ID: 969175281

View in Genome Browser
Species Human (GRCh38)
Location 4:5394090-5394112
Sequence CCTGCTTTGCAGTCTGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 218}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969175273_969175281 14 Left 969175273 4:5394053-5394075 CCCTGCCAAAAGACACATGCAGA 0: 1
1: 0
2: 1
3: 20
4: 228
Right 969175281 4:5394090-5394112 CCTGCTTTGCAGTCTGTGCATGG 0: 1
1: 0
2: 0
3: 20
4: 218
969175274_969175281 13 Left 969175274 4:5394054-5394076 CCTGCCAAAAGACACATGCAGAA 0: 1
1: 0
2: 5
3: 33
4: 327
Right 969175281 4:5394090-5394112 CCTGCTTTGCAGTCTGTGCATGG 0: 1
1: 0
2: 0
3: 20
4: 218
969175275_969175281 9 Left 969175275 4:5394058-5394080 CCAAAAGACACATGCAGAAACAT 0: 1
1: 0
2: 10
3: 87
4: 947
Right 969175281 4:5394090-5394112 CCTGCTTTGCAGTCTGTGCATGG 0: 1
1: 0
2: 0
3: 20
4: 218
969175272_969175281 15 Left 969175272 4:5394052-5394074 CCCCTGCCAAAAGACACATGCAG 0: 1
1: 0
2: 1
3: 19
4: 195
Right 969175281 4:5394090-5394112 CCTGCTTTGCAGTCTGTGCATGG 0: 1
1: 0
2: 0
3: 20
4: 218
969175271_969175281 16 Left 969175271 4:5394051-5394073 CCCCCTGCCAAAAGACACATGCA 0: 1
1: 0
2: 2
3: 30
4: 323
Right 969175281 4:5394090-5394112 CCTGCTTTGCAGTCTGTGCATGG 0: 1
1: 0
2: 0
3: 20
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969175281 Original CRISPR CCTGCTTTGCAGTCTGTGCA TGG Intronic
900394492 1:2447599-2447621 CCTGCCTTCCAGTCTCTCCAGGG - Intronic
900612968 1:3552182-3552204 CCAGGTTTGCATTCTGTGCCTGG - Intronic
900797877 1:4720289-4720311 TCCGCCTTGCAGTCTGTGTAAGG + Intronic
901081033 1:6584379-6584401 ACTGCTTTGGAGTCCCTGCAAGG + Intronic
903036055 1:20493286-20493308 CCTGCCTTGGAGCCTGTGGAAGG - Intergenic
903134247 1:21298892-21298914 TCTGCTTTGCAGTTTGTGCTTGG - Intronic
903264723 1:22150910-22150932 CCTGCTGGCCAGGCTGTGCAGGG - Intergenic
903812013 1:26039823-26039845 CCAGATATGCAGGCTGTGCAGGG + Exonic
904841090 1:33372412-33372434 CGTGCTGGGCTGTCTGTGCAGGG + Exonic
904959771 1:34323232-34323254 CCTCCTTGGGAGTCTGGGCATGG + Intergenic
905537897 1:38737929-38737951 TCTGCCTTGTAATCTGTGCAGGG - Intergenic
906689745 1:47784775-47784797 CCTGCTTTGCAGGCCGCCCAGGG + Intronic
906855573 1:49300810-49300832 CCTTCTTTGAACTCTGTGCCTGG + Intronic
906941000 1:50255295-50255317 CCTCCTTTGCAGTCTGGGGCTGG + Intergenic
907279919 1:53340616-53340638 CCGGCTCTGCAGTGTGTGTATGG - Intergenic
907320156 1:53596913-53596935 CATGCTTTTCACTCTGTGCTGGG + Intronic
907757039 1:57320550-57320572 CATGCATTGTAGTATGTGCATGG - Intronic
908565211 1:65347349-65347371 ACTGCTTTGCAGTCTTTATACGG + Intronic
