ID: 969177261

View in Genome Browser
Species Human (GRCh38)
Location 4:5408133-5408155
Sequence CAGCCCAAACGGACTGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 1, 2: 9, 3: 69, 4: 260}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969177261 Original CRISPR CAGCCCAAACGGACTGAGAT GGG Intronic
900925680 1:5704867-5704889 CAGCCGAGACGGGCTGAGAAAGG + Intergenic
901197550 1:7448515-7448537 CAGCCCAGACAGACTGGGACAGG - Intronic
903999975 1:27333389-27333411 CAGCCAGAACGGACTAAGATGGG - Intronic
904434769 1:30487242-30487264 CAGCCCAAGCAGACTAAGACAGG + Intergenic
904436753 1:30503958-30503980 CAGCACAAATGGACTGAGACAGG + Intergenic
904797966 1:33071681-33071703 CAGCACAAATGGACTAAGACAGG - Intronic
905902256 1:41589388-41589410 CAGCCCAATAGGAAGGAGATCGG + Intronic
906020149 1:42620941-42620963 AAGCCCAAAAGGACTGGGTTTGG - Intronic
906702947 1:47872878-47872900 CAGCCCCAAAGGACAAAGATAGG - Intronic
906730060 1:48073108-48073130 CAGCACAAATGGACTAAGACAGG + Intergenic
907506991 1:54926487-54926509 TAGCCCAAAGAGACTAAGATAGG + Intergenic
909998977 1:82318998-82319020 CAGCCCAAACAGACTATAATAGG - Intergenic
910897888 1:92086925-92086947 CAGCACAAATGGACTAAGATAGG + Intronic
911240710 1:95462779-95462801 CAGCCCGAATGAACTAAGATAGG - Intergenic
911659594 1:100486419-100486441 CAGCCCAAATGGACTAAGACGGG - Intronic
912872535 1:113322706-113322728 CAGCACAAACGCCCTGAGATGGG - Intergenic
913067462 1:115269711-115269733 CAACCCAAACTGACTAAGACAGG + Intergenic
913547991 1:119888325-119888347 CAGCCCATAAAGACTGAGAAAGG + Intergenic
915902525 1:159856689-159856711 CACCCCACAGGGACTGAGGTTGG - Intronic
916671428 1:167024833-167024855 CAGTACAAATGGACTGAGACAGG + Intergenic
916936591 1:169633985-169634007 CAGCCCATACAGCCTGAAATTGG + Intergenic
917481267 1:175414233-175414255 CAGCCCAAGTGGACTAAGACAGG + Intronic
918025467 1:180740695-180740717 CAGTCCAAAAGGACTGAGATGGG - Intronic
920219017 1:204382390-204382412 CAGCCCACACAGGCTGAGAGTGG - Intergenic
920338446 1:205260173-205260195 CACCCCAACCTGCCTGAGATAGG - Intronic
920793120 1:209111559-209111581 CTGCACAAACAGACTGAGACAGG + Intergenic
921213971 1:212921810-212921832 CAGTCCAAACAGACTAAGACAGG - Intergenic
921655772 1:217735181-217735203 CAGCCCAAACTGACTAAGACCGG - Intronic
922325799 1:224527085-224527107 CAGCCGAAACAGACTAAGACAGG + Intronic
922569759 1:226627315-226627337 CAGTCCAAACAGACTGAGACAGG + Intergenic
924419236 1:243891921-243891943 CAGGCTAAATGGACTGAGAGTGG + Intergenic
1064640847 10:17414493-17414515 CAGCCCAAGCTGACTAAGACAGG - Intronic
1064691263 10:17920723-17920745 CAGCACAAATGGATTGAGATAGG + Intergenic
1064829841 10:19450662-19450684 CAGCCCAAACAGACTAAGATAGG - Intronic
1064939993 10:20723447-20723469 CAGCCCAAGCTGACTAAGACAGG + Intergenic
1065779472 10:29153567-29153589 CAGCCCAAACAAACTAAGACAGG - Intergenic
1068524762 10:58115913-58115935 CAGCCTGAACAGACTGAGACAGG - Intergenic
1068663651 10:59649414-59649436 CTGGCCACAGGGACTGAGATAGG + Intergenic
1069096668 10:64267548-64267570 CAGCCTGAATGGACTGAGACAGG + Intergenic
