ID: 969180618

View in Genome Browser
Species Human (GRCh38)
Location 4:5437809-5437831
Sequence TACACAGGTTTAGAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 1, 2: 3, 3: 36, 4: 328}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969180618_969180621 0 Left 969180618 4:5437809-5437831 CCTTCCAGCTCTAAACCTGTGTA 0: 1
1: 1
2: 3
3: 36
4: 328
Right 969180621 4:5437832-5437854 GTTCTCTCACGTCTAAGTGCTGG 0: 1
1: 0
2: 1
3: 3
4: 65
969180618_969180622 1 Left 969180618 4:5437809-5437831 CCTTCCAGCTCTAAACCTGTGTA 0: 1
1: 1
2: 3
3: 36
4: 328
Right 969180622 4:5437833-5437855 TTCTCTCACGTCTAAGTGCTGGG 0: 1
1: 0
2: 1
3: 5
4: 116
969180618_969180623 30 Left 969180618 4:5437809-5437831 CCTTCCAGCTCTAAACCTGTGTA 0: 1
1: 1
2: 3
3: 36
4: 328
Right 969180623 4:5437862-5437884 AACAGCCAATGACATCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969180618 Original CRISPR TACACAGGTTTAGAGCTGGA AGG (reversed) Intronic
901973074 1:12923423-12923445 TATACAATTTTGGAGCTGGAAGG + Intronic
902012107 1:13278340-13278362 TATACAATTTTGGAGCTGGAAGG - Intergenic
902257238 1:15197830-15197852 GACATAGTTTCAGAGCTGGAGGG - Intronic
903130045 1:21273022-21273044 CACACAGATTTGGAACTGGACGG + Intronic
903309684 1:22444866-22444888 TAAAAAGTTTTAGAGCAGGAAGG - Intergenic
903396739 1:23007317-23007339 TTCACAGGTTTACAGCTGGAGGG + Intergenic
904436976 1:30505381-30505403 TTCACAGGCTCACAGCTGGAAGG + Intergenic
904540450 1:31229320-31229342 TACAGAGATTCAGAGCTGGGAGG - Intronic
904799742 1:33083899-33083921 TGCACAGGGTGCGAGCTGGATGG + Intronic
904960917 1:34332155-34332177 TAAACAGCTTGAGAGATGGAGGG - Intergenic
906371136 1:45254848-45254870 CACTCAGGTTTTGAGGTGGAGGG + Intronic
908486895 1:64603872-64603894 TTCACCGTTTAAGAGCTGGAAGG + Intronic
908635282 1:66157003-66157025 TACACAAGTTTAGAGCTCAAGGG - Intronic
909754557 1:79207824-79207846 TAAACAGGTTGAGAGATTGATGG + Intergenic
911242198 1:95478868-95478890 TTTACAGGTTTATAGGTGGAAGG + Intergenic
911644180 1:100320854-100320876 TCCACAGGCTTATAGGTGGAAGG + Intergenic
912370073 1:109167068-109167090 TAGAGAGCTTTAAAGCTGGAAGG + Intronic
912662604 1:111546352-111546374 AAAACAGTTTTAGAGATGGATGG - Intronic
913217596 1:116633466-116633488 TACACAGTCTTGGAGCTGAAAGG - Intronic
913590027 1:120315535-120315557 TAAAGAATTTTAGAGCTGGAAGG - Intergenic
913618158 1:120582831-120582853 TAAAGAATTTTAGAGCTGGAAGG + Intergenic
914572056 1:148927392-148927414 TAAAGAATTTTAGAGCTGGAAGG - Intronic
914600780 1:149202873-149202895 TAAAGAATTTTAGAGCTGGAAGG + Intergenic
918474611 1:184910353-184910375 TACAGACCTCTAGAGCTGGATGG + Intronic
920831496 1:209469833-209469855 TTCACAGGCTTATAGCTGGAGGG - Intergenic
920928866 1:210368230-210368252 AGCACAGGTTTGGAGTTGGATGG + Intronic
922062087 1:222102525-222102547 TTCACAGGTTTAGAGCTTAGAGG - Intergenic
922063533 1:222114223-222114245 TGCAGAGGTTTGGAGCAGGATGG - Intergenic
923405525 1:233655303-233655325 TTCACAGGCTCACAGCTGGAGGG + Intronic
924626656 1:245701462-245701484 TAACCAGGACTAGAGCTGGAAGG - Intronic
1062938689 10:1406361-1406383 CACACGGCTTTAGAGCTGGATGG - Intronic
1063728301 10:8665214-8665236 TACTCTAGTTTAGAGTTGGAAGG + Intergenic
1063991242 10:11566075-11566097 AACACAGGGCTAGAGCTGGATGG + Intronic
1064909520 10:20384800-20384822 TGCACAGGCTCACAGCTGGAGGG + Intergenic
1067709572 10:48637328-48637350 GACACAGGTATACAGATGGATGG + Intronic