910803767 1:91170574-91170596 CCTGCCTTGCCCTCTGAGCAGGG - Intergenic
913233699 1:116762839-116762861 CCTGCTCTCCAGTTTGTCCAGGG - Intronic
916546983 1:165815127-165815149 CCTTCTTTTCAGTCTGGGAAAGG + Intronic
916700783 1:167292444-167292466 GCTGCTTATCAGTCTGTTCAGGG - Intronic
918109295 1:181441722-181441744 CCTGCTTTGCTGGGTTTGCATGG + Intronic
919295864 1:195699078-195699100 CTTGCTTTCCAGCCTGGGCATGG - Intergenic
919807954 1:201391890-201391912 CCTGATTTGCAGACAATGCAGGG - Intronic
921939560 1:220826243-220826265 CCTTCTTTGCAGTCTGTCCCTGG + Intergenic
923103565 1:230836977-230836999 CCTGCTTTGCAGTCTTGGTGCGG - Intergenic
1065313137 10:24435575-24435597 ACTGTCTTGCAGCCTGTGCAAGG + Intronic
1068452901 10:57215193-57215215 TTTGCTTTGCAGTTTGGGCAAGG - Intergenic
1068814286 10:61292253-61292275 CCAGCTCTGCAGTCAGGGCAAGG - Intergenic
1069728528 10:70596563-70596585 ACGGCTGTGCAGGCTGTGCAGGG - Intergenic
1069987298 10:72293151-72293173 CATGCTTAGAAGTCTGTCCAGGG + Intergenic
1070823736 10:79379217-79379239 CCTCCTGTGCAGCCTGTGCCCGG - Intergenic
1071717375 10:88110909-88110931 CCTGCTTTGCTGGCAGTACATGG - Intergenic
1074358695 10:112807910-112807932 CCTTCTTTCCAGGCTGGGCATGG + Intronic
1075041606 10:119112054-119112076 CCGTCTTTACAGTCTGTGAAGGG - Intronic
1075186559 10:120264526-120264548 CATGTTTTGCACTTTGTGCAGGG + Intergenic
1075352750 10:121738992-121739014 CATGCTTGTCAGTCTGTGCCAGG - Intergenic
1076186308 10:128452230-128452252 TCTGCTTTGCACTCTTTGCTAGG + Intergenic
1076482417 10:130793187-130793209 CCTGCACTGCAGACTGTGCAGGG - Intergenic
1077454326 11:2669259-2669281 CTGGCTTTGCTGTCTTTGCAGGG + Intronic
1077731738 11:4738148-4738170 CCTGCTTTGGTATCTGTCCAAGG + Intronic
1080575058 11:33591225-33591247 TCCTCTTTGCAGCCTGTGCAAGG + Exonic
1081995618 11:47361827-47361849 CCTGCTTTGCAGTATGACCATGG + Intronic
1083328305 11:61884969-61884991 CCTGCTTTGGGGGCTGTGGAGGG - Intronic
1083549354 11:63574746-63574768 CCTGGTGTGAAGTCTGTTCAGGG - Exonic
1084367746 11:68713958-68713980 CCTGCTTTGAAGTCAGCACAGGG - Intronic
1084708469 11:70829588-70829610 CCTGCTTCTCAGCCTGTGCAGGG + Intronic
1085834248 11:79935402-79935424 CCTGCTTTGCTATCTCTGAATGG + Intergenic
1089272835 11:117314115-117314137 CATGCTGTGCACACTGTGCATGG - Intronic
1090345695 11:126068469-126068491 CCTATTTTGAAGTCTGTGCAAGG - Intergenic
1091422624 12:356341-356363 CTTGAATTGCAGTCTGTGCTGGG - Intronic
1092763496 12:11830610-11830632 CCAGCTCTGCAGTCTGTGATTGG - Intronic
1093744594 12:22725668-22725690 GATACTTTGCAGTCTGTGCCTGG + Intergenic
1096474274 12:51898555-51898577 CCTCCTTTGCAGCCTCTTCAGGG + Intergenic
