ID: 969177778

View in Genome Browser
Species Human (GRCh38)
Location 4:5412358-5412380
Sequence CCCAGTGGGCCTCATCTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969177778_969177786 23 Left 969177778 4:5412358-5412380 CCCATTAGATGAGGCCCACTGGG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 969177786 4:5412404-5412426 TAGCCAGGGGAAAGCAGAAGTGG 0: 1
1: 0
2: 5
3: 38
4: 346
969177778_969177783 8 Left 969177778 4:5412358-5412380 CCCATTAGATGAGGCCCACTGGG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 969177783 4:5412389-5412411 GCTCATCAGTTAGCATAGCCAGG 0: 1
1: 0
2: 0
3: 1
4: 73
969177778_969177784 9 Left 969177778 4:5412358-5412380 CCCATTAGATGAGGCCCACTGGG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 969177784 4:5412390-5412412 CTCATCAGTTAGCATAGCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 101
969177778_969177785 10 Left 969177778 4:5412358-5412380 CCCATTAGATGAGGCCCACTGGG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 969177785 4:5412391-5412413 TCATCAGTTAGCATAGCCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969177778 Original CRISPR CCCAGTGGGCCTCATCTAAT GGG (reversed) Intronic
900127529 1:1075225-1075247 CCCAGTGGACCTCATGCAAGGGG + Intergenic
900519773 1:3099973-3099995 CCCAGTGGCCTCCATCTCATAGG - Intronic
906865213 1:49410959-49410981 TCCAGAGGGCCACAACTAATAGG + Intronic
913057983 1:115179616-115179638 CCCAGTGGGCCTGCTCTCCTGGG - Intergenic
913328876 1:117650983-117651005 CCCAGTGCCCCGCATCTCATTGG + Intergenic
920096427 1:203489197-203489219 CCCTGAGGGCCTCATCAAAGGGG - Exonic
921406959 1:214790655-214790677 CCCAATGGGCCTCATCTAGAGGG + Intergenic
921903946 1:220476407-220476429 CCCAGGGTGCCTCATCTTAAGGG + Intergenic
922916791 1:229264372-229264394 CTGGGTGGGCCCCATCTAATCGG + Intergenic
1063520258 10:6734792-6734814 CCCAGAGGGTCTGATTTAATAGG - Intergenic
1075035984 10:119067661-119067683 ACTAGTGGGACTCATTTAATTGG + Intronic
1075109504 10:119566727-119566749 CCCTGTGGGTCCCATCTACTTGG - Intergenic
1083681180 11:64352561-64352583 CCCCGTGGGGCTCACCTATTGGG + Intronic
1086279135 11:85165451-85165473 GCCATGGGGCCTCTTCTAATGGG - Intronic
1086665761 11:89479985-89480007 CCCAGTGGGCCCCATGGAATTGG + Intronic
1087513472 11:99128168-99128190 CCCAGTGGGTCTCAGCTTGTGGG - Intronic
1091306696 11:134540884-134540906 CCCTGAGGGCCTCATCAAAGAGG + Intergenic
1092458462 12:8665844-8665866 CCCAGAGGCCTTCAGCTAATGGG - Intergenic
1097554569 12:61121318-61121340 CTTGGTGGGCATCATCTAATCGG + Intergenic
1102799177 12:115716663-115716685 CAAAGTGGGACTCATCTAATGGG - Intergenic
1108975684 13:56441337-56441359 CCCCTTGGGCCTGAACTAATAGG - Intergenic
1115654853 14:35433608-35433630 CCCAGTAGGCCTTATGGAATTGG + Intergenic