1068299601 10:55121342-55121364 TTCACAGGCTCAGAGCTGGGGGG + Intronic
1068416722 10:56733481-56733503 TTTACAGGTTTATAGGTGGAAGG - Intergenic
1070956484 10:80467029-80467051 TACACTGGGTTAGAGCTGTGGGG + Intronic
1071821271 10:89283674-89283696 TACACTGGTTTCCTGCTGGAGGG - Intronic
1071856957 10:89635738-89635760 TTCACAGGCTTACAGCTAGAGGG - Intronic
1071959593 10:90797225-90797247 CACTGAGTTTTAGAGCTGGAAGG + Intronic
1072094175 10:92160813-92160835 TAGACAGGCTTAGGGGTGGAGGG + Intronic
1073081145 10:100861706-100861728 TACACAGGTCTGGAGCTCGAGGG - Intergenic
1073629560 10:105134929-105134951 TTCACAGGCTTGCAGCTGGAGGG - Intronic
1074619823 10:115107236-115107258 TTCACAGGCTCACAGCTGGAAGG - Intronic
1075500797 10:122971870-122971892 TTCACAAACTTAGAGCTGGAGGG + Intronic
1075768361 10:124912862-124912884 TAAAGAGGTTTTGAGCAGGAAGG - Intergenic
1077702685 11:4456354-4456376 TATGCAGGTTTAGATGTGGAGGG + Intergenic
1077705235 11:4478750-4478772 TTCACAGGTTTATAGATGGAGGG + Intergenic
1080340401 11:31256788-31256810 TACACAGAATTTGAGCTTGATGG + Intronic
1082960386 11:58913849-58913871 TACAAAGGTTCAGAGGTGGGAGG + Intronic
1082980326 11:59115004-59115026 TACAAAGGTTCAGAGATGGGAGG + Intronic
1085045200 11:73348682-73348704 AAAAGAGTTTTAGAGCTGGATGG + Intronic
1086280704 11:85184143-85184165 TAATTATGTTTAGAGCTGGAAGG + Intronic
1086949496 11:92877106-92877128 AACACAGGTTTGGAGGTGGAAGG + Intronic
1087205700 11:95391691-95391713 TTCACAGGCTCACAGCTGGAAGG - Intergenic
1087348510 11:97001648-97001670 TACCCAGGTTTTGGGGTGGAAGG + Intergenic
1088739240 11:112753266-112753288 TACAGAGGATGACAGCTGGAAGG + Intergenic
1089283177 11:117388659-117388681 AACACAGTGTTAGAGCTGGCAGG - Intronic
1090755475 11:129786286-129786308 TTTACAGGTTTATAGGTGGAAGG - Intergenic
1091125488 11:133091733-133091755 TTCACAGGCTGACAGCTGGAGGG + Intronic
1091163095 11:133444181-133444203 TAAACATGTTTAGAGCTAGCAGG - Intronic
1091879756 12:3967665-3967687 TGCACAGGTTTAGCACAGGAAGG - Intergenic
1092674282 12:10899154-10899176 TTCACAGGCTCATAGCTGGAAGG + Intronic
1093675789 12:21939212-21939234 TGCACAGGTTCAGAGCCGGCCGG - Intronic
1095484505 12:42671394-42671416 TAAAAAGCTTTAGAGCAGGAAGG + Intergenic
1095685333 12:45026761-45026783 TACAGAGTTACAGAGCTGGAAGG - Intronic
1097642071 12:62193390-62193412 CACAGACCTTTAGAGCTGGAAGG - Intronic
1099873359 12:88375183-88375205 TTCACAGGTTTACAGCTTGAGGG - Intergenic
1100277168 12:93081852-93081874 TAAAAAGTTTTAGAGCAGGAAGG - Intergenic
1100674779 12:96855424-96855446 TTTACAGGTTTATAGGTGGAAGG - Intronic
1101214457 12:102566664-102566686 TATGAAGTTTTAGAGCTGGAAGG - Intergenic
1102579202 12:113875385-113875407 TACAAAAGTTTAGAATTGGATGG + Intronic
1105645057 13:22308606-22308628 TACACAAGTTTAGAGTTAGAAGG + Intergenic
1107137961 13:36965051-36965073 GAGACAGGGCTAGAGCTGGAAGG + Intronic
1109922585 13:69088275-69088297 TTCACAGGCTCACAGCTGGAGGG + Intergenic
1110191816 13:72739139-72739161 CACACAATTTTAGAGCTGGGGGG - Intronic
1112884071 13:104147381-104147403 TCCACAGGTTTACAGCTGGAGGG - Intergenic
1113082414 13:106533890-106533912 CACACAGATTTAGGGATGGATGG + Intronic
1113144906 13:107197687-107197709 CACAGAGCTGTAGAGCTGGAAGG - Intronic
1113203001 13:107887632-107887654 TTTACAGGTTTATAGGTGGAAGG - Intergenic
1113831461 13:113298565-113298587 AACAGAGTTTTACAGCTGGATGG - Intronic
