 CCCTGAAAAGGAAAGGAAAAGGG + Intronic
1160891395 19:1380570-1380592 CAGTGAGAGGGGAAGGACCCAGG - Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1161049378 19:2154634-2154656 CAGTGAAAAGGGACAGAAAGTGG - Intronic
1161082295 19:2317324-2317346 AAGAGAAAAGGGAATGAGACCGG - Intronic
1161267565 19:3371723-3371745 CAGAGGGAAGGGAGGGAAACTGG - Intronic
1161310985 19:3593818-3593840 AAGTGAACAGTGGAGGAAACGGG + Intergenic
1162363950 19:10236588-10236610 CAGTGGAGGAGGAAGGAAACAGG + Intergenic
1162702092 19:12524023-12524045 CAGTGAAGGGGGGAGGAGACAGG + Intronic
1163163370 19:15479124-15479146 CAAGGATAAGGGAAGGAATCTGG - Intronic
1164292468 19:23880477-23880499 GAAGGAAAAGGGAAGGAGACAGG + Intergenic
1164678489 19:30118797-30118819 CAGTGAATAGGGAGGGACCCTGG - Intergenic
1165302498 19:34979615-34979637 CAGTGATAGGGGAATGCAACTGG - Intergenic
1166347351 19:42175036-42175058 AAGTGAAAACGGGAGGAAATTGG - Intronic
1166582972 19:43918963-43918985 CTGTGAAAAGGCAAGGACATAGG + Intronic
1167241953 19:48349283-48349305 TGGTGAAAAGGGAAGGAGGCAGG - Intronic
1167843130 19:52138730-52138752 CAGGGAAAAGGGAATTTAACAGG - Intronic
925369965 2:3337080-3337102 AAGAGAAAAGGGAAGGGAAAAGG + Intronic
925369975 2:3337117-3337139 AAGGGAAAAGGGAAGGGAACAGG + Intronic
925586163 2:5466275-5466297 CAGGGAAAAGGGAAGTGAAATGG + Intergenic
926394868 2:12430558-12430580 CTGAGAAAAGGGAAGGGAAAAGG + Intergenic
926473119 2:13286251-13286273 CGGTGAAAAGGGAGGAAAAGTGG - Intergenic
926622009 2:15055212-15055234 CAGTAAAAAGCCAAGGGAACAGG + Intergenic
927034360 2:19158295-19158317 CACTGAAAAGAGGAAGAAACTGG - Intergenic
927236835 2:20882437-20882459 AAGAGAAAAGGGAAGGATAAGGG - Intergenic
927468956 2:23357980-23358002 CAGGGAAAAGGGAAAAAAACTGG - Intergenic
927629950 2:24764477-24764499 CAAGGCAAAGGGAAGGAAAAGGG + Intronic
927880565 2:26687316-26687338 CATTGAAGAGGAAAGGAAAAGGG + Intergenic
928382498 2:30831257-30831279 CATTCAAAAGAGAGGGAAACAGG + Intergenic
928956871 2:36878269-36878291 TAGTGAAAAGGAAAGGACAGTGG - Intronic
929529359 2:42737455-42737477 CACTGAAGAGGGAAGGGAAGAGG - Intronic
929847866 2:45550723-45550745 CAGTGTAAATGTAAGTAAACAGG + Intronic
930356436 2:50327028-50327050 AAGTGGAAAGGCTAGGAAACAGG - Intronic
930422383 2:51169294-51169316 CAGTGAAAAGGGAAAAACATAGG - Intergenic
930741031 2:54832658-54832680 CAAATAAAAGGGAAGGAAAGAGG + Intronic
930919133 2:56730091-56730113 CTGTGAAAAGGCACAGAAACAGG - Intergenic
930975547 2:57455173-57455195 CAGAGAAAATGGAAGGAGAGAGG - Intergenic
931037002 2:58254917-58254939 GTGGGAAAAGGGAAGGAAGCCGG - Intergenic
931732337 2:65164383-65164405 CAGAGAGAAGGGAAGAAAATGGG + Intergenic
932652832 2:73578490-73578512 AAATGAAAAGGGAATAAAACTGG - Intronic
932663360 2:73676554-73676576 CAGTGTAAATGGAGGTAAACGGG + Intergenic
933085820 2:78053083-78053105 CAGTGAGAAGGAATGGAATCGGG + Intergenic
934660416 2:96140530-96140552 CAGTGCACAGGGACGGAAAGTGG + Intergenic
934674655 2:96241132-96241154 CCCTGAACAGGGGAGGAAACTGG - Intergenic
935240493 2:101173935-101173957 CAAGAAAAAGGGAAGGAAATGGG + Intronic
935308485 2:101759820-101759842 AAGGGAAAAGGGAAGGGAAGGGG - Intronic
935689396 2:105717035-105717057 CAGTTCATAGGAAAGGAAACAGG - Intergenic
935708448 2:105876791-105876813 CAGAGAGAATGAAAGGAAACTGG + Intronic
935812092 2:106808515-106808537 CATGGAAGAAGGAAGGAAACTGG - Intronic
935869921 2:107436560-107436582 CAGTGAAAATGGCAGAAACCAGG - Intergenic
936461820 2:112720044-112720066 CAATAAAAAGGGAAAGAAAAAGG - Intergenic
937315710 2:120930892-120930914 CACTGGCAAGGGAAGGAAGCAGG - Intronic
937705682 2:124918181-124918203 CTGAGAAAAGGGAAGGAGAGGGG - Intergenic
938189217 2:129259923-129259945 TAGTGAAAAACAAAGGAAACAGG - Intergenic
938268049 2:129943448-129943470 CATTTAGAAGGGGAGGAAACTGG + Intergenic
938568502 2:132541541-132541563 AACTGAAAAGTGAAGGAAAATGG + Intronic
938599920 2:132827013-132827035 ACGTGAAAAGGGAAGAAAAGAGG + Intronic
938648405 2:133354267-133354289 GAGAGAAAAGGGAAAGAAAAAGG - Intronic
938991976 2:136639024-136639046 AAGAGAAAATGGAAGGCAACAGG - Intergenic
939198077 2:138998260-138998282 CAGAGTACAGGGAAGGAAGCAGG + Intergenic
939398369 2:141660588-141660610 CAGTGAGAAGGGATGGATCCAGG - Intronic
939706948 2:145466900-145466922 CAGGGATAAGGGAAAGAAAGAGG - Intergenic
