ID: 969178823

View in Genome Browser
Species Human (GRCh38)
Location 4:5421683-5421705
Sequence TCCCCATGGCTCTGCTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 1, 1: 0, 2: 7, 3: 43, 4: 450}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969178823_969178831 18 Left 969178823 4:5421683-5421705 CCAGGAAAGCAGAGCCATGGGGA 0: 1
1: 0
2: 7
3: 43
4: 450
Right 969178831 4:5421724-5421746 TCCATGGCCCTGCTTTCAAAAGG 0: 1
1: 0
2: 0
3: 9
4: 166
969178823_969178833 19 Left 969178823 4:5421683-5421705 CCAGGAAAGCAGAGCCATGGGGA 0: 1
1: 0
2: 7
3: 43
4: 450
Right 969178833 4:5421725-5421747 CCATGGCCCTGCTTTCAAAAGGG 0: 1
1: 1
2: 1
3: 14
4: 191
969178823_969178829 2 Left 969178823 4:5421683-5421705 CCAGGAAAGCAGAGCCATGGGGA 0: 1
1: 0
2: 7
3: 43
4: 450
Right 969178829 4:5421708-5421730 CAGCTGGGCACTCTCCTCCATGG 0: 1
1: 0
2: 0
3: 28
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969178823 Original CRISPR TCCCCATGGCTCTGCTTTCC TGG (reversed) Intronic