1114946971 14:27694785-27694807 TGCACAGGTTTTGATGTGGAAGG + Intergenic
1115518807 14:34212320-34212342 TATACAGTTTTTGAGCTGCACGG - Intronic
1115744389 14:36420849-36420871 TACAAAGGTTGAGAGCTTTAAGG + Intergenic
1117780247 14:59224516-59224538 TTCACAGGCTTACAGCTGGAAGG + Intronic
1117886066 14:60364322-60364344 TATACAGGTCTAGAGCTCAAAGG - Intergenic
1119128044 14:72146511-72146533 TTCACAGGCTCACAGCTGGAGGG - Intronic
1120133722 14:80838612-80838634 TAAAGAGATTTAGAACTGGAAGG - Intronic
1120141783 14:80937868-80937890 TAAAGAATTTTAGAGCTGGATGG - Intronic
1120342099 14:83234593-83234615 TACATAAATTTGGAGCTGGAAGG - Intergenic
1120646364 14:87079382-87079404 GATACGGTTTTAGAGCTGGAAGG - Intergenic
1120891623 14:89496737-89496759 TACAGAGTTGTAGAGATGGATGG - Intronic
1121420907 14:93813282-93813304 TACACAGGGTGAGGTCTGGATGG - Intergenic
1121492425 14:94369894-94369916 TACAGAGGGTAAGAGCTGGGGGG - Intergenic
1121991754 14:98564464-98564486 GACAGAGGTTTAAAGATGGATGG - Intergenic
1122316064 14:100826773-100826795 TACACAGGTTTAGTGCAGTGTGG + Intergenic
1122964495 14:105115812-105115834 TAAAAAGTTTTAGAGCAGGAAGG + Intergenic
1123043633 14:105500693-105500715 TCCACAGGGTTAAAGCTGGATGG + Intergenic
1123138341 14:106051030-106051052 TTTACAGGTTTATAGGTGGAAGG + Intergenic
1123469651 15:20540863-20540885 AGCACAGGTTTCCAGCTGGAAGG - Intronic
1123648411 15:22459836-22459858 AGCACAGGTTTCCAGCTGGAAGG + Intronic
1123729929 15:23135849-23135871 AGCACAGGTTTCCAGCTGGAAGG - Intronic
1123748099 15:23333331-23333353 AGCACAGGTTTCCAGCTGGAAGG - Intergenic
1124280463 15:28357183-28357205 AGCACAGGTTTCCAGCTGGAAGG - Intergenic
1124302235 15:28554429-28554451 AGCACAGGTTTCCAGCTGGAAGG + Intergenic
1126136530 15:45397561-45397583 TACAAAGGGTGAGATCTGGAAGG - Intronic
1126394331 15:48197187-48197209 TACAAAGGCTTTGAGGTGGAAGG - Intronic
1126425860 15:48526491-48526513 TACACAGGTTTAGATTTTAAAGG - Intronic
1126569730 15:50137753-50137775 TATACAGTGTTAGAGCTGGGAGG + Intronic
1126617827 15:50603921-50603943 TACACATCTTGAGAGATGGAAGG + Intronic
1127304978 15:57696698-57696720 TATAGAATTTTAGAGCTGGAAGG + Intronic
1127739036 15:61880010-61880032 TACACAAGTTTAGAGCATTATGG + Intronic
1129179161 15:73860735-73860757 TACCCAGGAAGAGAGCTGGAGGG - Intergenic
1129999539 15:80034861-80034883 GACACAGCCTCAGAGCTGGAGGG + Intergenic
1132285263 15:100657984-100658006 TCCACAGGTGAAGAGGTGGAGGG + Intergenic
1135184182 16:20300572-20300594 GACACAGAATTAGAGCTGGAAGG - Intergenic
1135483528 16:22843600-22843622 TACACAGGGTGAGGTCTGGAAGG + Intronic
1137429346 16:48405826-48405848 CACACAGAATTAGAGCTGAAAGG - Intronic
1139069774 16:63365878-63365900 TGTACAGATTTATAGCTGGAAGG - Intergenic
1139077701 16:63473580-63473602 CACACAATTTTAGAGCTGAAAGG - Intergenic
1139220462 16:65176570-65176592 TACACAGGGGTAGAGCTGGAAGG + Intergenic
1139967719 16:70754966-70754988 CACACAGATTCAGGGCTGGAAGG + Intronic
1140753532 16:78047418-78047440 TGCACAGGTTTGAAGCTGCAGGG + Intronic
1142522853 17:517338-517360 CACTCAGGATCAGAGCTGGACGG + Exonic
1143650802 17:8263396-8263418 TAGACAGGTTCAGGGTTGGAAGG + Intronic
1143972567 17:10806115-10806137 TACACAGGGGCAGAGGTGGAGGG - Intergenic
1144484909 17:15656440-15656462 TACACGGGTTGAGAGGTGGCAGG - Intronic
1144524834 17:15980280-15980302 AACACAGCTTTAGATCTTGAAGG + Intronic
1144970504 17:19106262-19106284 GACTCAGGCTCAGAGCTGGAAGG + Intergenic
