ID: 969174993

View in Genome Browser
Species Human (GRCh38)
Location 4:5391683-5391705
Sequence GCCTGAAGGCCTTTGGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969174986_969174993 20 Left 969174986 4:5391640-5391662 CCACAGGGTGCAGAGGTCAAGCC 0: 1
1: 0
2: 1
3: 20
4: 209
Right 969174993 4:5391683-5391705 GCCTGAAGGCCTTTGGAATCTGG No data
969174984_969174993 30 Left 969174984 4:5391630-5391652 CCTGGCTGGGCCACAGGGTGCAG 0: 1
1: 0
2: 8
3: 95
4: 1845
Right 969174993 4:5391683-5391705 GCCTGAAGGCCTTTGGAATCTGG No data
969174989_969174993 -1 Left 969174989 4:5391661-5391683 CCTACTGGCCAGATCAGGAAATG 0: 1
1: 0
2: 2
3: 21
4: 287
Right 969174993 4:5391683-5391705 GCCTGAAGGCCTTTGGAATCTGG No data
969174990_969174993 -9 Left 969174990 4:5391669-5391691 CCAGATCAGGAAATGCCTGAAGG 0: 1
1: 0
2: 1
3: 19
4: 163
Right 969174993 4:5391683-5391705 GCCTGAAGGCCTTTGGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969174993 Original CRISPR GCCTGAAGGCCTTTGGAATC TGG Intronic
No off target data available for this crispr