940405133 2:153292700-153292722 CAGGGAAAAGAGATGGAACCAGG + Intergenic
941693144 2:168522642-168522664 CAGTGGGAGGGGAATGAAACTGG - Intronic
941852165 2:170195132-170195154 CAGTGATATGGGCAGGAGACAGG + Intronic
942267204 2:174240488-174240510 AAGTGAAAAGTCAAGCAAACTGG + Intronic
942856921 2:180560028-180560050 AAGGGAAACAGGAAGGAAACTGG - Intergenic
942932379 2:181511077-181511099 GAGATAAAAGGGAAGGTAACGGG - Intronic
942932464 2:181512288-181512310 CAGTGACAGGGCAGGGAAACGGG + Intronic
943060110 2:183034120-183034142 CAGGGTAAAGGGAGGGGAACTGG - Intronic
943235629 2:185315311-185315333 CAGTGAAAATGATAGGAAAATGG - Intergenic
943420445 2:187661920-187661942 CAGTGAAAAGGAAAGAGATCAGG + Intergenic
943702044 2:190997077-190997099 CAGGGAGATGGGAAGGAAAGTGG - Intronic
943976463 2:194484722-194484744 CTGAGAAAATGGAAGGAAAAAGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944438222 2:199714728-199714750 CAGAGAAAAGGGAGGGTCACAGG + Intergenic
944818918 2:203409137-203409159 CAGTGAAAAGAGAAGGTAGTTGG - Intronic
945004639 2:205391220-205391242 TAGAGAAAAGGGAAGGAAAGAGG + Intronic
945025997 2:205620609-205620631 CCTTAAAAAGGGAGGGAAACAGG + Intergenic
945071048 2:205989324-205989346 AAGTAAAAATGGAAGGAAAGGGG - Intergenic
945127466 2:206528588-206528610 CAGTGAAGAGGGCTGGAAAGGGG - Intronic
945324085 2:208462945-208462967 CATTGGAAAGTGAAGGAATCAGG + Intronic
945420962 2:209635854-209635876 CATTTCAAAGGGAAGAAAACTGG + Intronic
945848232 2:214973907-214973929 CAGTGAAATGGGAAAAATACGGG - Intronic
946606554 2:221411492-221411514 AAGAGAAAAGGGAAGGAGAAAGG + Intergenic
946675951 2:222159444-222159466 CACTGAAAAAGAAAGGACACTGG + Intergenic
947291468 2:228580057-228580079 CAGTGAGAAGGGATGGAATGTGG + Intergenic
947542335 2:230987577-230987599 CACAGAAAAGGGAAAGAAGCCGG - Intergenic
948061504 2:235045921-235045943 CAGGGAGATGGGAAGGAAAAAGG + Intronic
948532130 2:238615694-238615716 AAGAGAAAAGCAAAGGAAACGGG - Intergenic
948550279 2:238766207-238766229 AAGTGAATAGGGCAGGAAAGAGG - Intergenic
1168786865 20:546994-547016 CAGTGAACAGGCCAGCAAACTGG + Intergenic
1168841530 20:912971-912993 CAGTGTACAGGTGAGGAAACAGG - Intronic
1169554623 20:6736195-6736217 CAGAGGAAAGGGAAGGAACTAGG - Intergenic
1169623254 20:7532024-7532046 GAGAGAAAGGAGAAGGAAACTGG + Intergenic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170829905 20:19830971-19830993 CTGTGGAATGGGAAGGAAGCAGG - Intergenic
1170857553 20:20071116-20071138 CAGTTAAAAGTGAAGGGAGCTGG + Intronic
1170914142 20:20606149-20606171 CTGTGAAAATGGAAGGAAAAGGG - Intronic
1170918759 20:20655584-20655606 CAGTGAGAAGGGGAGGAGATGGG + Intronic
1171226031 20:23442801-23442823 CAGTGACAGGGCAAGGCAACAGG + Intronic
1171474512 20:25397818-25397840 AAGTGAAAAGGGAAGGGAAAGGG + Intergenic
1172438369 20:34946694-34946716 AAATCAAAAGGCAAGGAAACTGG - Intronic
1172468231 20:35172677-35172699 TAGGGAAAATGGAAGGAGACTGG + Intronic
1172944681 20:38677997-38678019 CAGTGGAAATGGAAGAAAAGAGG + Intergenic
1172997364 20:39081093-39081115 CATTTAACAGAGAAGGAAACAGG - Intergenic
1173182206 20:40814014-40814036 GAGAGAAAAGGGAGGGAGACAGG - Intergenic
1173857164 20:46257892-46257914 CAGAGAGAAGGGGAGGAAAAGGG + Intronic
1173911107 20:46671626-46671648 CTGTGAAAAGGAAAAGGAACAGG + Intronic
1173954571 20:47021003-47021025 CATTTCATAGGGAAGGAAACTGG - Intronic
1174133926 20:48365750-48365772 GAGTCAAGAGGGAAGGAGACGGG - Intergenic
1174582104 20:51579385-51579407 CAGGGAAAGGGGAAGGACATTGG + Intergenic
1175597991 20:60250701-60250723 CAGTGAGCAGGCAAGGAAGCAGG + Intergenic
1175655427 20:60765771-60765793 GAGTGATAAGGGATGGAACCAGG + Intergenic
1175846336 20:62060906-62060928 CAGTGAAAAATGAGGGGAACTGG + Intronic
1175940131 20:62533946-62533968 CAGCCACAAGAGAAGGAAACCGG + Intergenic
1178360376 21:31944406-31944428 CACTGAAACGGGAAGAAAAGGGG - Intronic
1179020477 21:37636129-37636151 CAGGGAAAAGGCAGGGAAAAGGG - Intronic
1179540354 21:42079608-42079630 AAGAGAAGAGGGAGGGAAACAGG + Intronic
1179628863 21:42664635-42664657 CAATCAAAAGGCAAGGAAAGAGG + Intronic
1181694821 22:24587804-24587826 CATTTTAGAGGGAAGGAAACAGG - Intronic
1181744510 22:24946516-24946538 GAGTGAGGAGGGAAGGAAACTGG - Intronic
1182756875 22:32687494-32687516 CAATGGAAAGAGAGGGAAACAGG - Intronic
1183054445 22:35294818-35294840 AAGGAAAGAGGGAAGGAAACAGG - Exonic