1099293895 12:80805920-80805942 CGTGCCTTTCAGTCTGGGCATGG + Intronic
1103193945 12:119025884-119025906 CCTGCTGTGCAGTTTGAGAAAGG + Intronic
1103628192 12:122236854-122236876 CTTGCTCTGAAGTCTGTGTATGG + Intronic
1104032885 12:125078139-125078161 CCTGCTCTGTAGCCTGGGCAGGG - Intronic
1104752444 12:131248291-131248313 TCTGCTTTGAACTCTCTGCAGGG - Intergenic
1104979129 12:132565409-132565431 CCTGGGTGGCAGTGTGTGCATGG - Intronic
1105821880 13:24087300-24087322 AATGCTTTGCAGAGTGTGCAGGG - Intronic
1109529719 13:63625918-63625940 CCTGCCTGGCAGTATGGGCAGGG + Intergenic
1111395648 13:87665600-87665622 CCTGATTTGCATTCTGTTTAGGG - Intergenic
1116558876 14:46350991-46351013 TCTGCTCTGAATTCTGTGCACGG - Intergenic
1118292047 14:64535832-64535854 CCTGCTCTCCAGTATTTGCAAGG - Intergenic
1119275113 14:73348377-73348399 TCTGCTTTAGAGACTGTGCAGGG - Intronic
1122126975 14:99584488-99584510 CCTTCTTTGGTCTCTGTGCAAGG - Intronic
1122554671 14:102571308-102571330 CCTGCTTTGCAGGCTGGGCTGGG + Intergenic
1122918866 14:104871394-104871416 CCTGCATTCCTGTCTGTGCGTGG - Intronic
1124940535 15:34213516-34213538 CTTCCTTTGCAGGCTGTGGAAGG + Intergenic
1125556598 15:40590963-40590985 CCTGCTTTTCCTTCTGTGCTCGG - Intergenic
1127389296 15:58492210-58492232 CCTGCTTTGATGTTTGTGAATGG + Intronic
1127685044 15:61335207-61335229 CCTGTTTCCCAGTCTCTGCAGGG + Intergenic
1129069668 15:72940151-72940173 CATGCTTTGCAGTCTTGGAAGGG + Intergenic
1130433174 15:83869554-83869576 CCTGTTATGCAGTCTGTCCAGGG + Intronic
1132662808 16:1069136-1069158 CCTGCTTTTCAGTGAGTGGAGGG - Intergenic
1133256330 16:4518593-4518615 CCTGCCCTGCAGTCTCTGCTGGG - Intronic
1134055877 16:11169586-11169608 CCTCCTTTGCACACTTTGCATGG + Intronic
1134063262 16:11211519-11211541 CCTGGCTTGCTGTCAGTGCAGGG + Intergenic
1134249889 16:12566856-12566878 GTTGCTTTGCCTTCTGTGCATGG - Intronic
1135608321 16:23842002-23842024 CTTGCTTTGCTGCCTGTGCCTGG + Intronic
1138908485 16:61367533-61367555 CCTGATCTGCAGTCTGAACAGGG - Intergenic
1142250342 16:88989101-88989123 TCTGCTTTGCTGTCTGTCCCTGG - Intergenic
1142499762 17:325736-325758 ACTGCTGTGCAGTCAGTGCCTGG + Intronic
1146080565 17:29776594-29776616 CCTGCATTGTGGTCTTTGCATGG + Intronic
1149076531 17:52602066-52602088 CCTGCTATGCAGCCTGTCCATGG + Intergenic
1149269068 17:54956795-54956817 CCTGCTTTGGAGACTATGCCCGG - Intronic
1150295253 17:64003950-64003972 CCTGCCTTGGAGGCTCTGCAGGG + Exonic
1150492471 17:65583957-65583979 CTTGCTTTGCAGACTGTCAACGG + Intronic
1151980637 17:77506471-77506493 CCTGCTTTGCTGTGTGTGCTTGG + Intergenic