1144990807 17:19232424-19232446 GACTCAGGCTCAGAGCTGGAAGG + Intronic
1145271330 17:21406419-21406441 CACAGAGGTTCAGAGATGGATGG - Intronic
1145309535 17:21693823-21693845 CACAGAGGTTCAGAGATGGATGG - Intronic
1146111161 17:30090888-30090910 CCTACAGTTTTAGAGCTGGAAGG + Intronic
1147807203 17:43140238-43140260 TACACAGGGTGAGGTCTGGAAGG - Intergenic
1148033549 17:44640178-44640200 TACAAAATTTTAGATCTGGATGG - Intergenic
1148078687 17:44955322-44955344 TACACATGTTTGGAACTGGAAGG - Intergenic
1148169099 17:45504495-45504517 TACACAGGGTGAGGTCTGGAAGG - Intergenic
1148366424 17:47058879-47058901 TACACAGGGTGAGGTCTGGAAGG + Intergenic
1149691355 17:58579581-58579603 CACAGATGTTTAGAGCTGGGGGG - Intronic
1150036516 17:61805678-61805700 CACAGAATTTTAGAGCTGGAAGG - Intronic
1151221108 17:72613777-72613799 AACAGAGGTCTAGAGCTGGGGGG - Intergenic
1151489390 17:74423729-74423751 ATCACAGTTTTAGAGCTAGAGGG - Intergenic
1152087017 17:78226529-78226551 TACACCTGTTTTCAGCTGGATGG + Intergenic
1152123617 17:78433565-78433587 AACCCAGGTTTGGAGCAGGAGGG - Intronic
1152839788 17:82559810-82559832 TAAAAAGCTTTAGAGCAGGAAGG + Intronic
1153447225 18:5187911-5187933 TTCACAGGTTCACAGCTAGAGGG - Intronic
1155386156 18:25280061-25280083 ATCACAGGCTCAGAGCTGGAAGG + Intronic
1155450882 18:25961458-25961480 CACAGAAATTTAGAGCTGGAAGG - Intergenic
1157081605 18:44531519-44531541 CACAGAAGTTTAGAGGTGGAAGG + Intergenic
1157478742 18:48039568-48039590 TCCACAAATTTACAGCTGGAAGG + Intronic
1157656455 18:49394035-49394057 TAAAAAGTTTTAGAGATGGATGG + Intronic
1157868001 18:51203014-51203036 TACACAGGGTGAGATCTGGAAGG - Intronic
1157989151 18:52474274-52474296 CACACTGGTTTAAAGGTGGAGGG + Intronic
1157999734 18:52603383-52603405 TACAAAATTTTAGAGCTAGAAGG - Intronic
1158339271 18:56448068-56448090 CACAGAAATTTAGAGCTGGAAGG - Intergenic
1164833510 19:31340930-31340952 TACAGTGGTTGAGAGATGGAAGG - Intronic
1168011312 19:53535460-53535482 CACACATGCTTAGAGGTGGAGGG - Intronic
1168358606 19:55718896-55718918 CACACAGGATGAGATCTGGAAGG - Intronic
925668898 2:6290704-6290726 TACCCTGATTTAGAGCTGGGTGG - Intergenic
925802882 2:7618767-7618789 TGCAGAATTTTAGAGCTGGATGG - Intergenic
926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG + Intergenic
926467899 2:13214538-13214560 TTCACAGGTTCATAGGTGGAAGG - Intergenic
926690783 2:15731905-15731927 TACAAAGCTCTAGTGCTGGAGGG - Intronic
927083967 2:19656232-19656254 TTCACAGGCTTACAGCTGGAGGG - Intergenic
927966257 2:27271126-27271148 TGTACAGTTTTTGAGCTGGAAGG - Intronic
928926949 2:36589482-36589504 TATACAATTTTAGAGTTGGAAGG - Intronic
929208513 2:39326484-39326506 TATACAGGCTTATAGGTGGAAGG + Intronic
931122958 2:59240952-59240974 TAGACAAGTTTAGAGGTGGAAGG + Intergenic
932120961 2:69099736-69099758 TAAACAGGATTAGACCTGGTTGG + Intronic
932802121 2:74750250-74750272 TACACAGGGTGAGGTCTGGAAGG + Intergenic
933238966 2:79898067-79898089 TACAGGGGTTAAGAGTTGGATGG - Intronic
933821733 2:86118715-86118737 TACACAGCATTAGAGATGAAAGG + Intronic
935138665 2:100331863-100331885 TACACAATTACAGAGCTGGACGG + Intergenic
936508394 2:113126446-113126468 TGCAGTGTTTTAGAGCTGGACGG - Intronic
936732848 2:115405135-115405157 TTTACAGGCTTATAGCTGGAAGG - Intronic
936792438 2:116165415-116165437 TTGACAGGCTTAGAGGTGGAGGG + Intergenic
937436571 2:121886545-121886567 TACACAGGGTGAGGTCTGGAAGG + Intergenic