1183439638 22:37815944-37815966 CAGAGAGAAGGGAGGGGAACAGG - Intronic
1184144353 22:42600183-42600205 CAGTGAAAATGACAGGAAAATGG + Intronic
1184155875 22:42666738-42666760 GAGTGAAAAAGGAAGGATTCAGG - Intergenic
1184378886 22:44132611-44132633 CAGTGATGAGGGAAAGGAACAGG - Intronic
949449495 3:4169615-4169637 CAGTAAAAAGGTACGCAAACTGG - Intronic
949456947 3:4249006-4249028 CAGTGAGAAGTGAAGGAGAAGGG - Intronic
949626419 3:5871819-5871841 CTGAGAAAAGGGAAAGAGACAGG - Intergenic
949714116 3:6908556-6908578 CTGTGAAAAGGCAAGCAAATAGG - Intronic
949916876 3:8971965-8971987 CAGTGAGAAAGGAGGGAAGCTGG + Intergenic
950246490 3:11424102-11424124 CAGTGAAAAGCGAAAGGACCAGG - Intronic
950252946 3:11482102-11482124 CAGTGATGAGAGAAGGAACCGGG - Intronic
951033188 3:17905339-17905361 GAGTGAAAAGGGTAGGGAAGAGG - Intronic
951233750 3:20210874-20210896 CAAGGAAAAGTGAAGGAAGCAGG - Intergenic
951495233 3:23317851-23317873 CACTGAAAAGGGTAAGAAAGAGG - Intronic
951532473 3:23710695-23710717 CAGTGAGTAGGGCAGGAAGCAGG - Intergenic
951636716 3:24786814-24786836 CAGTAAAGGGAGAAGGAAACAGG - Intergenic
951916137 3:27802783-27802805 TGGAGAAGAGGGAAGGAAACTGG + Intergenic
952038250 3:29230667-29230689 GAGAGGAAAGGGAAGGAAAAAGG - Intergenic
952108835 3:30099067-30099089 AAGTAACAAGGAAAGGAAACAGG + Intergenic
952380474 3:32800681-32800703 CAGTCAAAAGGCAAGCATACAGG + Intergenic
952693905 3:36243229-36243251 CAGTGAAAAGTGAAACAAAATGG - Intergenic
952736335 3:36695142-36695164 GAGTGAAAAAGGAAGGAGAAAGG - Intergenic
952989230 3:38817052-38817074 CAGTTAATAGAGGAGGAAACTGG + Intergenic
953616806 3:44497964-44497986 CAGTGTAATGGGAGGGAGACGGG + Intergenic
953780027 3:45860394-45860416 CAGTGAAAAGGAAAGGACTTTGG + Intronic
953924368 3:46974631-46974653 AAGTGAAAAGGGAAGTAATAGGG - Intronic
954196558 3:49000580-49000602 CAGGAACAAGGGAAGGAAGCAGG + Intronic
954407556 3:50353910-50353932 CAGAGAAAGGGGAAGGAAATGGG - Exonic
954787413 3:53104105-53104127 CAGGGAAGAGGGAAGGAAGTTGG + Intronic
954826341 3:53376929-53376951 CAGTGGAAAGGGGAGAAAACTGG - Intergenic
955226225 3:57062492-57062514 CAGAGAAGAGGGAAGGAAGCAGG + Intronic
955281727 3:57600455-57600477 GAGGGAAAAGGGAAGGGAAAAGG - Intergenic
956135936 3:66098994-66099016 CAGAGAGAAGGGAAGGGAAGGGG - Intergenic
956211767 3:66808998-66809020 CTGTGAACAGGGAAGGAGAGCGG - Intergenic
956214619 3:66835680-66835702 CTGTGTAAAGGGAAGAAAATGGG + Intergenic
956689997 3:71867523-71867545 CAATAAAAAGGGCAGGAAAGGGG + Intergenic
956783423 3:72622846-72622868 CAGTGAAAGAGAAAGGAAAGGGG - Intergenic
956930997 3:74042823-74042845 CAGTGAAAAGGCCATGAAACAGG - Intergenic
957235471 3:77583325-77583347 CAGACAGAAGGGAAAGAAACAGG - Intronic
957289843 3:78265949-78265971 CAAAGAAAAGGGATGGAAAAAGG - Intergenic
957571073 3:81948053-81948075 CACTGTAAAAGTAAGGAAACTGG - Intergenic
957771629 3:84700474-84700496 AAGGGAAAAGGGGAGTAAACAGG + Intergenic
957826958 3:85459455-85459477 TAGTGAGAAGGGAAAGAAAGGGG + Intronic
957898141 3:86450248-86450270 CAGTGAAAAGATAAGGAAATGGG + Intergenic
958069447 3:88591348-88591370 CAGAGAAATAGGAAGAAAACAGG + Intergenic
959005345 3:101013492-101013514 CTGAAAAAAGGTAAGGAAACAGG - Intergenic
960522994 3:118677363-118677385 CAGTGAGAAGGGACAGAACCGGG + Intergenic
960610000 3:119547010-119547032 AAGTGAAAAGGGGAGGAATCAGG - Intronic
960680765 3:120245099-120245121 CAGGCAATAGGGAAAGAAACTGG + Intronic
960720693 3:120622376-120622398 CAGGGGAAGGGGAAGGAGACTGG - Intergenic
961607136 3:128104667-128104689 CAGTGCACAGGTCAGGAAACTGG + Intronic
963184593 3:142399746-142399768 AAGAGAAAAGGAAAAGAAACTGG + Intronic
963248279 3:143082872-143082894 CAATGATAAGGGAAGGAAATGGG - Intergenic
963333048 3:143937825-143937847 CACTGAAAAGGGAAGAAAAAGGG - Intergenic
963462286 3:145631371-145631393 CATTGAAAAAGAAAGAAAACTGG - Intergenic
963931346 3:151007156-151007178 CAGAGAAACGGGAAGAAATCAGG - Intergenic
964617856 3:158688473-158688495 AAGGGTAAAGGGAAGGAAAGAGG - Intronic
965136502 3:164778311-164778333 CAGAAAAAAGGGAAAGAAAGAGG + Intergenic
965468963 3:169066303-169066325 CAGAGAAAAAGGGAGAAAACTGG - Intergenic
965653969 3:170964206-170964228 AAGTGAAAAGGGTAGGGAAAAGG + Intergenic
966476076 3:180348289-180348311 GAGAGGAAAGGGAAAGAAACTGG - Intergenic