1069338018 10:67376157-67376179 CAGACCAAATGGACTAAGACAGG + Intronic
1069556894 10:69404433-69404455 CAACACAAATGGACTGAGATAGG - Intronic
1070976565 10:80610095-80610117 AAGCACAAAAGGTCTGAGATGGG - Intronic
1071177214 10:82940546-82940568 CAGCCCAGATGGACTAAGAAAGG - Intronic
1071957075 10:90770888-90770910 AGTCCCACACGGACTGAGATGGG + Intronic
1072362595 10:94674404-94674426 TAGCCCAAATGGACTAAGACAGG + Intergenic
1072597874 10:96892370-96892392 CAGCCCAAGTGGACTAAGAAAGG - Intronic
1073076870 10:100829750-100829772 CAGCCCCACAGGACTGGGATGGG - Exonic
1073806775 10:107107045-107107067 TAGCCCAAACAGACTAAGACAGG + Intronic
1074333131 10:112540338-112540360 AAGTCCAAAGGGACTGAGGTAGG - Intronic
1074600402 10:114908041-114908063 CAGCCCAAACAGACTAAGGCAGG - Intergenic
1075003514 10:118814677-118814699 CAGCCCAAACAGACTAAAACAGG - Intergenic
1075183361 10:120232435-120232457 CAGCACAAATGGACTGAGACAGG + Intergenic
1077483529 11:2827719-2827741 CAGACCAGAAGGACTCAGATAGG + Intronic
1077805436 11:5587373-5587395 CAGCCCAAATGGACTGAGATAGG - Intronic
1078498995 11:11850704-11850726 CAGCCCAAATGGACTAAGACTGG - Intronic
1079599621 11:22295145-22295167 AAGCCCAAACAGAGTGAGGTTGG + Intergenic
1080723532 11:34872410-34872432 AAGCCCAAAAGGACAGAGTTTGG + Intronic
1080824018 11:35832767-35832789 TAGCCCAAATGGACTAAGACAGG + Intergenic
1081046075 11:38274955-38274977 TAGCCCAAACAGACTCAGACAGG + Intergenic
1081638098 11:44734273-44734295 CAACACACACGGACTAAGATGGG + Intronic
1084126264 11:67101046-67101068 CAGCACAAAGGGACTGAGGCAGG - Intergenic
1086071859 11:82808405-82808427 CAGCCCAAACAGATTAAGACAGG + Intergenic
1086219231 11:84421283-84421305 CAGCCCAAACTGATTAAGACAGG + Intronic
1086263531 11:84970405-84970427 CAGCCCAAATGGACTAAGACAGG - Intronic
1086606662 11:88703889-88703911 CAGCCCAAACTGACTAAGATAGG - Intronic
1087226177 11:95601981-95602003 CAGCCCAAATGGACCAAGACAGG - Intergenic
1087739198 11:101868528-101868550 CAGCCCAAATGGAGTAAGAGAGG - Intronic
1088353124 11:108912032-108912054 CAGCCCAAAGTGACTGAGACAGG - Intronic
1088758394 11:112906523-112906545 CAGCACAAATGGACTAAGAAAGG + Intergenic
1090738327 11:129632497-129632519 CAGCTTAAATGGACTAAGATGGG - Intergenic
1092604024 12:10099687-10099709 CAGCACAAACAGACTAAGATGGG - Intronic
1092779715 12:11974339-11974361 CAGCCCAAGCTGACTGACACAGG - Intergenic
1093747257 12:22755948-22755970 AAGCCCAAACAGACTAAGACAGG + Intergenic
1095728847 12:45482682-45482704 CAACACAAATGGACTAAGATAGG + Intergenic
1098031549 12:66259835-66259857 AAGCACAAACGTCCTGAGATGGG - Intergenic
1098724043 12:73939570-73939592 CAGCAAGAATGGACTGAGATAGG + Intergenic
1100379264 12:94046523-94046545 CAGCAGAAACGAACTGAGACAGG - Intergenic
1100866769 12:98865805-98865827 CAGCCCAAATGGATTAAGACAGG - Intronic
1101255248 12:102970936-102970958 CAGCACAAACGGAAAGAGACTGG - Intergenic
1101722479 12:107362124-107362146 CAACCCAAACAGACTAAGAGTGG + Intronic
1105454701 13:20529346-20529368 CAGCCTGAACTGACTGAGAAAGG + Intergenic