938186654 2:129238112-129238134 TACAAAGGCTCACAGCTGGATGG + Intergenic
939056196 2:137367563-137367585 TACAGAATTTTAAAGCTGGAAGG - Intronic
939936690 2:148301501-148301523 TAAAAAGCTTTAGAGCAGGAAGG + Intronic
940035580 2:149309475-149309497 TACACAGAGTGAGATCTGGAAGG + Intergenic
942592280 2:177558745-177558767 TTTACAGGCTTACAGCTGGAAGG + Intergenic
942662745 2:178283488-178283510 TAGAGAGGTTTATGGCTGGAAGG + Intronic
942803086 2:179898515-179898537 TCCACAGCTTTAGACCTGGTGGG + Intergenic
943517133 2:188903021-188903043 GACACAGGATCAGAGCTGGAAGG - Intergenic
944491617 2:200263433-200263455 TTTACAGGTTTATAGGTGGAAGG + Intergenic
946469159 2:219940283-219940305 TTCACAAGTTTGCAGCTGGAGGG + Intergenic
948306962 2:236955460-236955482 TAGAAAGCTTTAGAGCAGGAAGG - Intergenic
1169805903 20:9558879-9558901 TCCACAGTTTTAGAGGGGGAGGG + Intronic
1169920976 20:10733891-10733913 CACAAAGTTTTAGAGGTGGAAGG + Intergenic
1172006995 20:31824483-31824505 TACACAGATAGAGAGATGGATGG + Intronic
1173678933 20:44862382-44862404 TACACAGAAGAAGAGCTGGAGGG - Intergenic
1175359826 20:58400268-58400290 TTCTCAAGCTTAGAGCTGGAAGG - Intronic
1175644339 20:60658392-60658414 AACCCAGGCTTAGGGCTGGATGG + Intergenic
1179326606 21:40352559-40352581 TAAACAGGGTTAGGGCTGGGTGG + Intronic
1179804919 21:43831362-43831384 TGCACACGTTTTGACCTGGATGG - Intergenic
1180818906 22:18811537-18811559 TACACAGTCTTGGAGCTGAAAGG - Intergenic
1181088332 22:20455275-20455297 CACACAGCTGTGGAGCTGGAGGG - Intronic
1181205130 22:21245992-21246014 TACACAGTCTTGGAGCTGAAAGG - Intergenic
1183177326 22:36233528-36233550 TACACAGGAATAGAGATGGGAGG + Intronic
1183293475 22:37016933-37016955 TGCACACTCTTAGAGCTGGAGGG - Intronic
1185354717 22:50361070-50361092 TCCACAGGCTTAGAGATGGTGGG - Intronic
1203221795 22_KI270731v1_random:49423-49445 TACACAGTCTTGGAGCTGAAAGG + Intergenic
1203269031 22_KI270734v1_random:37390-37412 TACACAGTCTTGGAGCTGAAAGG - Intergenic
949487314 3:4552496-4552518 TACACAGGGTGAGGTCTGGAAGG + Intronic
949825108 3:8156889-8156911 AAGACAGGTTCAGAGATGGACGG + Intergenic
951076979 3:18406065-18406087 AACACATGTTTAGTGATGGATGG - Intronic
952024133 3:29057963-29057985 TACACAGGTTTTGTGCTGGTTGG - Intergenic
952773604 3:37023570-37023592 TATACAGGGCTAGATCTGGAAGG + Intronic
953206642 3:40836893-40836915 TTCACAGGCTTACAGCTGGAGGG - Intergenic
953616304 3:44493591-44493613 TTCATAGGTTCACAGCTGGAGGG + Intergenic
956560185 3:70566391-70566413 TAAAGAGTTATAGAGCTGGAAGG + Intergenic
956665744 3:71640604-71640626 TGCACAGGGTTAAGGCTGGATGG + Intergenic
957576610 3:82015741-82015763 TACACAAGCTTATAGGTGGAAGG + Intergenic
958682093 3:97344075-97344097 TTCACAGGTTCACAGGTGGAGGG + Intronic
960600481 3:119453094-119453116 TATACAGATTTAGAACTAGAAGG - Intronic
961067703 3:123890405-123890427 TTTACAGGTTTATAGGTGGAAGG - Intergenic
961181766 3:124883494-124883516 GGCACAGGTTTAGAGCTGACAGG - Intronic
962270478 3:133974593-133974615 TACCCATGTTTCCAGCTGGAAGG - Intronic
962354628 3:134683338-134683360 TATACAACTTCAGAGCTGGAAGG + Intronic
964097544 3:152950416-152950438 TTTACAGGTTTAGAGAGGGAAGG - Intergenic
964195844 3:154063319-154063341 TACACAATGTTAGAACTGGAAGG + Intergenic
964835965 3:160939253-160939275 TGCAGAGTTATAGAGCTGGAGGG - Intronic
964915738 3:161838959-161838981 TTCACAGGCTTGCAGCTGGAGGG + Intergenic