966652345 3:182315352-182315374 CAGTGAAGAGGGATGGATCCCGG + Intergenic
967019003 3:185506093-185506115 CAGTGAAGAGGGGAGGGAAGAGG + Intergenic
967812361 3:193771561-193771583 CACAGAAATGGGAGGGAAACAGG - Intergenic
968056247 3:195694139-195694161 CAGAGAAAAGGGAATGAGAACGG + Intergenic
968704772 4:2072757-2072779 CAGTGAACAGGGACGGCAGCCGG - Intronic
969164931 4:5299293-5299315 CAGTGAAAAGGGAAGGAAACAGG + Intronic
969259843 4:6026409-6026431 AAGAGAAATGGGAAGTAAACAGG + Intronic
969466045 4:7357065-7357087 TAGTGAGCAGGGAAGGAGACAGG - Intronic
969612906 4:8237000-8237022 CCCTGAAAAGGGGAGGACACCGG + Intronic
969690209 4:8699989-8700011 CAGTGAGGAGGGAGGGAGACGGG - Intergenic
970040490 4:11791966-11791988 AAGCAAAAAGGGAAGCAAACTGG + Intergenic
970247852 4:14081948-14081970 AAAGGAAAAGGGGAGGAAACAGG + Intergenic
970461535 4:16279157-16279179 CATTCAGAAGGGAAAGAAACCGG + Intergenic
970525067 4:16923907-16923929 CAGTGGAAAGGGAATGAACTTGG + Intergenic
971020037 4:22525576-22525598 CAGTGAGAAGCAAAGGAAAGAGG + Intergenic
971042837 4:22773934-22773956 CAGTGATAATGAAAAGAAACAGG + Intergenic
971135049 4:23859431-23859453 CAAAGAAGAGGGAAGGAAATTGG + Intronic
971182135 4:24338612-24338634 CAGTGAAAAGGACTTGAAACGGG - Intergenic
972400325 4:38695928-38695950 AAGAGAAAAGGGAAGGAAAGTGG + Intronic
973655472 4:53043256-53043278 CAGTGACAAGTGAAAGAAAAGGG + Intronic
973884859 4:55310281-55310303 CAGTGAAAAGAGAAAAAAGCAGG + Intergenic
974348443 4:60713329-60713351 CAGTGAAAGGAAAAGGAAACAGG + Intergenic
974414000 4:61580937-61580959 AAGAGAAAAGGGAAGAATACTGG + Intronic
974997780 4:69183537-69183559 CAGTGAAAACACATGGAAACAGG - Intronic
977356195 4:95950338-95950360 CAGTGGAAATGGAAAGATACGGG + Intergenic
977711558 4:100132537-100132559 CAGTGAAACTGAAAGGAAATAGG - Intergenic
977888574 4:102280195-102280217 AAGGGAAAAGGGAAGAAAAAAGG - Intronic
979102915 4:116645095-116645117 TTGTGGAAAGGGAAGTAAACAGG - Intergenic
979164752 4:117514698-117514720 CTGTGAAAAAGAAAGAAAACTGG + Intergenic
979457378 4:120942417-120942439 GAATGGAAAGAGAAGGAAACTGG - Intergenic
979923210 4:126526634-126526656 CATTAAAAAGGCAAGAAAACGGG - Intergenic
980599654 4:135005013-135005035 GAGTGTATAGGGAAGGAAATAGG - Intergenic
980617411 4:135248710-135248732 CTCTGAAATGGTAAGGAAACTGG - Intergenic
980889596 4:138800287-138800309 CAGGGAAAAGGAAAAGAAAGGGG + Intergenic
981218094 4:142195714-142195736 CAATAAGAAGGGAAGGAAAAGGG + Intronic
981234181 4:142395239-142395261 CAGAGAAAAGGAAATGAAAGAGG + Intronic
981465615 4:145068066-145068088 GAATGTAAAGAGAAGGAAACTGG + Intronic
981667623 4:147247210-147247232 CAGGAAGAAAGGAAGGAAACAGG + Intergenic
981696407 4:147563600-147563622 CAGTAAGAAGGGAAGAAAATTGG - Intergenic
981987227 4:150872713-150872735 CATCGAAAAGTGAAGGAATCAGG - Exonic
982091062 4:151880454-151880476 CAGAGGAAAGGAAAGGAACCGGG - Intergenic
982721379 4:158863490-158863512 CAGGGAAGAGGGAGGGAAGCCGG + Intronic
982958204 4:161798875-161798897 GAGTGAAATGGGAAGAAAAGTGG + Intronic
983191690 4:164760877-164760899 CAATGAAAAGGGAAATAAAGGGG + Intergenic
983506849 4:168562668-168562690 CACTGAAATGGGAATGAGACAGG + Intronic
983862112 4:172720281-172720303 GAGTGAAAAGGGAATAAAAAGGG + Intronic
983923967 4:173376261-173376283 CAATGAAAAAGCAAGGAAGCAGG + Intronic
984540796 4:181034682-181034704 CAGAGACAAGGTAAGGAAGCAGG - Intergenic
984720802 4:182970889-182970911 AAGGAAAAAGGGAAGGAAAAAGG + Intergenic
984911383 4:184676804-184676826 AAGGGAAAAGGGAAGGGAAGGGG - Intronic
985168536 4:187123844-187123866 GAGTGACAAGGGAAGGAAAAAGG - Intergenic
985377821 4:189360567-189360589 CAGTGAGATAAGAAGGAAACAGG + Intergenic
985798142 5:1980117-1980139 CAATAAAAAAGGAAGGAAAAAGG + Intergenic
986057827 5:4156412-4156434 ATGAGAAAAGGGAATGAAACAGG - Intergenic
986310459 5:6547217-6547239 GAGTGGAAAGGGAAGGGAAGGGG - Intergenic
986588440 5:9343774-9343796 CAAAGGAAAGGGAAGGAAACTGG - Intronic
986719051 5:10547099-10547121 CAGTGAAAAGGGGAGAAAACAGG + Intergenic
986765728 5:10924306-10924328 GAGTGAGGAGGGAAGGCAACAGG - Intergenic
987771319 5:22309354-22309376 AAGTGAAAAGAGAACAAAACAGG + Intronic
987876169 5:23684447-23684469 CTCTGACAAGGGAAGGAAAAGGG + Intergenic
988222919 5:28372233-28372255 CAGTTAAACTGAAAGGAAACTGG + Intergenic