1152419322 17:80183648-80183670 CCTGCTGGGGAGTCTGGGCAAGG + Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1156192820 18:34739424-34739446 CCTGCTTTGCAGACTATTAATGG + Intronic
1156356521 18:36346722-36346744 CCAGCTTTGCAGTGTGGGGATGG - Intronic
1157406463 18:47426025-47426047 CCATCTTTGCAGTCTGTGTGAGG + Intergenic
1157808774 18:50678493-50678515 CCCGCTCTCCAGTCTGTACAGGG - Intronic
1159032260 18:63243565-63243587 CCCACTGTGAAGTCTGTGCAGGG + Intronic
1159349809 18:67258089-67258111 CCTGTTTTGCAGGCTGGGGAGGG + Intergenic
1159966376 18:74598979-74599001 ACAGCTTTGCAGTCTATGCCTGG + Intronic
1160564651 18:79779664-79779686 CGGGCTTTGGAGTCTGTGCAGGG - Intergenic
1160917968 19:1506745-1506767 CCAGCGTTGGGGTCTGTGCAGGG + Exonic
1163036803 19:14574403-14574425 GCAGCTGTGCAGGCTGTGCACGG - Intergenic
1167603950 19:50470221-50470243 CCAACTGTGCAGGCTGTGCACGG + Intronic
1167868970 19:52351658-52351680 CCTGCTCTGCAGCCTGTGTGAGG + Intronic
1168469455 19:56628842-56628864 CCTGGCTTGCAGCCTGTGTAGGG + Intergenic
928663814 2:33530444-33530466 CCTGCAATGCAGCCTGGGCAGGG + Intronic
929744963 2:44647369-44647391 CATTCTTTGCTGTCTGTGCATGG + Intronic
931684449 2:64781533-64781555 CCTGCTTTTCATTCTCTTCAGGG + Intergenic
932779715 2:74552562-74552584 CCTGCTGTGCAGTTCGTGCTTGG - Exonic
934724144 2:96604284-96604306 GCGGCTCTGCAGTGTGTGCAAGG + Exonic
935527461 2:104188321-104188343 CCTGCTTTTCAGTTGGTTCAAGG + Intergenic
936351073 2:111713051-111713073 CCTGCCATGGAGGCTGTGCAGGG + Intergenic
940429140 2:153567479-153567501 CCTGCTTTGCAGGCACAGCATGG + Intergenic
940443264 2:153744964-153744986 CCTGGTTTGCAGGCAGAGCATGG + Intergenic
943571663 2:189581392-189581414 CCTGCTATGCAGTCCGGGGAAGG - Intronic
947193245 2:227533191-227533213 TCTTGTTTGCAGTCTGTTCAGGG + Intronic
947308099 2:228769686-228769708 CATGCCTTGAAGTCTGTGCAAGG + Intergenic
947724627 2:232389035-232389057 CTTTATTGGCAGTCTGTGCAGGG - Intergenic
948343993 2:237279868-237279890 CCAGCTTTGGAGTCCGTACAGGG + Intergenic
948800934 2:240433307-240433329 CCTGCTTTGGTGTCTTTGCCTGG - Intergenic
1171078962 20:22158313-22158335 ACTGCTTTGTAGTCTGCTCAGGG - Intergenic
1171448200 20:25219307-25219329 CCTCCTGTGCTGTCTGTACAAGG - Intronic
1172884513 20:38222318-38222340 CCAGCTTTGCAGTAGTTGCAGGG - Intronic
1175399889 20:58693998-58694020 CGTGCGCTGCAGTCTGAGCAGGG - Intronic
1175547778 20:59789906-59789928 CCTGGCTTGCAGTTTGTGCTGGG + Intronic
1176126420 20:63477368-63477390 CCTGCTTTCCAGTGTCCGCAGGG - Intergenic
1176217345 20:63954485-63954507 CCAGCTTGGAGGTCTGTGCACGG - Intronic