1131925514 15:97378810-97378832 CCCAGTCAGCCTCATCTTAGAGG + Intergenic
1131929947 15:97430724-97430746 CCCAGTAGATGTCATCTAATTGG + Intergenic
1134006275 16:10820582-10820604 CCCAGAGAGCCTGATTTAATTGG - Intergenic
1135096238 16:19567050-19567072 CCCAGTTGGCCCCCTTTAATTGG + Intronic
1139042987 16:63021519-63021541 CCCTGTGGGCCACATCTACTAGG - Intergenic
1140246454 16:73254133-73254155 CCCTGTGGGACTCCTCTAACAGG + Intergenic
1145755859 17:27389689-27389711 CCCCTTGGGCCTCATGAAATGGG + Intergenic
1146817421 17:35953999-35954021 GCCAGTGGTTCTCATCTAGTTGG + Intergenic
1148283803 17:46370468-46370490 CACAGAGGGCCTCTTATAATGGG + Intergenic
1148306021 17:46588385-46588407 CACAGAGGGCCTCTTATAATGGG + Intergenic
1149596070 17:57865490-57865512 CCCAGTGGGCAGCATCTACAAGG - Intronic
1153980024 18:10300875-10300897 CACAGTTGGCCACATCTGATTGG + Intergenic
1157701968 18:49766986-49767008 CACTGTGGGCCTCAGCTCATGGG + Intergenic
1157825126 18:50805579-50805601 CTCAGTGGGGCTCTTCAAATAGG + Intronic
1159758883 18:72399953-72399975 CCCAATAGGCCAGATCTAATTGG + Intergenic
926735622 2:16071208-16071230 CCCAGAGATCCTCATATAATTGG - Intergenic
932909542 2:75791441-75791463 CCCAGAGATTCTCATCTAATTGG - Intergenic
935758724 2:106298721-106298743 CTAAGTGGGCCCCAGCTAATGGG + Intergenic
937335568 2:121060141-121060163 GCCAGTGGGCCTGAACTAAGGGG + Intergenic
938802354 2:134774828-134774850 CCAAGAGGGCCTCATCGCATGGG - Intergenic
946133234 2:217623699-217623721 GTGGGTGGGCCTCATCTAATTGG + Intronic
946556192 2:220860362-220860384 CAGAGTGGGCACCATCTAATCGG + Intergenic
947059255 2:226144157-226144179 CTGAGTGGGCATAATCTAATTGG - Intergenic
1170772016 20:19341111-19341133 CCCAGAGGGGCTGAACTAATTGG + Intronic
1174430882 20:50467943-50467965 CCAAGTGGGCCTCCTGAAATTGG + Intergenic
1176016294 20:62935058-62935080 CACCGTGGGCCTCATTCAATTGG - Intronic
1178007828 21:28242713-28242735 CCCAGTGGGGTTCAGTTAATGGG + Intergenic
1178058303 21:28824148-28824170 CCCAGAGGGTCTGATTTAATTGG - Intergenic
1180694515 22:17743234-17743256 ACCAGTGGGCCTCAATCAATGGG + Intronic
1185335498 22:50269406-50269428 CCCAGTGGGCAGCAGCTAAGCGG + Intronic
949462662 3:4309669-4309691 CTCAGTAGGCCTCATCTACGTGG + Intronic
952061480 3:29516101-29516123 CCCAGCCTGCCTCATCTTATTGG - Intronic
952305060 3:32138164-32138186 TCCAGTGGGCTTCAGCCAATGGG - Intronic
954462503 3:50635367-50635389 CCCAGTGAGGCTCAACAAATGGG - Intronic
956520279 3:70096202-70096224 CCAGGTGGGCCTCTTCTACTTGG + Intergenic
958924787 3:100145790-100145812 GTGAGTGGGCCTCATCCAATTGG - Intronic
964639730 3:158895773-158895795 TCCAGTGGCCCTCATCCCATAGG + Intergenic
965827187 3:172743047-172743069 CCAAGTGGGCCTCTTCTCCTTGG - Intergenic
966593351 3:181704489-181704511 CTCAGTGGGCCTAAGCTAAGTGG - Intergenic