988523565 5:31967206-31967228 CACTTGAAAGGGAAGGGAACTGG + Intronic
988548717 5:32181130-32181152 CAGAGAAAAAAAAAGGAAACTGG + Intergenic
988673932 5:33411617-33411639 GAGTGAAGAGAGAAGGAAAGGGG - Intergenic
988918792 5:35921874-35921896 CAGTTAAAAGAGGAGGAAACAGG - Intronic
989069662 5:37497271-37497293 AAGGGAAAAGGGAGGGAAAAGGG - Intronic
990558204 5:56957076-56957098 CTCAGAAAAGGGAAGGAAAATGG + Intronic
990617704 5:57524153-57524175 CAATGAAAAGGAATGGAAACAGG - Intergenic
991501539 5:67282045-67282067 AAGGAAAAAGGGAAGGAAAAGGG - Intergenic
991722516 5:69507024-69507046 CAGAGAAAAGGAGAGGACACAGG - Intronic
992175612 5:74146299-74146321 CAGTCAGAAGGGAAGGAAGATGG - Intergenic
992495556 5:77289958-77289980 CAGTGATAAGGAAATGAAATAGG - Intronic
993038939 5:82790278-82790300 CAGTGAAAAAATTAGGAAACAGG - Intergenic
993050413 5:82920000-82920022 CAGGGTAAAGGAAAGGAAAGGGG - Intergenic
993621457 5:90173112-90173134 CAGTGGAAATGGAAGGAACCAGG - Intergenic
994331894 5:98516084-98516106 AAATGAGAAGGGAAGGAAACAGG - Intergenic
994777165 5:104049564-104049586 TAGGGAAAGGGGAAGTAAACAGG - Intergenic
995171109 5:109113391-109113413 CAGTAAGAAGCAAAGGAAACAGG + Intronic
995735789 5:115297919-115297941 CTGTGAGAAGGGAGGAAAACCGG + Intergenic
996196116 5:120609774-120609796 CAGAGAAATGGGAAAGAAAATGG - Intronic
996208337 5:120772208-120772230 CAGTTAAAAAGGAAGAAAACAGG - Intergenic
997263817 5:132483448-132483470 CAGTGAAATGTGAAGGAAAGTGG - Exonic
997819719 5:137054086-137054108 CATTAAAAAAGGAAGGAAAATGG + Intronic
997835892 5:137193282-137193304 CAGTGAGAAGTGAAGAAACCTGG + Intronic
998224903 5:140319388-140319410 GAGTGAAAAGGGAAGAACATAGG - Intergenic
998448897 5:142219347-142219369 CATTGAACAGGTATGGAAACAGG - Intergenic
998556915 5:143134447-143134469 CCGAGAAAAGGAAAGGACACTGG - Intronic
998813217 5:145986888-145986910 CAGGGAAAAGGGAAGGAAGTAGG - Intronic
998825281 5:146095304-146095326 TAGTGACAAGGGGAGGAAAAAGG - Intronic
999229919 5:150055769-150055791 CAGTGACAAAGGAGGGTAACAGG + Intronic
999256193 5:150211130-150211152 CACTGGACAGGGGAGGAAACAGG + Intronic
999790305 5:154933922-154933944 TAGTGAAAATGGAAGGGGACTGG - Intronic
999840476 5:155419922-155419944 GAGTGAAATGATAAGGAAACAGG - Intergenic
1000290432 5:159865053-159865075 CAGAGAAAAGGGGAGGATTCGGG + Intergenic
1001108399 5:168875261-168875283 GAGTGAGAAGGGAAGAAAACAGG + Intronic
1001417250 5:171554829-171554851 CGGTGAAGTGGGAAGGAGACTGG - Intergenic
1001456394 5:171863871-171863893 CACTGATGAGGGAAGGAAACGGG + Exonic
1001653721 5:173332282-173332304 CTAAGAAAAGGAAAGGAAACTGG - Intergenic
1001784295 5:174398578-174398600 GCTTGAAAAGGCAAGGAAACAGG + Intergenic
1001887574 5:175309284-175309306 CAGTGAAAGGGCAAGGTATCTGG - Intergenic
1002029930 5:176420414-176420436 GAGAGAAAAAGGAAGGAAAGGGG - Intergenic
1002078329 5:176723080-176723102 CAGTGAAAAGAGCAGCAAAGAGG + Intergenic
1002393116 5:178931312-178931334 CAATGGAAAGGGAAGGTATCTGG + Exonic
1002669860 5:180857833-180857855 CAGTGAAATGGCATGGAATCTGG + Intronic
1002779539 6:355800-355822 CAATGAAAAGGAAAGGGAAGAGG - Intergenic
1003435769 6:6086577-6086599 CAGTGAAAAAATAAGGAAATAGG - Intergenic
1003682495 6:8269710-8269732 CTGGGAAAAGGCAGGGAAACAGG + Intergenic
1003899595 6:10641733-10641755 CATTGAAAAGGGAAGAATGCAGG - Intergenic
1004170526 6:13292385-13292407 CTGGCAAGAGGGAAGGAAACTGG + Intronic
1004285760 6:14318980-14319002 CAGGGAAAAGTTAAGGAAGCTGG - Intergenic
1004366171 6:15014579-15014601 GAGTGAAAAGGGAAGAGATCTGG + Intergenic
1004576962 6:16905850-16905872 CACAGAAGAGGGAAGGAAGCTGG - Intergenic
1004617408 6:17303605-17303627 AAGGGAAAAGGGAAGGAGAAGGG + Intergenic
1005091241 6:22059109-22059131 CAGAGAAAAGGGAAGAAAACAGG - Intergenic
1006053131 6:31358692-31358714 CTGTGAAAAGTCAAGGAATCGGG - Intergenic
1007343521 6:41209256-41209278 CAGGGAGAAGGGAGGGAAAGAGG - Intergenic
1007355685 6:41314132-41314154 CAGAGAATAGTGAAGGCAACTGG + Intergenic
1007495045 6:42254072-42254094 TTGTGAAAAGTGAAGGAAATAGG - Intronic
1007868507 6:45004614-45004636 CATGTAAAAGGGAAGGAAATGGG - Intronic
1008010865 6:46466313-46466335 GAGTGAAAAGGAAAGAAAGCAGG + Intronic
1009562082 6:65259178-65259200 CAATGAAAAGTGAAAGGAACTGG + Intronic
1010368091 6:75076076-75076098 AAGGGAAAAGAAAAGGAAACAGG + Intergenic
