ID: 969177512

View in Genome Browser
Species Human (GRCh38)
Location 4:5410103-5410125
Sequence TGGCTGCCACTGTTCAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969177512_969177514 -1 Left 969177512 4:5410103-5410125 CCTGTGTTGAACAGTGGCAGCCA 0: 1
1: 0
2: 2
3: 4
4: 120
Right 969177514 4:5410125-5410147 AATGTTACAATCAGCGCCCACGG 0: 1
1: 0
2: 0
3: 4
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969177512 Original CRISPR TGGCTGCCACTGTTCAACAC AGG (reversed) Intronic
904834344 1:33325059-33325081 TGGCTGCCAGAGGTGAACACTGG - Intronic
906046199 1:42832834-42832856 CAGCTGCCCCTGTTCATCACAGG + Intronic
906779181 1:48557167-48557189 TGCCAGACACTGTTAAACACAGG - Intronic
910182928 1:84505744-84505766 TGTCGGCCACGGTTCAACCCAGG + Intronic
914193489 1:145431241-145431263 CGGCTGCCACGGTTCCACGCTGG + Intergenic
914474818 1:148014131-148014153 CGGCTGCCACGGTTCCACGCTGG + Intergenic
914765335 1:150632394-150632416 TTGCTACCACTGTTCAATATTGG - Intergenic
916850348 1:168696840-168696862 TGGAGGCCTCTGTTCATCACTGG + Intronic
917350758 1:174075326-174075348 TGGCTGCCAAGTCTCAACACGGG - Intergenic
924110684 1:240696542-240696564 TTGCTGGCACTGTTCCACTCAGG - Intergenic
1063560955 10:7127147-7127169 TGACAGCCACTTTTCATCACAGG + Intergenic
1066164581 10:32772665-32772687 TGGCTGCCCTTGGTCCACACTGG + Intronic
1070278509 10:75030822-75030844 TGGTAGCCACTGTTCATCATTGG - Exonic
1070949526 10:80419700-80419722 TGATGGCCACTGTTAAACACTGG - Intronic
1072446221 10:95501053-95501075 TTGCTGCCACTGTGCAGAACTGG - Intronic
1076445910 10:130513620-130513642 TGGCTGCCACGGATCAGAACTGG + Intergenic
1076798285 10:132809240-132809262 TGACTGTCACTGTTCAAAAGGGG - Intronic
1076923592 10:133468508-133468530 TGGCTGCCTCTCTTCAACACTGG - Intergenic
1084359769 11:68661751-68661773 GGGCTGCCACTGTGCCACCCGGG - Intergenic
1085285513 11:75357488-75357510 TAGCTGCCACTGCTGAACAATGG + Intergenic
1090420481 11:126571951-126571973 TGGCAGCCCCTGTTCCTCACAGG - Intronic
1095817159 12:46436734-46436756 TGGCAGCCACTAGTCATCACAGG - Intergenic
1095818243 12:46448632-46448654 TGGCAGCCACTAGTCATCACAGG + Intergenic
1100179424 12:92069258-92069280 TGGCAGACACTGTTCTAAACAGG + Intronic
1107680823 13:42848241-42848263 TAGCTGCCTCTGATCAACATTGG - Intergenic
1112322150 13:98417517-98417539 TGGCTGCCATTCTCCAAGACCGG - Intronic
1113606666 13:111612751-111612773 TGGCTTACCCTGTTCCACACAGG - Intronic
1117750492 14:58917648-58917670 TGGAGGACACTGTTCAATACAGG - Intergenic
1122009749 14:98736413-98736435 TGGCTGCCACAGTTGAACCTTGG + Intergenic
1125536798 15:40445604-40445626 TGGCAGCCTTAGTTCAACACAGG - Intronic
1127256849 15:57300041-57300063 TGCCTTCCACTGTTTACCACTGG + Intergenic
1127294237 15:57595841-57595863 AGGCTTCCTCTGTTAAACACTGG + Intronic
1128038283 15:64546473-64546495 TGGTCGCCACTGGTCACCACTGG - Intronic
1128440604 15:67704970-67704992 TGGAAGCCACTGTTCTTCACTGG + Intronic
1132603625 16:784616-784638 TGCCTGCCACTGTCCAGCTCCGG - Intergenic
1134105153 16:11480060-11480082 TGGCAGCCACTGCTCAGCTCTGG - Intronic
1138871159 16:60888525-60888547 TGGCTGTCACTGTTGAAAGCAGG + Intergenic