1105610389 13:21964061-21964083 CAGCCCAAACTGACTAACGTGGG + Intergenic
1105968063 13:25402781-25402803 CAGCCCAACCAGACTAAGACAGG - Intronic
1106307436 13:28525855-28525877 AAGCCCAAGCGGACTAAGACAGG + Intergenic
1106633439 13:31501651-31501673 CAGCACAAATGGACTAAGACAGG + Intergenic
1106820355 13:33457548-33457570 CAGCCCGAATGGACTAAGACAGG - Intergenic
1109043955 13:57382722-57382744 AAGCCCAAACTGACTAAGACAGG + Intergenic
1109428248 13:62197344-62197366 CAGCACAAAGGGACTAAGACAGG - Intergenic
1110187391 13:72691485-72691507 CAGCACAAATAGACTAAGATAGG - Intergenic
1110495949 13:76168114-76168136 CAGCCCAAGCCGACTTAGATAGG - Intergenic
1112034421 13:95484147-95484169 CAGCCCAAAAGGACAAAGATAGG + Intronic
1114838541 14:26234063-26234085 CAGCCCAAAAAGACTAAGACAGG - Intergenic
1116615050 14:47124964-47124986 CAGCCCAAGCTGACTAACATAGG + Intronic
1116929476 14:50675562-50675584 CAGAACAAAAAGACTGAGATGGG + Intergenic
1117968845 14:61232680-61232702 AAGCCCAAAAGGACTGGGTTGGG - Intronic
1118148075 14:63162275-63162297 CAGCCCAAACAAACTAAGACAGG + Intergenic
1119735434 14:76978405-76978427 CAGCCCAAATGAACTAAGACCGG - Intergenic
1119866317 14:77978161-77978183 CAGCCGGAATGGACTGAGATAGG - Intergenic
1119894695 14:78210094-78210116 CAGCCTGAACGGACTAAGACAGG - Intergenic
1120287331 14:82520532-82520554 AAGCCCAAACAAACTAAGATAGG + Intergenic
1121013676 14:90535702-90535724 CAGCCCAAGCTGACTAAGGTGGG - Exonic
1121499291 14:94420769-94420791 CAGCCAAAACATACTGAGACAGG + Intergenic
1121851937 14:97229270-97229292 CAGCCAGAACAGACTGAGACAGG - Intergenic
1122040000 14:98980439-98980461 CAGCCCAAATGAACTAAGACAGG + Intergenic
1122998381 14:105277698-105277720 CAGCCCAAAAGGACTAAAATGGG + Intronic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1124581572 15:30960279-30960301 CAGCCCAGCCAGCCTGAGATGGG + Intronic
1125024202 15:35014066-35014088 CAGCCCAAACCAGCTAAGATGGG + Intergenic
1126252097 15:46579429-46579451 CTGCCCAAACAGACTGGTATGGG - Intergenic
1126323229 15:47447441-47447463 AAACCCAAAAGGACTGGGATTGG + Intronic
1127417312 15:58770692-58770714 CAGCCAAAACCGACAGAGACTGG + Intergenic
1128946179 15:71823242-71823264 CAGCCCACAGGCACTGAGGTGGG + Exonic
1129946552 15:79543521-79543543 CAGCCCAAGCAGACTAAGGTAGG - Intergenic
1130162690 15:81417367-81417389 CAGCCTAAAATTACTGAGATGGG - Intergenic
1131393412 15:92067749-92067771 GAGCCCAAAAGGACTAACATAGG - Intronic
1131496929 15:92920431-92920453 CAGTTCAAAGGGAATGAGATGGG + Intronic
1132670695 16:1101132-1101154 CAGCCCAGACGGACAGTGAGGGG + Intergenic
1133436546 16:5784962-5784984 CAGCCCAAACAGACTAAGACAGG + Intergenic
1135413588 16:22252597-22252619 CAGACCACAGGGACTGAGACTGG + Intronic
1135490568 16:22905897-22905919 CACCCCAAACCCACTGAAATTGG + Intronic
1136098196 16:27974020-27974042 CAGCTCAAAGGGAATCAGATGGG - Intronic
1138140588 16:54564985-54565007 CAGCCCAAAGAGACAGAGAGTGG + Intergenic
1138182991 16:54955447-54955469 CAGTACAAAGGGACTGAGGTGGG + Intergenic
1141943045 16:87291014-87291036 GAGCCCAAACGGGCAGAAATGGG + Intronic