1176284631 21:5012832-5012854 GCTGCTGTGCAGTCCGGGCAGGG + Intergenic
1178176258 21:30103128-30103150 CCTGCTTTCCCATCAGTGCAGGG - Intergenic
1179872550 21:44250643-44250665 GCTGCTGTGCAGTCCGGGCAGGG - Intronic
1180686913 22:17675951-17675973 CCTGCTTTCCACACTGTGAAAGG - Intronic
1182759282 22:32708930-32708952 GCTGCTTTGGGGGCTGTGCACGG + Intronic
1183470086 22:38000570-38000592 GTTCCTCTGCAGTCTGTGCAGGG + Intronic
1183751652 22:39724321-39724343 CCAGCCTTGCAGCCTCTGCAGGG + Intergenic
1183964801 22:41435247-41435269 ACTGGTTTGCAGACTGTGGAAGG - Exonic
1185171582 22:49297590-49297612 GCTGCTTTGCCTTCTCTGCAGGG - Intergenic
1185176760 22:49332062-49332084 CCAGCCATGCAGCCTGTGCACGG + Intergenic
1185193729 22:49454990-49455012 CATGCTGTGGAGTCAGTGCAGGG + Intronic
951599900 3:24362213-24362235 ACAGCTTTGCAGACTGTGAAAGG - Intronic
951966441 3:28391140-28391162 TCTACTTTGCAGTATGTGCTGGG - Intronic
952546445 3:34424908-34424930 CCTGCTTTGCAGTGGCTGAATGG + Intergenic
952827342 3:37535473-37535495 TATGCTTAGCAGTCTGTGAAAGG - Intronic
953694761 3:45148795-45148817 CCTGTTTTACAGCCTTTGCAGGG - Intergenic
954544189 3:51418801-51418823 CCTGCTGTGCATTCTCAGCACGG - Exonic
955688766 3:61569877-61569899 CCTCCTTTGCAATGTGGGCAAGG - Intronic
955990109 3:64617484-64617506 CCTGCTTTGTAGTCTCTCCCTGG + Intronic
960963369 3:123088184-123088206 CCAGCTGTGCAATCTGGGCAAGG + Intronic
961195664 3:124999325-124999347 CCAGCTTTGCAGTGTTTGCCTGG - Intronic
961521480 3:127469640-127469662 CCATCTTTTCAGTGTGTGCAGGG - Intergenic
963274281 3:143314764-143314786 CCAGCTTTGCAGACAGTGCCAGG - Intronic
968291850 3:197545187-197545209 ACTCTTTTGCAGTCTGAGCAAGG - Intronic
968871448 4:3244797-3244819 CCTGCTCTGCTGTCTGTGCCAGG + Intronic
968902835 4:3439354-3439376 CCTACCATGCTGTCTGTGCAGGG + Intronic
969175281 4:5394090-5394112 CCTGCTTTGCAGTCTGTGCATGG + Intronic
969622999 4:8288165-8288187 CCTGCTTTTCAGACTTTTCACGG + Intronic
972539886 4:40030105-40030127 CCTGCTTGCCAGGCTGGGCACGG + Intergenic
981460860 4:145011978-145012000 GCTGCTTTGCAGTTCTTGCAAGG - Intronic
983506260 4:168556928-168556950 CCTGCCTTCTAATCTGTGCAGGG - Intronic
984950261 4:185002758-185002780 TCTGGTTTGCAGTATGTGCCAGG - Intergenic
984957002 4:185054831-185054853 TCTGCTTTTCAGTTTGGGCAGGG - Intergenic
985002665 4:185501120-185501142 CCTACCTTGCAGGCTCTGCATGG - Intronic
985295765 4:188435705-188435727 GCTGCTTTCCAGTCTATGGAAGG - Intergenic
986412497 5:7494447-7494469 TCTACTTTGAAGTCTTTGCATGG + Intronic
987359188 5:17091582-17091604 CCTGCTTTACAGTCGGTCCAGGG - Intronic
989129800 5:38095552-38095574 ACTGCTTAGCAGTCTTGGCAGGG + Intergenic