969163113 4:5279191-5279213 TTCACAGGCTTATAGGTGGAAGG - Intronic
969180418 4:5436384-5436406 TACACAGGTTTAGAGCTGAAAGG + Intronic
969180618 4:5437809-5437831 TACACAGGTTTAGAGCTGGAAGG - Intronic
969292198 4:6247018-6247040 TAAAAAGTTTTAGAGCAGGAAGG - Intergenic
969604347 4:8194947-8194969 AACACAGGTTTGGTGCTGGAAGG + Intronic
970317278 4:14841537-14841559 TTCACAGGCTCACAGCTGGAGGG - Intergenic
970559244 4:17266744-17266766 TAGAGAGGTTTAGAGTTTGATGG - Intergenic
971117477 4:23664807-23664829 TTCACAGGCTCACAGCTGGAGGG + Intergenic
971310572 4:25522501-25522523 TACTGAGGTTTGGAGCAGGAAGG + Intergenic
972758286 4:42074474-42074496 TACTGAGGGTTAGAGCAGGAGGG + Intronic
973580498 4:52339667-52339689 TGCACAGGCTTACAGTTGGAGGG + Intergenic
974011272 4:56609376-56609398 TTCACAGGTTCACAGCTGGAGGG + Intergenic
974742163 4:66021292-66021314 TTCACAGGCTCAGAGGTGGAAGG - Intergenic
975580194 4:75899803-75899825 TGCACAGTTTTAGAACTAGAAGG + Intronic
975799171 4:78041184-78041206 TTCACAGGTCTACAGATGGAGGG + Intergenic
976090652 4:81453778-81453800 CACACAGTTTCAGAGCTGAAAGG + Intronic
976387070 4:84473030-84473052 CTCAGAGTTTTAGAGCTGGAAGG - Intergenic
977716111 4:100185633-100185655 TACACAGGTCCAGAACTGGTGGG + Intergenic
977869209 4:102070136-102070158 TAAAAAGCTTTAGAGCAGGAAGG + Intronic
977989468 4:103423287-103423309 TGCACATGTTTAAGGCTGGAGGG + Intergenic
979056132 4:115997491-115997513 TAAAAAGGTTTAGAACAGGAAGG + Intergenic
980408138 4:132380770-132380792 TTCACAGGCTTATAGGTGGAAGG - Intergenic
980425045 4:132617779-132617801 TATACAGGTTCATAGGTGGAAGG - Intergenic
981072557 4:140559171-140559193 CACATAATTTTAGAGCTGGAGGG - Intergenic
981548153 4:145915806-145915828 TTTACAGGCTTACAGCTGGAGGG - Intronic
984058872 4:174966433-174966455 TTCACAGTTTCATAGCTGGAGGG - Intronic
985497005 5:214429-214451 AACATAGTTTTAGAGCTGAAAGG - Intronic
985973321 5:3394139-3394161 TCCACACGTCTCGAGCTGGAGGG + Intergenic
987493700 5:18615980-18616002 TTCACAGGTTCATAGGTGGAAGG - Intergenic
987728112 5:21729463-21729485 TACAGGGGTTTAGAGTGGGAGGG - Intergenic
988783557 5:34545255-34545277 TAAAAAGCTTTAGAGCAGGAAGG + Intergenic
989729464 5:44631335-44631357 TAAACATGTTTGGAACTGGAAGG + Intergenic
991007756 5:61846525-61846547 TTCACAGGCTCAGAGCTGGAGGG + Intergenic
991030541 5:62077781-62077803 TAAAAAGCTTTAGAGCAGGAAGG - Intergenic
991468578 5:66942621-66942643 CAAACAGCTTTAGATCTGGAAGG - Intronic
991547238 5:67795972-67795994 TTCACAGGCTCACAGCTGGAGGG + Intergenic
992311040 5:75499152-75499174 TTCACAGGTTCACAGGTGGAGGG + Intronic
995452877 5:112321888-112321910 TACACAGGTTTAAAGGTGGGAGG - Intronic
995460456 5:112398124-112398146 CACACAGCTTTCGAGATGGAAGG + Intronic
996644244 5:125795353-125795375 TAAACAGGCTTTGAGCTGCAAGG + Intergenic
996836590 5:127800551-127800573 CACACAGGTTTAGAGATGGCTGG + Intergenic
1000047372 5:157532781-157532803 TACTCAGGATTAGAGCTGGGAGG - Intronic
1000242220 5:159419129-159419151 TTCACAGGCTGACAGCTGGAGGG - Intergenic
1000358116 5:160420469-160420491 TACAGAGGTTTTGAGGTGCAAGG - Intronic
1001360600 5:171081962-171081984 TACACAATTTTAGAGTTAGAAGG - Intronic
1001522505 5:172404613-172404635 CACAGATATTTAGAGCTGGACGG - Intronic
1001672215 5:173483229-173483251 GACCAAGGTTTAGAGCTGGAAGG - Intergenic
1001977110 5:176009190-176009212 TACACAGGTTTAGGATTGGCTGG - Intronic
1002240317 5:177834590-177834612 TACACAGGTTTAGGATTGGCTGG + Intergenic