1143271295 17:5677123-5677145 AAGCCCATACAGACTGAGACAGG + Intergenic
1143679133 17:8463209-8463231 CAGCCCAAAAGAACTCAGAGTGG - Intronic
1144002703 17:11070638-11070660 CAGTCCAAAAGGACTAAGACAGG - Intergenic
1146945845 17:36872926-36872948 CAGCCCAAATTGACTAAGACGGG + Intergenic
1147442643 17:40456815-40456837 CAGCCCAAGAGGACTGAGACTGG + Exonic
1148325821 17:46782935-46782957 GAGCCCAAAGGGACTCAGGTGGG + Intronic
1148985803 17:51620100-51620122 CAGCCAAAATGGACTAAGACAGG - Intergenic
1149311201 17:55395686-55395708 CAATCCAAATGGACTGACATTGG + Intronic
1149584941 17:57780150-57780172 CAGCCCAAACAGACTAAGACAGG + Intergenic
1155668067 18:28335628-28335650 CAGCCTAAGCTGACTAAGATGGG + Intergenic
1155913430 18:31532089-31532111 CAGCTCAAATGGACTAAGACAGG - Intronic
1157331805 18:46709453-46709475 CAGCCCAAAAGAACTAAGATAGG + Intronic
1157547295 18:48555469-48555491 CTGCCCAAAGTGACTGTGATGGG + Intronic
1157797351 18:50587446-50587468 CAGCCCAAATGGAGTAAGACAGG + Intronic
1157966169 18:52210843-52210865 CAGCCCAAACTGACTAAGACAGG + Intergenic
1158149807 18:54355699-54355721 CAGCCCAAAAGGACTGAGACAGG + Intronic
1158982161 18:62773736-62773758 CAGCCTAAACGAACTAAGACAGG - Intronic
1160053786 18:75460989-75461011 CAGCCCAAATGGACTAAGACAGG - Intergenic
1160486322 18:79296315-79296337 CAGCCCAGAAGGAGTGAGACAGG + Intronic
1161748302 19:6075210-6075232 CAGCCCAAACAGATTAAGACAGG + Intronic
1163216822 19:15885288-15885310 CAGCCCACATGGGCAGAGATGGG - Intronic
1165119714 19:33551299-33551321 CAGCCCACACAGACTAAGACAGG - Intergenic
1165521316 19:36316524-36316546 CAACACAAACGGACTAAGAGAGG - Intergenic
1165622745 19:37262064-37262086 CAACACAAACGGACTAAGAGAGG + Intergenic
1167600997 19:50454799-50454821 AAGACCAAAGGGATTGAGATGGG - Intronic
925265794 2:2565597-2565619 CAGCCCCAGCTGACTGAGACAGG + Intergenic
925504304 2:4543732-4543754 CTGCCCAAATGGACTGAGACAGG - Intergenic
925748484 2:7065495-7065517 CTGCCAAAACTGGCTGAGATTGG + Intronic
925853973 2:8111604-8111626 CAGTCCAAGCAGACTAAGATAGG - Intergenic
926627774 2:15107429-15107451 CAGCCCAAGCTGACTAAGACAGG + Intergenic
927203844 2:20594662-20594684 CAGCCTGAATGGATTGAGATAGG - Intronic
928044680 2:27917341-27917363 CAACCCAAACTGACTAAGACAGG - Intronic
929139535 2:38654882-38654904 CAGTACAAACGGACTAAGATAGG - Intergenic
929769310 2:44878660-44878682 CAGCCCAGACTGCCTGTGATGGG - Intergenic
930886455 2:56332270-56332292 CAGCCCAAAAGGACTATGAAGGG - Intronic
931007890 2:57873239-57873261 CAGCCCAAAAAGACTAAGACAGG + Intergenic
933057445 2:77689826-77689848 CAACACAAATGGACTAAGATAGG + Intergenic
933165930 2:79074672-79074694 CAGCACAAATGGACTAAGACTGG + Intergenic
933927585 2:87111016-87111038 CAACACAAATGGACTAAGATAGG + Intergenic
935920138 2:108003780-108003802 CAGCCCAAACTGACTAAAGTAGG - Intronic
936346051 2:111676046-111676068 AAGCCCAAATGGATTGAGACAGG + Intergenic
936391441 2:112078186-112078208 CAGCACAAACAGACTAAGATAGG - Intronic
938198805 2:129356281-129356303 CAGCCCAGGTTGACTGAGATGGG - Intergenic