1010771867 6:79841069-79841091 CAATGAGGAGGGAAGGAAAGTGG + Intergenic
1010928393 6:81770981-81771003 CAGGGAAATGAGAAGGAAAGGGG + Intergenic
1011058445 6:83233185-83233207 CAGTGAAAAGAGAATGAAAAGGG - Intronic
1011979223 6:93351323-93351345 CAGAGAGAAGGGAAGCAAGCAGG - Intronic
1012724780 6:102796775-102796797 CAGTGAAAAGGGTAGGAAGTGGG + Intergenic
1012977415 6:105794871-105794893 CTGGGAAAAGGGAAGGGAACTGG + Intergenic
1013087997 6:106873004-106873026 CTGTGAAAAGGGGAAGAAGCAGG + Intergenic
1013920462 6:115396631-115396653 CAGTGAGAAGGAATGGATACAGG + Intergenic
1014982582 6:127962581-127962603 GAGAGTAAAGGGAAGGAAAATGG - Intergenic
1015127768 6:129773332-129773354 GAGAGAAAAGGGAAAGAAGCTGG + Intergenic
1015139619 6:129914885-129914907 CTATGAACAGGTAAGGAAACTGG + Intergenic
1015655040 6:135508506-135508528 AATTGAATAAGGAAGGAAACTGG + Intergenic
1015788474 6:136942629-136942651 CAGTGTAGAGGGAAGGAAACAGG - Intergenic
1015841062 6:137477849-137477871 CATTGCACAGAGAAGGAAACAGG + Intergenic
1016441369 6:144087537-144087559 TAGAAAAAAGGGAAGGAAATTGG + Intergenic
1016474456 6:144411181-144411203 CAGTGAAAAGGGAACGCTGCTGG - Intronic
1016749188 6:147613787-147613809 GAGGAAAAAGGGAAGGAAAATGG + Intronic
1016798865 6:148147584-148147606 AAAGGAAAAGGAAAGGAAACAGG + Intergenic
1017431827 6:154378918-154378940 GAGTGAAATGGAAAGGAAGCAGG + Intronic
1017727450 6:157285424-157285446 TTCTGAAAAAGGAAGGAAACAGG + Intergenic
1018064577 6:160116347-160116369 CAGTGGAAAAGGAAGGATGCAGG + Intergenic
1018443119 6:163831593-163831615 CAGTGAAGGGGGAATAAAACGGG + Intergenic
1018582732 6:165321468-165321490 CAGAGAAAAGAGAAGGCAACTGG + Intergenic
1018882938 6:167903494-167903516 CAATGAAAGGTGGAGGAAACGGG - Intronic
1019265011 7:110268-110290 GAGTGATAAGGAAAGGAACCAGG + Intergenic
1019696434 7:2448796-2448818 AAAGGAAAAGGGAAGGAAAAAGG - Intergenic
1020012288 7:4812774-4812796 CAGTGAACTAGGAAGCAAACAGG - Intronic
1020635387 7:10690622-10690644 CAGGGAAAAAGGATGGGAACGGG + Intergenic
1020749634 7:12124085-12124107 GAGTGAAAAAGGAAGAAAAGGGG + Intergenic
1020803172 7:12756842-12756864 CTGGGAAAGGAGAAGGAAACTGG + Intergenic
1021020833 7:15596588-15596610 TACTCAAAAGGTAAGGAAACAGG - Intergenic
1021060003 7:16099497-16099519 AAGGGAAAAGGGAAGGAAAGAGG + Intronic
1021316730 7:19157186-19157208 AAGCAAAAAGGGAAGGAATCAGG - Intergenic
1022372287 7:29783253-29783275 CAGTGATATGGGAGGGAGACAGG + Intergenic
1022863789 7:34396268-34396290 CAGTGAAAAGGCTAACAAACTGG + Intergenic
1023473452 7:40550959-40550981 AAGAGAAAAGAGAAGAAAACAGG - Intronic
1023534185 7:41190848-41190870 CAGTCACAAGGGAAGGAGACAGG - Intergenic
1024842383 7:53602563-53602585 TAACGTAAAGGGAAGGAAACAGG + Intergenic
1024878413 7:54054730-54054752 TAGTGAACAGGAAAGGAAACAGG - Intergenic
1024883100 7:54111807-54111829 CAGGGAAAAGGGAAGGAAAAGGG + Intergenic
1025086689 7:56029113-56029135 CAATGAAAAGAGGAGGAAATTGG - Intronic
1026323123 7:69284703-69284725 GAGTGAAAAGGAAGGGAAAGAGG - Intergenic
1026648250 7:72191888-72191910 AATAGAAAAGGCAAGGAAACGGG - Intronic
1027367491 7:77473570-77473592 CAGAGAAGAGGGAAGGAATTAGG + Intergenic
1027418231 7:77995066-77995088 AAGCCAAAAGGGAAGGAAAATGG + Intergenic
1027603883 7:80275160-80275182 CATTAAAAAGGGAGGGAAAGGGG - Intergenic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1027994949 7:85413950-85413972 TAGTTAAAAGAAAAGGAAACAGG - Intergenic
1029237298 7:99131727-99131749 CAGTGAAGAGGGAGGAAAAGAGG + Intronic
1029957013 7:104650789-104650811 CAATGACAGGAGAAGGAAACAGG + Intronic
1030671517 7:112343341-112343363 CAGGGAAAAGTGAAGTTAACTGG - Intergenic
1030707322 7:112707345-112707367 AAAAGAAAAAGGAAGGAAACTGG - Intergenic
1030880543 7:114873067-114873089 CAGTGGAAAGGGAAGGCAGTTGG - Intergenic
1031060059 7:117040981-117041003 CAGAGAAAAGGAAAGCAAAGGGG - Intronic
1031865478 7:127034524-127034546 GAGGGAAAAGGGAAGGAACAGGG - Intronic
1032263452 7:130354275-130354297 GAGTGAAATGGGAAAGAAAGAGG - Intronic
1032606633 7:133362063-133362085 AAGTCAAAAGAGAAAGAAACTGG - Intronic
1032653160 7:133900674-133900696 CAGGGGACAGGGAAGGAAAATGG + Intronic
1032880265 7:136082855-136082877 AAATGAAAAGGAAAGGAAAGGGG - Intergenic
1033092207 7:138396309-138396331 AAGTGCAAAGGGAAGGAAAATGG - Intergenic
1033166303 7:139041369-139041391 CAGTGAACACTGAAGGAAAAGGG + Intergenic