1005080412 6:21951691-21951713 GACAGAGGTTTAGGGCTGGTAGG + Intergenic
1005173533 6:23016250-23016272 TTCACTTGTTTAGAGTTGGAGGG - Intergenic
1005289174 6:24361529-24361551 TGCACAGGTTGAGGGATGGATGG + Intergenic
1007017957 6:38488405-38488427 TATCCAGGTTTAGAGCTGCAAGG + Intronic
1008893543 6:56524584-56524606 CACAGATGTTTAGAGCTGGGAGG - Intronic
1009705528 6:67245724-67245746 TAAACAGATTTACAGATGGAAGG + Intergenic
1010842676 6:80665850-80665872 TACACAGCAGTAGAGCTGGGTGG + Intergenic
1011018247 6:82782354-82782376 TTCACAGGCTCACAGCTGGAGGG + Intergenic
1011935426 6:92770638-92770660 TTCACAGGCTCACAGCTGGAGGG + Intergenic
1013077948 6:106788092-106788114 CCCACAGGCTTAGAGCTGGGAGG - Intergenic
1013136584 6:107288546-107288568 TAAACAGATTTAGATTTGGAGGG + Intronic
1013850170 6:114504595-114504617 TTCACAGGTTCACAGCTAGAGGG - Intergenic
1015014243 6:128391182-128391204 TTCAGATGTTTAAAGCTGGAAGG - Intronic
1015772945 6:136787458-136787480 TACAGAATTTGAGAGCTGGAGGG + Intronic
1015936101 6:138407253-138407275 TTCACAGGTTCATAGATGGAGGG - Intronic
1019826164 7:3286125-3286147 CACAGAATTTTAGAGCTGGAAGG - Intergenic
1020730262 7:11870545-11870567 TTCACAGGTTTATAGGTGGAAGG + Intergenic
1024407446 7:48998734-48998756 TACATAGGGTGAGATCTGGAAGG - Intergenic
1024414067 7:49081862-49081884 TTCACAAGTTCACAGCTGGAGGG - Intergenic
1024431611 7:49294853-49294875 TTCACAGGGTTACAGCTGGAGGG - Intergenic
1024489224 7:49958151-49958173 TTCACAGGGTCACAGCTGGAGGG + Intronic
1024966753 7:55029824-55029846 TACAGATGTTTTCAGCTGGAAGG - Intronic
1025483001 7:61009234-61009256 TACACAGGTTTATAGCCTGGGGG + Intergenic
1027141434 7:75660596-75660618 TACAGAGGTTAAGAGCAGGGAGG + Intronic
1027663510 7:81016432-81016454 TTCACAGGCTCACAGCTGGAGGG - Intergenic
1031825447 7:126559713-126559735 TACTCAGATTTACAGGTGGAAGG - Intronic
1033165806 7:139037782-139037804 TATACAGGTCTAGACCTTGAGGG + Intergenic
1037393172 8:18416084-18416106 TTTACAGGTTTACAGCTGAAGGG - Intergenic
1037961006 8:23098289-23098311 TACACAGGTGTAGAACTAGTGGG + Intronic
1038280311 8:26158387-26158409 TACACAGGCTTATAGGTGGAAGG - Intergenic
1038625645 8:29190483-29190505 TACAGAGGGTGAGATCTGGAAGG - Intronic
1039232320 8:35461922-35461944 TTCAGATGTTTAGAACTGGAAGG + Intronic
1039506888 8:38058714-38058736 TTCACAGGCTCACAGCTGGAAGG - Intronic
1039698448 8:39937810-39937832 TACACATGTTTTGAGATGGCAGG - Intronic
1040106177 8:43543428-43543450 TAGATAGGTATAGAGATGGATGG - Intergenic
1040557493 8:48494206-48494228 TACACAGAGTCAGAGCTGAACGG + Intergenic
1040558142 8:48499188-48499210 TAGACAGGTTTCTAGCTAGATGG - Intergenic
1040724704 8:50368932-50368954 TTCACAGGCTCAGCGCTGGAGGG + Intronic
1043649663 8:82575598-82575620 TTCACAGGTTCACAGCTGGAGGG - Intergenic
1043728359 8:83642334-83642356 TACACAGGTTTAGCTTAGGAAGG + Intergenic
1044581370 8:93829560-93829582 CACATAGGCTTAGAGCTGGTTGG + Intergenic
1045666009 8:104485480-104485502 CACAGAATTTTAGAGCTGGAAGG - Intergenic
1047766286 8:127992650-127992672 TAGACAGGTCAGGAGCTGGAAGG - Intergenic
1047846366 8:128809959-128809981 TTCACAGGTTCAGAGGTGCAGGG + Intergenic
1047850799 8:128855185-128855207 AACACGGGTTTAGAGAGGGAGGG + Intergenic
1047980003 8:130171260-130171282 TACACAGGTATAGAGGGGAAGGG - Intronic
1050067060 9:1771299-1771321 TTCACAGGCTTACAGCTGGAGGG - Intergenic
1051104310 9:13561151-13561173 TTCAGAGATTTGGAGCTGGAAGG + Intergenic
