ID: 969177830

View in Genome Browser
Species Human (GRCh38)
Location 4:5412685-5412707
Sequence ATCCTTCAAGTGCTACTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969177830 Original CRISPR ATCCTTCAAGTGCTACTGAG AGG (reversed) Intronic
900602721 1:3509909-3509931 CTCCTTCCAGTGCTCCTGCGAGG - Exonic
903549059 1:24144895-24144917 CTTCTTCCAGTGCTTCTGAGAGG - Intergenic
909701151 1:78524998-78525020 ATCCTCCAACTGCTTCTTAGTGG + Intronic
912996542 1:114537189-114537211 CTCCTTCAAGTGCTGCAGTGGGG + Intergenic
918639087 1:186816765-186816787 ATAATTTAAGTGATACTGAGTGG + Intergenic
919915451 1:202136019-202136041 AGCCTCCAAGTGCTACTCTGGGG + Intronic
921846107 1:219884026-219884048 ACCTTTCGAATGCTACTGAGTGG - Intronic
1077583869 11:3435495-3435517 AACCCTCATGTGCTATTGAGAGG - Intergenic
1081416783 11:42824720-42824742 TTCCTCCAAGTGATACAGAGAGG - Intergenic
1081487672 11:43544558-43544580 TCCCTTCAAGTGCTGCTAAGTGG - Intergenic
1084240775 11:67818168-67818190 AACCCTCATGTGCTATTGAGAGG - Intergenic
1084831666 11:71774544-71774566 AACCCTCATGTGCTATTGAGAGG + Intergenic
1085052938 11:73389031-73389053 ATCCTGGAAGTGGTGCTGAGGGG + Intronic
1089629540 11:119775601-119775623 AGCCTTCTGGTGCTACAGAGAGG - Intergenic
1092411006 12:8252742-8252764 AACCCTCACGTGCTATTGAGAGG - Intergenic
1098152630 12:67563200-67563222 TTCATTCAAGTCCTGCTGAGAGG + Intergenic
1098859603 12:75692916-75692938 GTCCTTCCATTGCTACTTAGTGG + Intergenic
1102810502 12:115820078-115820100 TTCCTTCAAATGCTTCTGAGAGG + Intergenic
1103331085 12:120154523-120154545 ATCCTCCAACTGCTACTCATGGG + Intronic
1110522099 13:76491639-76491661 ACCTTGCTAGTGCTACTGAGAGG - Intergenic
1110843507 13:80168993-80169015 ATCATTCCAGTGCTCCAGAGGGG - Intergenic
1123733940 15:23167025-23167047 ATTCTTCCAGTACTACAGAGAGG + Intergenic
1128983452 15:72202482-72202504 CTCCTTCAAGTGCTGCAGTGGGG - Intronic
1131935181 15:97496367-97496389 ATCCTTCCAGTGTTAATGACTGG - Intergenic
1133352239 16:5109062-5109084 AACCCTCATGTGCTATTGAGAGG - Intergenic
1135279711 16:21143767-21143789 ATCCTCCAAGTGATATTGAAAGG + Intronic
1138026762 16:53528230-53528252 AATGTTAAAGTGCTACTGAGAGG + Intergenic
1139931140 16:70527482-70527504 ATACTTAATGTGGTACTGAGAGG + Intronic
1140732225 16:77866917-77866939 AACCTTCAAGTGCACCTGAGGGG - Intronic
1144309197 17:13997004-13997026 CTCCCTGAAGAGCTACTGAGGGG + Intergenic
1147607322 17:41781549-41781571 TTCCTGCAAGTGACACTGAGCGG - Intronic
1151280196 17:73068233-73068255 CTCCCTCAAGTGCTACTGGAGGG - Intronic
1152089105 17:78237251-78237273 CTCCTTGCAGTGCTAGTGAGGGG - Intronic
1156567111 18:38204307-38204329 AACCTTCATATGCTACTGATTGG - Intergenic
1157323359 18:46650909-46650931 ATCGTTCAGGTGTTACAGAGAGG - Intronic
1159443665 18:68512977-68512999 ACCAATCAAGTGCTACAGAGAGG - Intergenic
1159855269 18:73579862-73579884 ATCCTTGAAGTGCTTGAGAGAGG + Intergenic
1161720269 19:5898364-5898386 GTCCCTCAAGAGCGACTGAGGGG + Intronic
1164543402 19:29139522-29139544 CTCCTTCAACTGCTATTGAGTGG + Intergenic
1164897798 19:31892311-31892333 AGCCTTCAAATGCTAAAGAGAGG + Intergenic
932441919 2:71742980-71743002 CTCCTTCGCTTGCTACTGAGTGG + Intergenic
936066272 2:109334830-109334852 GTCCTGGAAGTGCTACTGAGGGG - Intronic
944424856 2:199569746-199569768 ATCCTTAAAGTACTTCAGAGAGG - Intergenic
945912271 2:215662995-215663017 ATCTTTCAACTGCTTTTGAGGGG - Intergenic
947458579 2:230282329-230282351 ATCCTTGAAGTGATACTCTGAGG + Intronic
1168927961 20:1598515-1598537 ATGCATCAGGGGCTACTGAGTGG - Intronic