1033544689 7:142389298-142389320 CAGTGTAAAGTGGAGGACACAGG - Intergenic
1033596380 7:142862589-142862611 CAGTGAAGCGGGAGGGACACAGG - Intronic
1034051997 7:147993873-147993895 TTGTGAAGGGGGAAGGAAACAGG - Intronic
1034520394 7:151614847-151614869 CAGTGTAAAGGTGAGGAGACTGG - Intronic
1034653411 7:152710497-152710519 AGGAGAAAAGGGAAGGAAAGAGG + Intergenic
1034767862 7:153743603-153743625 CACTGAAGAGGGAGGGAAAAAGG + Intergenic
1034823273 7:154236850-154236872 CAGTAAAAAAATAAGGAAACAGG + Intronic
1035682236 8:1496474-1496496 CCTTGAGAAGGGAAGGAAGCAGG - Intergenic
1035795230 8:2350034-2350056 TGGTGAAAGGGGAAGCAAACAGG - Intergenic
1036062364 8:5337869-5337891 CATTCAAAAGGGAAGGGAAATGG - Intergenic
1036414503 8:8534687-8534709 CAGTGAAAATGAAAGGAAATGGG - Intergenic
1036421691 8:8602087-8602109 CTGACAAAGGGGAAGGAAACAGG - Intergenic
1036465400 8:8992685-8992707 CAGAGAAAAAGGAAGGAAGCAGG + Intergenic
1037043731 8:14270994-14271016 CAGTGAGAACGCAAGGACACAGG + Intronic
1037115385 8:15219678-15219700 AAGTGAATACAGAAGGAAACAGG + Intronic
1037274119 8:17159159-17159181 CTGTGAAAAGGAAAGGAGTCTGG - Intronic
1037631907 8:20665649-20665671 GAATGCAAAGGGAAGGAAAGGGG - Intergenic
1037793480 8:21969460-21969482 CTGTGAAAAGAGAGGGAAAAAGG - Intronic
1038037618 8:23699905-23699927 CAGTGAAGGGGGAAAGAAAGGGG - Intergenic
1038277450 8:26133824-26133846 CAGGGAACAGGGATGGGAACTGG - Intergenic
1038315370 8:26480194-26480216 CAGTTAAAGGTGAAGAAAACAGG + Intronic
1039485356 8:37905481-37905503 CAGTGGGAAGGGAAGGAAAGGGG - Intergenic
1039734068 8:40310649-40310671 GACTAAAAAGAGAAGGAAACTGG + Intergenic
1040067267 8:43156870-43156892 CAAAGAAAAGGGATGGAAAAAGG - Intronic
1040384354 8:46903662-46903684 CAGGGAAAAAGAAAGGAATCAGG + Intergenic
1041006334 8:53499972-53499994 CTATCAACAGGGAAGGAAACAGG - Intergenic
1041159850 8:55028613-55028635 AAATGAAAAGGGAAAGAAAGGGG - Intergenic
1041331289 8:56728492-56728514 CAGTGAAAATGCAAGGGTACAGG - Intergenic
1041592904 8:59610546-59610568 CAGAGAAGAGGGAAAGGAACTGG - Intergenic
1041838798 8:62246709-62246731 CACTGAAAAGATAGGGAAACAGG - Intergenic
1041902957 8:63002072-63002094 CAGTAAAAAGGGAAGGTCAGTGG - Intergenic
1042928569 8:73991469-73991491 CAGTAAATATGGAAGAAAACAGG - Exonic
1044273258 8:90271746-90271768 GAGCCAAAAGGGAAGGAAAGTGG + Intergenic
1044769366 8:95613888-95613910 CAGGGAAAAGGGCAGGAAGGGGG - Intergenic
1044929315 8:97236643-97236665 CATTCGAAAGGGAAAGAAACTGG + Intergenic
1045112174 8:98946629-98946651 CAGAGAAAAGGGAAAGAAGATGG + Intronic
1045663405 8:104461369-104461391 CAGTGAAATGGGAATGATAATGG + Intronic
1046473956 8:114716204-114716226 GTGTGAAAAGGCAAGAAAACAGG - Intergenic
1046647432 8:116801659-116801681 CAACAAAAAGGCAAGGAAACAGG - Intronic
1047491083 8:125375177-125375199 CAGGTAAAACTGAAGGAAACAGG + Intergenic
1047676259 8:127206438-127206460 CATTTAAAAGGGAAGGGAATGGG + Intergenic
1047900918 8:129421815-129421837 GAGTAAAAAGAGAATGAAACGGG + Intergenic
1047907324 8:129486435-129486457 AAGTGAACAGGGAAAGTAACTGG - Intergenic
1048061731 8:130925902-130925924 GAGGCCAAAGGGAAGGAAACTGG - Intronic
1048348575 8:133597211-133597233 AAGAGGAAAGGGAAGAAAACAGG - Intergenic
1048706778 8:137162501-137162523 CACTGAAAACTGAAGGAAAGTGG + Intergenic
1048719623 8:137308763-137308785 CATTGAAAAGTTAAAGAAACTGG + Intergenic
1048762534 8:137811538-137811560 CAGAGTACAGGAAAGGAAACAGG - Intergenic
1049329503 8:142042785-142042807 CAGAGAAAACGGGAGGAAGCGGG + Intergenic
1049397704 8:142409276-142409298 GAGTGAAAAGAGAAGGAGAGAGG + Intergenic
1050981245 9:12018345-12018367 CAGTGATATGGGCAGGAGACAGG - Intergenic
1051308530 9:15743102-15743124 AAGTGAATAGTAAAGGAAACTGG + Intronic
1051394987 9:16610115-16610137 CAGTGATGAGGGAAGGGAAAAGG + Intronic
1051534437 9:18141230-18141252 CAGTGAGAAGGGGAGGAGAGTGG + Intergenic
1051596129 9:18825971-18825993 CAGTACAAAGAGGAGGAAACAGG - Intronic
1052765996 9:32641473-32641495 CAAAGAAAAGGGAAGGGAAGGGG + Intergenic
1054968003 9:71051863-71051885 CAGTCAGAGGGAAAGGAAACTGG + Intronic
1055120998 9:72660826-72660848 AAATGAAAAGGGAAGGACAAGGG - Intronic
1055140896 9:72876008-72876030 CAGTGCAAGGGAGAGGAAACAGG + Intergenic
1055274092 9:74594797-74594819 AAGAGAAAAAGGAAGGAAAGAGG + Intronic