1051187395 9:14474649-14474671 TTAACGGGTTTATAGCTGGAGGG - Intergenic
1051920784 9:22260873-22260895 TTCACAGGCTTATAGCTGGAAGG + Intergenic
1052422455 9:28260585-28260607 CACACAGGTTTAGATCTTGGTGG + Intronic
1052792014 9:32884287-32884309 TCAACAGGGTTAGAGCTGAAAGG - Intergenic
1053200101 9:36146553-36146575 TTCACAGGCTCACAGCTGGAAGG - Intronic
1053576790 9:39362555-39362577 TACACATGCACAGAGCTGGAAGG - Intergenic
1053841303 9:42190480-42190502 TACACATGCACAGAGCTGGAAGG - Intergenic
1054098360 9:60921246-60921268 TACACATGCACAGAGCTGGAAGG - Intergenic
1054119761 9:61196876-61196898 TACACATGCACAGAGCTGGAAGG - Intergenic
1054587993 9:66985686-66985708 TACACATGCACAGAGCTGGAAGG + Intergenic
1055223923 9:73970622-73970644 TTCACAGGTTTATGGGTGGAAGG + Intergenic
1055986014 9:82056877-82056899 TACACATGCACAGAGCTGGAAGG + Intergenic
1056585322 9:87924254-87924276 TACACATGCACAGAGCTGGAAGG - Intergenic
1056611559 9:88128686-88128708 TACACATGCACAGAGCTGGAAGG + Intergenic
1057935589 9:99236083-99236105 GTCACAGCTGTAGAGCTGGAAGG + Intergenic
1057969898 9:99544927-99544949 TTCACAGGCTCACAGCTGGAGGG - Intergenic
1058435047 9:104954873-104954895 TACAGACCTTCAGAGCTGGAGGG - Intergenic
1058450839 9:105094819-105094841 TACAGAGGTGTAGAGATGGGAGG - Intergenic
1059231508 9:112725530-112725552 TTCACAGGATCACAGCTGGAGGG - Intergenic
1059877211 9:118647823-118647845 CTCACAGGTTTATAGCTGGAAGG + Intergenic
1060783812 9:126433390-126433412 GACACAGGTTTATAGCAGCAAGG - Intronic
1062078382 9:134604905-134604927 TTCACAGGCTCACAGCTGGAGGG - Intergenic
1187036432 X:15545260-15545282 TAAAAAGTTTTAGAGCAGGAAGG + Intronic
1187192179 X:17045630-17045652 TAAAGAGGTTGAGAGCTGTAGGG - Intronic
1188284494 X:28311561-28311583 TAAAAAGCTTTAGAGCAGGAAGG + Intergenic
1188322915 X:28761928-28761950 GAAACAGGTTTAGAGATGTAAGG - Intronic
1188517470 X:31003158-31003180 TTCACAGATTCACAGCTGGAAGG - Intergenic
1189177841 X:38975750-38975772 AGCACAGGTTTAGAGATGGGAGG + Intergenic
1189184199 X:39038120-39038142 TCAACAGGTTTGGAGGTGGATGG - Intergenic
1189963687 X:46350217-46350239 TTCACAGGTTCACAGCTGGCAGG - Intergenic
1189971278 X:46420633-46420655 TTCACAGGCTTATGGCTGGAGGG - Intergenic
1190703468 X:53005803-53005825 TTTACAGGTTTATAGGTGGAAGG - Intergenic
1191903779 X:66065901-66065923 TACAGAGGTTAAGAAATGGAGGG + Intergenic
1192234010 X:69284836-69284858 TACCCTGGGGTAGAGCTGGAGGG + Intergenic
1193371940 X:80709083-80709105 TACACAGTTTCAGAACTGGTTGG - Intronic
1194500099 X:94672224-94672246 TTCACAGCTTTATAGGTGGAAGG - Intergenic
1194505961 X:94733654-94733676 TTCACAGTTTCACAGCTGGATGG + Intergenic
1194592779 X:95820221-95820243 TACACAGGTTAAGAGGTATAGGG + Intergenic
1194684077 X:96890255-96890277 CACAGAGGCTTAGAGCTGGAAGG - Intronic
1196492815 X:116288868-116288890 CACAGGGGTTTAGAACTGGAAGG - Intergenic
1196734507 X:118972771-118972793 CACTCAAGGTTAGAGCTGGAGGG + Intergenic
1197673026 X:129299274-129299296 TTCACAGGTTCATAGCTGGAAGG + Intergenic
1197819060 X:130528249-130528271 TTTACAGATTTACAGCTGGAGGG - Intergenic
1197827517 X:130605998-130606020 TCCACAGGTTTGGAGGCGGATGG + Intergenic
1197872070 X:131070168-131070190 CAGACAGGCTTAGAGGTGGAGGG - Intronic
1197991960 X:132328416-132328438 TTCACAGGCTTACAGCTAGAAGG - Intergenic
1199970783 X:152859311-152859333 GAAAAAGGTTTAGAGATGGATGG - Intronic