941711062 2:168713934-168713956 CAGCCCAAATGGATTAAGACGGG - Intronic
942336494 2:174892568-174892590 CAGCACAAACAGACTAAGACAGG + Intronic
943513389 2:188854412-188854434 CAGCCTAAGTGGACTAAGATTGG + Intergenic
945199851 2:207270635-207270657 CAGCCCAAGCTGACTAAGACAGG + Intergenic
945239433 2:207662586-207662608 CAGCAGAAACAGACTAAGATGGG + Intergenic
945366931 2:208965917-208965939 CAACCCCAACAGACTGAGAGAGG - Intergenic
945904999 2:215582498-215582520 CAGCCCAAACGGACTAAGACAGG - Intergenic
946858712 2:223979124-223979146 CAGCCCAGGCGGACTAAGACAGG + Intronic
947083799 2:226428121-226428143 CAGCCCAGACTGACTCACATAGG - Intergenic
948326256 2:237124163-237124185 CAGCACAAATGGACTAGGATAGG + Intergenic
948348524 2:237319481-237319503 GTGCCCAAACAGACTGAGGTGGG - Intergenic
948396162 2:237646872-237646894 CAGCCTAAGCAGACTGAGACAGG + Intronic
948516355 2:238506119-238506141 CAGCCAGAACGGACTAAGATAGG - Intergenic
948523195 2:238554482-238554504 TAGCCCAAATGGACCAAGATAGG - Intergenic
1169713361 20:8589378-8589400 CAGCCCAAACAGATTAAGACAGG - Intronic
1170435913 20:16328633-16328655 CAGCCCGAACGGACTAAGTCAGG - Intronic
1174438116 20:50526482-50526504 CTGCCCAAATGCACTGACATGGG - Intronic
1175427688 20:58879603-58879625 CAGCCCAAATGCACTCAGAGGGG + Intronic
1178711917 21:34924720-34924742 CAGCCCAAGCTGATTGAGACAGG - Intronic
1178969732 21:37162723-37162745 CAGCCCAAACTGACTAAGACAGG - Intronic
1181044709 22:20209108-20209130 TGGCCCAAGCGGACTGAGTTGGG + Intergenic
1181615435 22:24051177-24051199 CAGCAAAAAGGGACTGAGACTGG - Intronic
1182782077 22:32876034-32876056 CAGCCCAAACAGACTAAGTCAGG - Intronic
1183706371 22:39477173-39477195 CAGCCCAAAGGGATTGGAATGGG + Intronic
1184098829 22:42330942-42330964 CAGCCCCAGGGGAATGAGATGGG - Intronic
1184363255 22:44031268-44031290 CAGCCCAAGAGGAAAGAGATAGG - Intronic
949196656 3:1317828-1317850 CAGCCCAACTGAAATGAGATGGG + Intronic
949373203 3:3357787-3357809 CAAGCCAAACGGAGTAAGATTGG - Intergenic
949451157 3:4186590-4186612 CAGCACAAATGAACTGAGATTGG - Intronic
951690504 3:25390486-25390508 CAGCCCAAATGGACTAAGACTGG + Intronic
951706593 3:25550288-25550310 CAGCCCAAACAGACTAAGGCAGG - Intronic
952411551 3:33054255-33054277 CAGCCCACACTGACTAAGACAGG + Intronic
953364903 3:42335979-42336001 AAGCCCAAAAGGACAGAGTTTGG + Intergenic
954970698 3:54649446-54649468 CAGCGCAAGCTGACTGAGATAGG - Intronic
955040094 3:55308062-55308084 CAGCCTGAACAGACTAAGATAGG - Intergenic
955166931 3:56524070-56524092 CAGCCCAAACTGATTAAGACGGG + Intergenic
957183771 3:76915767-76915789 CAGCCCAAACTTACTTAGACAGG - Intronic
958069922 3:88597061-88597083 CAGCACAAACAGACTAATATAGG + Intergenic
958445996 3:94215824-94215846 CAGCACAAACAGACTAAGACAGG - Intergenic
959436965 3:106327406-106327428 CAGCCCACACTGACTAAGACAGG + Intergenic
959995817 3:112679201-112679223 CAGCCCCAAAAGACTAAGATAGG - Intergenic
960008402 3:112805860-112805882 CAGCCCAAACAGACTAAGACAGG + Intronic
961488680 3:127235607-127235629 CAGCCCAAATGGACTAAGATGGG - Intergenic
963262617 3:143208034-143208056 CAACCCATACGGACTAAGACAGG - Intergenic