1138966407 16:62089520-62089542 TGACTTCCACTTTGCAACACTGG - Intergenic
1142221121 16:88855786-88855808 TGGCCCCCACTGGTCAGCACAGG + Intronic
1142779208 17:2167781-2167803 TTGCTGCCACTGATGAGCACTGG + Intronic
1145000937 17:19304231-19304253 TTCCTGCCACTTCTCAACACAGG - Intronic
1145248249 17:21283857-21283879 CTGCTGCCCCTGTTCTACACAGG - Intergenic
1146074719 17:29717522-29717544 TGGCAGCCACTGCTCATCTCTGG - Intronic
1146125340 17:30227021-30227043 CGGCAGCCTCTGTTCACCACGGG - Intronic
1146719807 17:35116180-35116202 TGTCTCCCACTGTTCTAGACTGG + Intronic
1149026181 17:52030132-52030154 TGGCTGCCCCTGATGATCACAGG + Intronic
1150103945 17:62448004-62448026 TGTCTGCCACTGTCCAAAATGGG + Intronic
1152304789 17:79514145-79514167 TGGCTTCCTCTGTCCAGCACAGG - Intronic
1157038950 18:44014567-44014589 TGTCTGCCAGTTTTCTACACTGG + Intergenic
1157043158 18:44063275-44063297 TCGCTGCTACTGTTCATGACTGG + Intergenic
1157085818 18:44579941-44579963 TGCCAGCCACTGTGCTACACAGG + Intergenic
1158228618 18:55228754-55228776 TGTCTGCCACTGCTCAAGACTGG + Intronic
1159354113 18:67315153-67315175 TGGCAGTCAGGGTTCAACACGGG - Intergenic
1159613973 18:70558556-70558578 TGTCTGTTACTGTGCAACACTGG - Intergenic
1161676218 19:5651550-5651572 TTGCTGCCTCAGTTCACCACTGG + Intronic
925849024 2:8062397-8062419 TGGCTCCCACTGTTTCCCACTGG + Intergenic
927760524 2:25749329-25749351 TGGCTGTCAATGTTCTACAGAGG + Intronic
936153674 2:110035184-110035206 TGGCTGGCAGTATTCCACACGGG + Intergenic
936191010 2:110336231-110336253 TGGCTGGCAGTATTCCACACGGG - Intergenic
936786207 2:116096542-116096564 TGCCTTGCACTGTTCAGCACTGG - Intergenic
937871547 2:126789623-126789645 TGGCTGAGACTGTTCAGTACAGG - Intergenic
938367676 2:130747686-130747708 CTCCAGCCACTGTTCAACACAGG - Intergenic
939212751 2:139198079-139198101 TGGCTACTACTGATCAACAGTGG + Intergenic
941847395 2:170147164-170147186 GGGCTGCCACAATTCAACTCGGG - Intergenic
942257072 2:174113788-174113810 TGAATGCGACTGTTCCACACAGG - Intronic
944295219 2:198053810-198053832 TGACTGCCATTGTTGAAGACAGG + Intronic
944758002 2:202784081-202784103 GGGCTCCCACTGGCCAACACAGG + Intronic
945995710 2:216434247-216434269 GGGGTGACACTGTTCAATACAGG - Intronic
946412934 2:219524231-219524253 TGCCTGACACTGTTGAGCACAGG + Intronic
1169715119 20:8607282-8607304 TGTCTGCCAATGTGCAAAACTGG - Intronic
1171433265 20:25100416-25100438 TGACTGCCACTTTGCAACTCAGG + Intergenic
1171457861 20:25282103-25282125 TGGCTGCTGCTGTGCAACCCGGG + Exonic
1173306801 20:41858367-41858389 TGGCTGTCTCTGTCCCACACTGG + Intergenic
1174582879 20:51585061-51585083 TTCCTGCCACTCTTCAGCACTGG + Intergenic
1174950829 20:55040176-55040198 TAGCAGCCACTGTTCAAAATAGG + Intergenic
1175598688 20:60255571-60255593 CTGCTGCCACTGTGCACCACGGG - Intergenic
1175766430 20:61595835-61595857 TGGCTGCCTCAGGTCAGCACTGG - Intronic
1184856013 22:47147147-47147169 TGGCGGGCACTGTCCATCACGGG + Intronic
953229460 3:41051775-41051797 TGGCTGACAATGGCCAACACCGG + Intergenic
954593750 3:51806354-51806376 TGGCTTCCACTGTTAAATATTGG - Intergenic
956746498 3:72314959-72314981 TGGCTGCCCCTCTTCGAGACTGG - Intergenic
956890627 3:73609907-73609929 TGGCTGTCAATGTGCAACTCTGG + Intronic