1175264713 20:57695679-57695701 ATCCTTCTGGTGCTAATCAGAGG - Intronic
1177185758 21:17794207-17794229 ATCCTTGATCTGCTACTGATTGG + Intronic
1178946810 21:36955105-36955127 GTCCTTCAGGAGCTACTGTGGGG + Intronic
949106697 3:208165-208187 ATCCTCCAACTGCCACTGGGAGG - Intronic
955560035 3:60178981-60179003 ATACTTCAAGAAATACTGAGGGG + Intronic
958005026 3:87799720-87799742 ATCCTACTGGTGCTACTCAGGGG - Intergenic
959090970 3:101902246-101902268 ATCACCCAAGTGCTGCTGAGAGG - Intergenic
959555264 3:107710065-107710087 ATCCTTCATGTTCTTCTGATGGG + Intronic
961298148 3:125903742-125903764 AACCCTCATGTGCTATTGAGAGG + Intergenic
964429006 3:156584163-156584185 TTCCTTCATGTGAGACTGAGGGG - Intergenic
965514864 3:169610290-169610312 ATGATTCCAGTGCCACTGAGGGG - Intronic
966680043 3:182632186-182632208 CTCCTTGAAGTGCTTCAGAGAGG + Intergenic
967289122 3:187902187-187902209 ATCCTCCAAGTGTGACTGAGCGG + Intergenic
968999051 4:3965244-3965266 AACCCTCACGTGCTATTGAGAGG - Intergenic
969177830 4:5412685-5412707 ATCCTTCAAGTGCTACTGAGAGG - Intronic
969478967 4:7436962-7436984 ATTCCTCAAATGCTGCTGAGGGG - Intronic
969577330 4:8044043-8044065 ATCCTGACAGTGCCACTGAGGGG - Intronic
969754950 4:9143388-9143410 AACCCTCACGTGCTACTGAGAGG + Intergenic
975904078 4:79188807-79188829 AAGCTTCCACTGCTACTGAGAGG - Intergenic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
988141856 5:27253508-27253530 AACCCTCAAGTGCTCCTGAAAGG + Intergenic
988219705 5:28327705-28327727 ATCATTCCAGTACTACTGATGGG - Intergenic
989163439 5:38412804-38412826 ACCTTTGATGTGCTACTGAGTGG + Intronic
993548571 5:89244482-89244504 ATTCTTTAAATGCTGCTGAGGGG + Intergenic
997789882 5:136749375-136749397 ATGCGTCAAGTGCTATGGAGGGG - Intergenic
1000907143 5:166977298-166977320 ATGCTTAAAATGCTAATGAGGGG - Intergenic
1001135938 5:169102824-169102846 ATCATTCGAGTGCTTCTGTGAGG - Intronic
1003422808 6:5973674-5973696 CTCCTTCAAGTGCTGCAGTGGGG + Intergenic
1008735792 6:54542305-54542327 CTCCTTGAAGTTCTGCTGAGTGG - Intergenic
1009707594 6:67273511-67273533 ATCTTTGAAGTGCTACTTAAAGG + Intergenic
1012159664 6:95868014-95868036 ATCCTTAAAATACTACTGTGAGG - Intergenic
1021417778 7:20408026-20408048 AGCCTTTAAGTGCAACTGAGTGG - Intronic
1031483043 7:122300775-122300797 ATGCTTCAAGTGTTAATCAGCGG - Intergenic
1032735934 7:134692539-134692561 ATGCTTCAAGTTCTACTCATAGG + Intergenic
1036378184 8:8218703-8218725 AACCCTCACGTGCTACTGAGAGG + Intergenic
1036851386 8:12203914-12203936 AACCCTCAAGTGCTATTGAGAGG - Intergenic
1036872750 8:12446188-12446210 AACCCTCAAGTGCTATTGAGAGG - Intergenic
1041551973 8:59113348-59113370 AACCTTCATGTGATGCTGAGAGG - Intronic
1041993206 8:64020034-64020056 ATTCTTCTTGTGCTATTGAGAGG - Intergenic
1050561193 9:6835559-6835581 ATCCTTCAAATGCTTCTAGGCGG + Intronic
1052493608 9:29197904-29197926 TTCCTTCATGTGCTACTAAATGG - Intergenic
1057152976 9:92810017-92810039 ATCCACCAAGTGCTACAGACGGG - Intergenic
1058386934 9:104447361-104447383 CTCCTTTAAGTGATGCTGAGTGG - Intergenic
1059935146 9:119302903-119302925 ACCCTACAAGTGCTCCTGAAAGG + Intronic
1060724931 9:126000359-126000381 ATCCTTCCAGGGCTCCTGAGGGG + Intergenic
1061607244 9:131720229-131720251 CTCCTTCCAGTGCTTTTGAGAGG + Intronic
1187295074 X:17991361-17991383 ATATTTAAAGTGCTACTTAGGGG + Intergenic
1190437395 X:50439058-50439080 ATCCATCAAGTGCTAATTATGGG - Intronic
1193851275 X:86540174-86540196 ATCATTCTTCTGCTACTGAGTGG + Intronic
1193929533 X:87534914-87534936 ATCCGACAAGTGCTTCTGAAAGG - Intronic
1195732831 X:107982711-107982733 TTCCTCCAAGGGCAACTGAGGGG - Intergenic