963627596 3:147692720-147692742 CAGTCCAAAAGGACTAAGACAGG - Intergenic
963665656 3:148182697-148182719 TAGCCCAAATGGACTAAGACAGG - Intergenic
964093969 3:152910216-152910238 CAGTGCAAATGGACTGAGGTGGG - Intergenic
965933859 3:174081274-174081296 CAGCCTAAATGGACTAAGAAAGG - Intronic
967437669 3:189468546-189468568 TAGACCAAACTGACTAAGATAGG - Intergenic
968290419 3:197534863-197534885 CAGCCCAAACAGACTAAGACAGG - Intronic
969081347 4:4620999-4621021 CAGCCCACATGGACTAAGACAGG - Intergenic
969177261 4:5408133-5408155 CAGCCCAAACGGACTGAGATGGG + Intronic
971376554 4:26060250-26060272 CAGCCAGAACCGACTGAGACAGG + Intergenic
971749844 4:30633044-30633066 CAGCCCAAACTGACTCAGATAGG - Intergenic
972009237 4:34155435-34155457 CAGCCAAAATGGACTAAGATAGG - Intergenic
972018153 4:34272545-34272567 CAGCCCAAACTGACTAAGAGAGG - Intergenic
972110308 4:35549922-35549944 CTGCACAAAGAGACTGAGATAGG - Intergenic
972844791 4:42974603-42974625 CAGCCCAGAGGGACTGAAACCGG - Intronic
973576378 4:52293992-52294014 CAGCCCAAATGGACTAAGACTGG - Intergenic
973907834 4:55548164-55548186 CAGACCATATGGACTGAGAGTGG - Intergenic
974747709 4:66097952-66097974 CAGCCCAAACTGACTGAGGCAGG - Intergenic
975745330 4:77469623-77469645 CAGCCTAAACAGACTAAGATAGG + Intergenic
976118447 4:81753898-81753920 CAGCACAAACAGACTAAGAAAGG - Intronic
976702019 4:87980172-87980194 CAGCCCAAATGGCCTGAGTGTGG - Intronic
979631971 4:122913128-122913150 CAGCCCAAATGGACTAAGACAGG - Intronic
980379943 4:132000667-132000689 CAGCTCAAACGGACTAAGACAGG + Intergenic
981008841 4:139903724-139903746 CAGCACAAACAGACTAAGATTGG - Intronic
981034018 4:140152282-140152304 CAGCCCAAAGGGGGTGAGCTGGG + Intronic
981899395 4:149844254-149844276 CACCCCAAAGTGACTGAGATTGG - Intergenic
982508316 4:156248840-156248862 CAGCCCAAATGGACTAAGACAGG - Intergenic
982617488 4:157658699-157658721 CAGACCAAAAGGACTAAGACAGG - Intergenic
983589024 4:169386954-169386976 CAGCCCAAGCCGACTAATATAGG + Intergenic
984578907 4:181487327-181487349 CAGCCCAAACGCACTAATACAGG - Intergenic
984714123 4:182911016-182911038 CAGCCCCAAGGGACTGTGACAGG - Intronic
985562472 5:596411-596433 CAGCCCTAACCAACTGAGATGGG - Intergenic
986230867 5:5863929-5863951 CAGCCCAAACAGACTAAGACAGG + Intergenic
986488264 5:8262503-8262525 AAGCCCAAATGGACTAAAATAGG + Intergenic
988524068 5:31971108-31971130 CAGCACAAATGGACTGAGACAGG - Intronic
990428037 5:55708088-55708110 CAGCACCAAGAGACTGAGATAGG + Intronic
990716139 5:58639330-58639352 CAGCCCAAGCTGACTAAGACAGG - Intronic
991403515 5:66278612-66278634 CAGCCCGAATGGACTAACATGGG - Intergenic
992705705 5:79389776-79389798 CAGCACAAAAGGACTAAGACAGG + Intronic
993107266 5:83613369-83613391 CAGCCCAAACAGACAAAGACAGG + Intergenic
993297522 5:86161458-86161480 CAGCCCAAACTGACTAAGACAGG - Intergenic
993752564 5:91689370-91689392 CAACACAAATGAACTGAGATGGG - Intergenic
994518389 5:100798453-100798475 CAGCCCAAATGGACTAACAGGGG - Intergenic
994577489 5:101597014-101597036 CAGCCCAAAAGGACTAAGAAGGG + Intergenic