965347956 3:167575469-167575491 GGGCTGCCACTGTGAACCACTGG + Intronic
969087381 4:4666528-4666550 TGACTTCCACTGTCCACCACTGG - Intergenic
969177512 4:5410103-5410125 TGGCTGCCACTGTTCAACACAGG - Intronic
969307854 4:6335952-6335974 AGGCTGCCACTGCTCACCAGAGG - Intronic
969887463 4:10228380-10228402 TGCTTGCCTCTGTTCAAAACGGG + Intergenic
984396150 4:179202441-179202463 TGGCTGAGAATTTTCAACACTGG - Intergenic
988611861 5:32734437-32734459 TGGCTGCAGCTCTTCACCACAGG + Intronic
995082000 5:108061980-108062002 AGGCTGCCACTTTTCATCAGAGG - Intronic
996245096 5:121253524-121253546 TTTCTGGCACTGTTCAACCCAGG + Intergenic
999157143 5:149466244-149466266 TGGCTGCCAGTGTGCTGCACTGG + Intergenic
1000629412 5:163574552-163574574 TGGCTGAAAGTGTTCAAAACAGG + Intergenic
1006807973 6:36800861-36800883 TGACAGCCACTGTTCCTCACTGG - Intronic
1007010450 6:38412269-38412291 TGTCTTCCAGTTTTCAACACAGG - Intronic
1008904372 6:56659924-56659946 CCGCTGCTGCTGTTCAACACAGG - Intronic
1008905416 6:56672281-56672303 TGGCAGCCTCTGCTGAACACTGG - Intronic
1009631872 6:66210369-66210391 TGGCTGCCAGGGTTCAATCCTGG + Intergenic
1011261103 6:85470268-85470290 TGGCTCTCACTGTGCAACCCAGG - Intronic
1016078243 6:139823822-139823844 TTGCTGCCACTGTTCAGCTTTGG + Intergenic
1018761529 6:166897996-166898018 TGGCTTCCACCTTTAAACACGGG + Intronic
1024995688 7:55271723-55271745 TGGCTGCCTCTGTTCAGCTGTGG - Intergenic
1026729237 7:72896831-72896853 TGCCTGCCACTGTTAAGCACTGG + Intronic
1027114767 7:75470283-75470305 TGCCTGCCACTGTTAAGCACTGG - Intronic
1027527946 7:79294430-79294452 TGGCTTCCCCTGTTCCATACTGG - Intronic
1027552797 7:79619911-79619933 TGACTCCCACTGTTAAACAAAGG - Intergenic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1031415314 7:121489120-121489142 TGGCTGAAGCTGTTCTACACTGG - Intergenic
1032033126 7:128501201-128501223 TGTCTGCCACTGTCCAAAATGGG + Intronic
1033241543 7:139683660-139683682 TGGCTGCCACTGTCATACCCTGG + Intronic
1035560497 8:600818-600840 TGGCTGCCTCGGTTCAGCCCTGG + Intergenic
1036627592 8:10484332-10484354 TTACTGCTACTGTTCAACTCTGG - Intergenic
1037726153 8:21484065-21484087 TGCCAGCCACTGTGCTACACAGG - Intergenic
1037871139 8:22497641-22497663 TCTCTGCTACTGTTCAAAACTGG - Intronic
1040470700 8:47733836-47733858 TGGGTGTCACTGGTCAAGACAGG - Intronic
1043549467 8:81353650-81353672 TTGCTGGCATTGATCAACACAGG + Intergenic
1043915244 8:85915037-85915059 TGACTGTCACTGTTAAGCACTGG + Intergenic
1055606504 9:77976312-77976334 TGGCTGCCAATTTTTACCACTGG - Intronic
1058272038 9:102985139-102985161 TGGCTTCCCTTGTTCCACACTGG - Intergenic
1060439418 9:123625313-123625335 TAGCTGCCACTGTTGAACACTGG - Intronic
1062375503 9:136260130-136260152 TGGCTGCCACTCTCCACCAGCGG + Intergenic
1188407136 X:29825537-29825559 TGGCTGCCGCAGCTCAACAGCGG + Intronic
1190339901 X:49287756-49287778 TGGCTGCCACTCTTCCTCCCTGG - Exonic
1190457114 X:50637250-50637272 CTGCTGCCACAGTTCAACTCTGG - Intronic
1197818590 X:130523850-130523872 TGGCGGCCACTGGCCACCACTGG - Intergenic
1199105047 X:143856143-143856165 TGGTTCCCACTGTTCCACACAGG + Intergenic
1199768688 X:150959519-150959541 TGGCAGTCCCTGTTCAAAACTGG + Intergenic