990759024 5:59108060-59108082 TCTATTTTGCAGTCTGTGCTGGG - Intronic
992231276 5:74666611-74666633 GCTGCTCTGCAGTGTGGGCAGGG - Intronic
992673861 5:79085801-79085823 CCTGGTTTCCTGTCTGTGGAAGG - Intronic
993098940 5:83512488-83512510 CATGTCTTGCAGTGTGTGCACGG + Intronic
995712583 5:115050208-115050230 CCTGCTTTCTTGTCTCTGCAAGG + Intergenic
997447854 5:133954665-133954687 ACTGTTTTGCAGGCTGTGGAGGG - Intergenic
997908064 5:137840252-137840274 CCTGCTTTACAGACTGTCCCTGG - Intergenic
998518941 5:142782465-142782487 GCTGGGTTGCAGTCTGGGCATGG + Intronic
998543353 5:143004400-143004422 CCTGTTTTGGAATCTGTCCAGGG + Intronic
999098010 5:148998599-148998621 CCTGCCTCGCAGTCTGTACTGGG + Intronic
999171206 5:149596850-149596872 CCTGGAGTGCAGTCTGTGAAGGG + Intronic
1001518373 5:172373230-172373252 CCTGCTTCCCAGCCTGTGCCTGG + Intronic
1002206890 5:177569146-177569168 CCTGAGTTGCAGACAGTGCAGGG - Intergenic
1003082182 6:3030064-3030086 CCTGCTTTTGAGTATTTGCATGG - Intergenic
1003749311 6:9039198-9039220 CCTGGTTTGCATTCTCTCCAGGG + Intergenic
1006376445 6:33674099-33674121 GCTGCTGTGCAGCCAGTGCAGGG + Intronic
1006894196 6:37456182-37456204 CCCTCTTTGCAGTATGTGTAGGG + Intronic
1009318504 6:62255486-62255508 CCTGCTCTGCAGCTAGTGCATGG - Intronic
1013851473 6:114521132-114521154 CCTGCTTTGTCGTCTGACCAGGG - Intergenic
1016802783 6:148183441-148183463 CTTGCTTTGCAGTCAGTGTGAGG - Intergenic
1018300808 6:162400795-162400817 CCTGATATGCAGTCTCTTCAAGG - Intronic
1019256894 7:58120-58142 CCTGCTTTGCCTGCTTTGCAAGG + Intergenic
1020212617 7:6167475-6167497 CCTGCTCTGGAGTCTCTGGAGGG - Intronic
1020737594 7:11970585-11970607 CCTGCTTTTCATCCTGTGTATGG - Intergenic
1021592440 7:22278284-22278306 CCTGCATTCCAGTTTCTGCATGG + Intronic
1024667976 7:51564872-51564894 GCTGCCTTGAAGCCTGTGCAGGG + Intergenic
1029734082 7:102455915-102455937 GCTGCTTTACAGACAGTGCACGG + Exonic
1030099419 7:105932411-105932433 CCTCCTCTCCTGTCTGTGCATGG + Intronic
1032479439 7:132234816-132234838 AACTCTTTGCAGTCTGTGCAAGG - Intronic
1033155242 7:138951101-138951123 ACTGCATTCCAGCCTGTGCAAGG - Intronic
1034699475 7:153083838-153083860 CCAGTTCTGCAGGCTGTGCAGGG + Intergenic
1035238424 7:157515106-157515128 CCTGCCCTGCTGTCTGGGCAGGG - Intergenic
1036181584 8:6590412-6590434 CCTGCTTTGCTTTTTGTTCATGG - Intronic
1036957462 8:13203958-13203980 AATGCTATGAAGTCTGTGCATGG - Intronic
1037287274 8:17314798-17314820 CCTGATATGCAGTCGGTGAAGGG + Intronic
1037502245 8:19497189-19497211 CCAGCTTAACTGTCTGTGCAGGG - Intronic
1038641394 8:29331915-29331937 CCTGCTTTGAAGAGTGTTCAGGG + Intergenic