996692114 5:126351617-126351639 CAGCACAAATGGACTAAGACAGG - Intergenic
1000111420 5:158111669-158111691 CTGCCCACATGGACTGAGAAGGG - Intergenic
1000293755 5:159895132-159895154 CAGCCCACACGCTCTGAGAAAGG + Intergenic
1001847155 5:174932468-174932490 CAGCAAAAACAGACTAAGATGGG - Intergenic
1005144438 6:22671838-22671860 GAGCACAAAAGGACTGAGCTTGG - Intergenic
1005514579 6:26541360-26541382 CAGCCCTAGCGGACTAACATAGG - Intronic
1005560295 6:27033487-27033509 CAGCACAAAGGGGCTGAGACTGG + Intergenic
1007265106 6:40589863-40589885 AAGCCCACAAGGACTGAGTTAGG + Intergenic
1007411404 6:41664205-41664227 CAGCCCAAGTGGACTAAGATGGG + Intergenic
1007814877 6:44514691-44514713 CAGCACAAATGGACTAAGACAGG + Intergenic
1008513784 6:52300616-52300638 CAGCACAAACAGACTAAGACAGG - Intergenic
1010081673 6:71871047-71871069 CAGCTCAAACAGACTAAGACAGG + Intergenic
1010773182 6:79856460-79856482 CAGCCCAAGCTGACTAAGAAGGG - Intergenic
1011171684 6:84511572-84511594 CAGCCCAAATGAACTAAGACAGG + Intergenic
1011369905 6:86625365-86625387 TAGGCCAAAAGGACTGAGACAGG - Intergenic
1011890308 6:92151063-92151085 CACCCCAAACATACTGAGAAGGG - Intergenic
1012768579 6:103400043-103400065 GAGCCCAAACAGACTAGGATAGG - Intergenic
1014575098 6:123059659-123059681 CAGCCAAAACTGACTGGTATGGG + Intronic
1016682984 6:146852001-146852023 CCGCCCAAGCTGACTAAGATGGG - Intergenic
1017023923 6:150165111-150165133 CAGCCCAAACTGACTAAGACAGG + Intronic
1017455472 6:154597462-154597484 CAACACAAACGGACTAAGACAGG + Intergenic
1018223344 6:161604120-161604142 CAGCCCAGATGGACTAAGACAGG + Intronic
1018234919 6:161714588-161714610 CAGCACAAACAGACTAAGACAGG + Intronic
1021863677 7:24932770-24932792 CAGCCCAAATGGACTAAGACAGG + Intronic
1021937254 7:25643414-25643436 CAGCCCATAAGATCTGAGATGGG - Intergenic
1023019839 7:36001505-36001527 TAGCCCAAACAGACTAAAATTGG + Intergenic
1023340088 7:39210864-39210886 CAGCCCAAACAGACTAAGGCAGG - Intronic
1024250685 7:47503699-47503721 CAGCCCACATGGACTTAGATAGG - Intronic
1024550181 7:50556168-50556190 TAGCCCAAAGGGACTAAGATAGG - Intronic
1025287862 7:57683118-57683140 CAGTCCAAATGGACTCAGACAGG - Intergenic
1026965715 7:74438585-74438607 CAGCACAAACAGAGTGAGACAGG - Intergenic
1027388456 7:77681522-77681544 CAGCCCAAACTGACTGAAGATGG - Intergenic
1028766790 7:94568971-94568993 CAGCCCAAATGGACTAAGAGGGG + Intergenic
1028879216 7:95860608-95860630 CAGCACAAATGGACTAAGAAAGG - Intronic
1031114481 7:117653298-117653320 CAGCCTAAATGGACCAAGATAGG - Intronic
1035639978 8:1177612-1177634 CTGCCCAAATGGACTAAGACAGG - Intergenic
1035891879 8:3353951-3353973 CAGGCCAAGCAGACTGAGACAGG - Intronic
1036060495 8:5313004-5313026 AGGCCCAAATGGAGTGAGATGGG - Intergenic
1036439192 8:8765299-8765321 CAGCCTGAATGGACTGAGACAGG - Intergenic
1036678621 8:10854304-10854326 CAGCCCAGACGGGCTAAGACAGG + Intergenic
1037778363 8:21850420-21850442 CAGCCCTAACGGAATTAGACAGG + Intergenic
1038984404 8:32792949-32792971 CAGCCTGAATGGACTAAGATAGG - Intergenic
1040513630 8:48117050-48117072 CAGACCATAGGGACTGAGGTGGG + Intergenic