969140323 4:5065460-5065482 CCTAGTAGCCCTCATCTAAGTGG - Intronic
969177778 4:5412358-5412380 CCCAGTGGGCCTCATCTAATGGG - Intronic
970914250 4:21314246-21314268 CCAAGTGAGCCTGACCTAATCGG - Intronic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
982492859 4:156051042-156051064 CCCAGTGGGTCTCTTCTCCTTGG + Intergenic
984974135 4:185215338-185215360 CCCTGTGGGTCTAATCTACTGGG - Intronic
985644134 5:1077167-1077189 CCCCGTGGGCCTCAGCTTCTGGG - Intronic
992363581 5:76069029-76069051 CCCAGTTGGTCTCACATAATAGG + Intergenic
993251317 5:85527555-85527577 GTGAGTAGGCCTCATCTAATTGG - Intergenic
994074058 5:95631362-95631384 CCCAGTTGGCCTCTTGTAATTGG - Intergenic
1001031795 5:168268704-168268726 TCCAGAGGTCCTGATCTAATTGG - Intergenic
1001492336 5:172164747-172164769 CCACGTGGGCCTCATCTACTTGG - Intronic
1003083149 6:3038305-3038327 CCCAGTGGCCTTAATCTAAAGGG + Intergenic
1003641373 6:7878336-7878358 TCCAGTGGGCCTCAGTGAATTGG + Intronic
1006802442 6:36767741-36767763 GCCAGAGGGCCTAATTTAATTGG + Intronic
1007356054 6:41318655-41318677 CCCAGTGCGCCTAATTTAATTGG - Intergenic
1007652922 6:43434267-43434289 CCCTTTGTCCCTCATCTAATGGG + Intronic
1019362159 7:610394-610416 CCCAGTGAGGCTCATTTAAGAGG - Intronic
1019729825 7:2623683-2623705 CCCGGAGGGGCTCATCTCATGGG - Intergenic
1020083557 7:5298893-5298915 CCCAGTGCGGCTCTTCTGATTGG + Intronic
1021584218 7:22190676-22190698 CACAGAGGGCCTCCTCTATTGGG + Intronic
1021799301 7:24287879-24287901 CCCAGAGGGTCTGATTTAATTGG - Intronic
1022245393 7:28554221-28554243 ACCAGTGGCCCACATCTAAATGG - Intronic
1024009602 7:45256571-45256593 GTGAGTGGGCCTCATCCAATCGG - Intergenic
1024054241 7:45649464-45649486 CCCTGTTGGCCCCATCTCATTGG - Intronic
1026944064 7:74305242-74305264 CCCAGGGTGCCCCATCCAATGGG - Intronic
1027132816 7:75603485-75603507 CCCAGAGGACCCCATCTGATGGG - Intronic
1044999425 8:97867579-97867601 CCCAGTGGGCCTAAGGTACTGGG + Intergenic
1045342482 8:101267032-101267054 CCCAGTGGTCCACATCTATGCGG + Intergenic
1046678837 8:117144155-117144177 CCCAGTGGCCATCATCTCAGAGG - Intronic
1047596967 8:126387473-126387495 CACAATGGGTCTCATCTAATGGG - Intergenic
1048333705 8:133488385-133488407 GCAGGTGGGCCTCATCCAATAGG + Intronic
1051981368 9:23023591-23023613 GCCTTTTGGCCTCATCTAATTGG + Intergenic
1054921050 9:70542482-70542504 CCCACTGGGCCTTCTCTCATGGG - Intronic
1055902571 9:81258004-81258026 CCCAGTGTTGCTCCTCTAATAGG + Intergenic
1058280288 9:103104465-103104487 CCCAGTGGGCCTGAGCAACTCGG + Intergenic
1062379068 9:136278055-136278077 CCCCGTGGCCCCCATCTAACTGG + Intergenic
1188245895 X:27835553-27835575 GCCTGTGGGCCTCATTTCATAGG + Intergenic
1190131672 X:47753942-47753964 CCCAGTGGGGCCCATCTAGAAGG - Intergenic
1194548261 X:95265323-95265345 CCCAGAGGTTCTCATTTAATTGG - Intergenic