1039847125 8:41333467-41333489 GCTGTTTTGCAGTCACTGCATGG - Intergenic
1040979190 8:53228063-53228085 CCTGCATGGCATTCTGTGAAGGG - Exonic
1043505605 8:80898887-80898909 GCTGCTCTGCACCCTGTGCAGGG + Intergenic
1044803060 8:95976856-95976878 CCTGCCCAGCAGTCTGTGCCAGG + Intergenic
1045062741 8:98423376-98423398 CCCGCTTTGCTCCCTGTGCAGGG - Intronic
1045530132 8:102977005-102977027 CATGTTTTCCAGTCTGGGCAAGG - Intronic
1047154549 8:122302318-122302340 CCTGGGTTTCAGTCTGTTCAAGG + Intergenic
1048738197 8:137525165-137525187 TCAGCTTTTCAGTCTGTTCAGGG - Intergenic
1048875178 8:138831569-138831591 CATGCTTTGCAGGATGAGCAGGG + Intronic
1049377885 8:142297649-142297671 CCATCTTTGCAGCCTGCGCAGGG - Intronic
1049429043 8:142550761-142550783 CCTGCCTTGCAGTGTGCACAGGG + Intergenic
1049466913 8:142755592-142755614 TCTGTTTTGGAGTCTGGGCACGG + Intergenic
1050857757 9:10382801-10382823 TGTGCTTTGCATTTTGTGCAGGG - Intronic
1051696343 9:19771976-19771998 CCTGTTTTGCTGTCTGTACTGGG - Intronic
1052788038 9:32848121-32848143 CCTGCTTTGGAGTGTGTTCAGGG - Intergenic
1053103395 9:35390340-35390362 CCTGCTTTCCAGCCTCTGCCTGG + Intronic
1055799219 9:80014740-80014762 GCTGGTTTGCAGTCTTTGTAAGG + Intergenic
1055928277 9:81532958-81532980 CCTGCCTTGAAATGTGTGCAGGG + Intergenic
1056579565 9:87880923-87880945 CCTGCAGTGAAGTCTGTGGAGGG + Intergenic
1058003180 9:99888326-99888348 CTTGCTTTGTAGTCAGGGCAGGG + Intergenic
1058261824 9:102842921-102842943 ACCGATTTGCAGTCTGTGCATGG + Intergenic
1058468260 9:105250482-105250504 CTTTCTTTGCAGTTTGAGCAGGG - Intronic
1058629780 9:106974569-106974591 CCTTCTATGCAGTCTACGCAAGG - Intronic
1060126605 9:121053682-121053704 CCTGCTGTGCAGCCTGTGGTTGG - Intergenic
1061129966 9:128703132-128703154 ACTGATTTGGAGACTGTGCAAGG - Intronic
1061362435 9:130152173-130152195 CCTGCTTTGCCGTGTGGACAAGG - Intergenic
1061508034 9:131043142-131043164 CCATCTTTGCAGTCTGATCATGG + Intronic
1062194071 9:135263693-135263715 CCTGGTTTGCTGTCTGGCCAGGG + Intergenic
1062345073 9:136110779-136110801 TCTGATTTTCAGTCTGTGCCTGG - Intergenic
1189230561 X:39449401-39449423 CCTGTTTTGCAGTTTGCTCATGG - Intergenic
1193614004 X:83666571-83666593 CCTGCTTTGGACTGAGTGCATGG + Intergenic
1196862476 X:120041085-120041107 CGTGCATTGCAGTCTGTGAATGG - Intergenic
1196880626 X:120195259-120195281 CGTGCATTGCAGTCTGTGAATGG + Intergenic
1199898858 X:152153330-152153352 CTTGCTTTTTAGTATGTGCATGG + Intergenic
1200043883 X:153389260-153389282 CATGCTTTGCAGTGTGTGTTGGG - Intergenic
1202368488 Y:24182567-24182589 CCTTCTGTCCAGTATGTGCATGG - Intergenic