1040525633 8:48222100-48222122 CAACACAAATGGACTGAGACAGG - Intergenic
1041740540 8:61152355-61152377 CAGTACAAACGGGCTGAGACAGG - Intronic
1041793848 8:61725646-61725668 CAGAATAAACAGACTGAGATAGG - Intergenic
1042668331 8:71232294-71232316 CAGTCCAAGCGGCCTGAGAAGGG + Intronic
1044147267 8:88732637-88732659 AAGCCCAAACTGACTAAGACAGG + Intergenic
1044897349 8:96906506-96906528 CAGCACAAATGGACTAAGACAGG - Intronic
1046040493 8:108897551-108897573 CAGCCTAAATGGACTAAGTTTGG - Intergenic
1046842566 8:118876135-118876157 CAGCCCAAACAGACTAAGACAGG + Intergenic
1047053300 8:121137527-121137549 CATCTCAAACAGACTGAGAGAGG + Intergenic
1051461294 9:17319292-17319314 CAGCCCAGACGTACTGAATTAGG - Intronic
1052216321 9:25970686-25970708 CAGCCCAAACGTACTAAGACAGG + Intergenic
1055376701 9:75656184-75656206 CAGCACAAATGGACTAAGACAGG + Intergenic
1055753899 9:79536484-79536506 CAGCCCAAACAGACTAAGATAGG + Intergenic
1057706305 9:97397510-97397532 CAGCCCTAACTGACTCAGACAGG - Intergenic
1058230072 9:102414949-102414971 CAGCCCAAACAGACTAAAACAGG - Intergenic
1058457667 9:105152836-105152858 CAGCCCAAACAGACTAAGACAGG + Intergenic
1058746909 9:108000611-108000633 CAGCCCAAACTGACTAAGACAGG - Intergenic
1060841717 9:126798880-126798902 CAGCACAAACAGACTGAGAGAGG - Intergenic
1061089275 9:128417745-128417767 CAGCCCAAACGGACTAAGACAGG - Intronic
1061752916 9:132793069-132793091 CAGCCCAAATGGACTAAGACAGG - Intronic
1062154534 9:135039320-135039342 CAGCACAAACGGACTAAGGTAGG + Intergenic
1062267474 9:135693899-135693921 CAGGGCAGACGGACTGAGGTGGG - Intronic
1062688057 9:137826479-137826501 CAGCCTCAACGGACTGAGACAGG - Intronic
1185876302 X:3705073-3705095 CAGCCGAAATGGATTTAGATGGG - Intronic
1185936472 X:4262441-4262463 AAACCCAAAAGGACTGAGTTTGG - Intergenic
1186545910 X:10449387-10449409 CAGTCCAAATGGTCTGGGATAGG + Exonic
1187789312 X:22932151-22932173 CAGTCTAAACGGACAAAGATAGG - Intergenic
1188235765 X:27729476-27729498 CAGGCCAAATGGACTAAGATGGG - Intronic
1189526437 X:41827272-41827294 CAGCCCAAACAGACTAAGACAGG - Intronic
1190124633 X:47693001-47693023 CAGCCCAAACAGACTAAGGCAGG - Intergenic
1190434508 X:50410062-50410084 CAGCCCAAACTGACTAAGACAGG + Intronic
1190762363 X:53447187-53447209 CAGCCCAAATAGACTAAGACAGG + Intergenic
1191679995 X:63831161-63831183 CAGGCCTAAAGGACTGTGATAGG - Intergenic
1192840345 X:74849040-74849062 CAGCCCAAACTGATGGAGAGAGG + Intronic
1194174440 X:90629194-90629216 CAGCTCAAACGTGCTGAGTTAGG + Intergenic
1197705584 X:129632369-129632391 CAGCACAAACAGACTAAGACAGG + Intergenic
1197848128 X:130826274-130826296 CAGTCCAAACAGACAGAGTTGGG + Intronic
1198464183 X:136889913-136889935 CAGCCTGAACGGACTGAGAGAGG + Intergenic
1198671796 X:139089087-139089109 CAGCCCAAATGGACTAAGACAGG + Intronic
1198951108 X:142073495-142073517 CAGACCAAAAAGACTAAGATAGG - Intergenic
1199736082 X:150687966-150687988 CAGCACAAACAGACTAAGACAGG + Intergenic
1200520657 Y:4206887-4206909 CAGCTCAAACGTGCTGAGTTAGG + Intergenic
1200789061 Y:7283634-7283656 CAGCCCAAATGGATTTAGATGGG + Intergenic