1055883064 9:81025059-81025081 CAATGGAAGGGGAAGGAAATAGG - Intergenic
1056232305 9:84559147-84559169 CAGTGAAGAAGGAAGGAATTAGG + Intergenic
1056467173 9:86869098-86869120 AAGTAACAAGGGAAAGAAACAGG - Intergenic
1057798517 9:98175169-98175191 GAGTGAAAGGGGAAGCAGACAGG - Intronic
1057910872 9:99019668-99019690 CAGAGAGAAGTGAAGAAAACTGG - Intronic
1059042794 9:110831979-110832001 TAGTAAAAATGGAGGGAAACAGG - Intergenic
1059326348 9:113506186-113506208 CAGGGAGAAGGGAAGGCAAAGGG + Intronic
1059562625 9:115349939-115349961 AAGTGAATAGAGAAGGAAAAAGG + Intronic
1059784781 9:117569533-117569555 CAGTGAAAAGCGTATTAAACTGG - Intergenic
1059918242 9:119128223-119128245 AAGGAAAAAGGGAAGGAAAGAGG - Intergenic
1060870953 9:127039768-127039790 CAGTGAAATGGGAGGGAAAGGGG + Intronic
1061475339 9:130861859-130861881 CAATGAAAAGAGAAGAAAACAGG + Intronic
1061722565 9:132561830-132561852 CAGTAAGAAGGCAAGGAAAGAGG + Intronic
1061729414 9:132601975-132601997 AAGAGAAAAGGGGAGGAGACAGG + Intronic
1061739320 9:132688812-132688834 CAGTCAAAAGGGATGAATACCGG - Intronic
1185940898 X:4317749-4317771 AAGTGAAAAGGAAAGAAAAAAGG + Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186423209 X:9443292-9443314 CACTTGAAAGGGAAGCAAACGGG + Intergenic
1186521340 X:10209323-10209345 AAGGGAAAAGGGAAGGGAAGGGG - Intronic
1186546919 X:10459559-10459581 CAGAGAAAAGGAAAAGAAAGGGG + Intronic
1186826993 X:13350313-13350335 CAGTGAACAGGGAAAGGAAGTGG + Intergenic
1187216193 X:17279248-17279270 CTGTGAAAAGGGAAAGAACCAGG - Intergenic
1187252635 X:17612662-17612684 CAGTGAACAGGGCAGCAATCAGG - Intronic
1187518350 X:19991750-19991772 CAGTGACAAGGGAGGGCAAAAGG - Intergenic
1187585913 X:20661828-20661850 CTCTGAAATGGAAAGGAAACAGG - Intergenic
1188341229 X:29004474-29004496 CAGTGAACACATAAGGAAACTGG + Intronic
1188862797 X:35276584-35276606 GAGTGAAAAGGGAAAAAAAAAGG + Intergenic
1189097802 X:38158570-38158592 CAGGGAAGAGGGCAGGAAAGAGG - Intronic
1189110919 X:38287666-38287688 CAGTGAGAAGGAAACTAAACTGG - Intronic
1189989495 X:46580721-46580743 GAGTGAACAGGGAAGGAGGCTGG + Intronic
1190259780 X:48790631-48790653 GAGTGGAAAGAGAAGGAAATGGG + Intronic
1190783129 X:53618175-53618197 CAGTGAAAACGAAAGCAAAAAGG + Intronic
1190905357 X:54721955-54721977 CAGCTAAAAGGGAAGGAAACTGG - Intergenic
1191731663 X:64342664-64342686 CAATGAAAAGTGCAGGCAACAGG + Intronic
1192617524 X:72643148-72643170 CAGAGAAAAGGGAAGGAGACTGG + Intronic
1192925135 X:75748024-75748046 CCCAGAAAAGGGAAGAAAACTGG - Intergenic
1193306098 X:79953993-79954015 CTGAGCAAAGGGAATGAAACTGG + Intergenic
1193667507 X:84340080-84340102 CAGGGAAAGGGAAAGGAAATGGG + Intronic
1193834838 X:86329419-86329441 CAATGAAAAGGGAGGGGAGCAGG - Intronic
1193915551 X:87357887-87357909 TACTTTAAAGGGAAGGAAACAGG + Intergenic
1194173064 X:90612570-90612592 CAGTGAAAAGGGGAGGAAGTAGG - Intergenic
1194593980 X:95835836-95835858 CAGTGAGAAGATATGGAAACAGG + Intergenic
1195021963 X:100837746-100837768 AAGTAGAAAGGGAAGGAAAAAGG - Intronic
1195059407 X:101179168-101179190 CTGGGAAAAGGGAAGGAATGAGG - Intergenic
1195476860 X:105297053-105297075 CAGGGAAAAGGGATGGAGATTGG + Intronic
1195890252 X:109685660-109685682 CAGTGAAATGAGAAAGAAACTGG + Intronic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1195973943 X:110505098-110505120 AAGGGAAAAGGGAAGGGAAGGGG - Intergenic
1196519557 X:116657119-116657141 CAGAAAAGAGGGAAGGAATCTGG + Intergenic
1196818685 X:119685889-119685911 CAGTCAAAAGAGAGGGAAACAGG - Intronic
1196974823 X:121147838-121147860 AAGGGAAAAAGGAAGGAAAAAGG + Intergenic
1197198535 X:123728213-123728235 CATTTAAAAGAAAAGGAAACAGG + Intronic
1197262036 X:124330361-124330383 TAGTGAAAAAGGAAAGAAAAAGG - Intronic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1199989739 X:152979729-152979751 CAGAGAAAAAGCAAGGAAGCAGG - Intergenic
1200519288 Y:4190293-4190315 CAGTGAAAAGGAGAGGAAGTAGG - Intergenic
1200945465 Y:8830907-8830929 CCATCAAAAGGGAAGGAAAGGGG + Intergenic
1201334397 Y:12864579-12864601 CACAGAAAAGGAAAGGAAAAGGG - Intergenic
1201453008 Y:14136324-14136346 AAGGGAAAAGAGAAGGAAAATGG - Intergenic
1202136500 Y:21670925-21670947 AAGGGAAAAGGGAAGGGAAGGGG - Intergenic
1202342303 Y:23882463-23882485 CTGTGAAAAGTGCAGGATACGGG + Intergenic
1202528466 Y:25787622-25787644 CTGTGAAAAGTGCAGGATACGGG - Intergenic