ID: 969182413

View in Genome Browser
Species Human (GRCh38)
Location 4:5452264-5452286
Sequence CAGAGAGGCCAGCGAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 1, 2: 3, 3: 40, 4: 298}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969182400_969182413 29 Left 969182400 4:5452212-5452234 CCCCAGTCAGCACTTCTCCTTAG 0: 1
1: 0
2: 0
3: 17
4: 159
Right 969182413 4:5452264-5452286 CAGAGAGGCCAGCGAGTGGAGGG 0: 1
1: 1
2: 3
3: 40
4: 298
969182403_969182413 27 Left 969182403 4:5452214-5452236 CCAGTCAGCACTTCTCCTTAGGA 0: 1
1: 0
2: 0
3: 6
4: 118
Right 969182413 4:5452264-5452286 CAGAGAGGCCAGCGAGTGGAGGG 0: 1
1: 1
2: 3
3: 40
4: 298
969182401_969182413 28 Left 969182401 4:5452213-5452235 CCCAGTCAGCACTTCTCCTTAGG 0: 1
1: 0
2: 0
3: 13
4: 124
Right 969182413 4:5452264-5452286 CAGAGAGGCCAGCGAGTGGAGGG 0: 1
1: 1
2: 3
3: 40
4: 298
969182406_969182413 12 Left 969182406 4:5452229-5452251 CCTTAGGAATGGGTAGACAGAGA 0: 1
1: 0
2: 1
3: 14
4: 202
Right 969182413 4:5452264-5452286 CAGAGAGGCCAGCGAGTGGAGGG 0: 1
1: 1
2: 3
3: 40
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969182413 Original CRISPR CAGAGAGGCCAGCGAGTGGA GGG Intronic
900001221 1:15896-15918 CAGAGTGGCCAGCCACCGGAGGG + Intergenic
900251219 1:1671033-1671055 CAGCGAGGACAGCGCGTGGCAGG - Intronic
900685510 1:3945454-3945476 CAGAGAGGGCAGCAGGTGGTGGG - Intergenic
901050385 1:6423315-6423337 CCGTGAGGCCAGCAAGTGGCAGG - Intronic
901508807 1:9703995-9704017 CAGAGATGCCAGTGAGTACAGGG - Intronic
901653834 1:10757938-10757960 CAGAGTGGCCAGGACGTGGATGG - Intronic
901883055 1:12205162-12205184 GAGGGAGGCCAGGGGGTGGAGGG + Intronic
901905467 1:12405582-12405604 CAGACAGGGCAGTGAGTGAAGGG - Intronic
902155098 1:14478745-14478767 AAGGGAGGCCAGCTGGTGGATGG - Intergenic
902277138 1:15347954-15347976 CAGAGAAGCCACCCAGAGGAAGG + Intronic
902778353 1:18689160-18689182 CAGCGAGGCCAGCCCGTGGATGG - Intronic
903878537 1:26492805-26492827 GAGACAGGCCAGGAAGTGGAGGG + Intergenic
904205936 1:28855344-28855366 CAAAGAGGCCAGTGTGTGGCAGG + Intronic
904325820 1:29727173-29727195 GAGAGAGGCCTGGCAGTGGAGGG + Intergenic
904418751 1:30378177-30378199 CAGAGAGGCCAGGGCCTGGGAGG + Intergenic
904561079 1:31397675-31397697 CAGTGAGGCCAGGAAGTTGAGGG - Intergenic
905329331 1:37181351-37181373 CTGAGAGGCCAGGGATTGGAGGG - Intergenic
906391846 1:45424289-45424311 CAGAGAGGCCAGGCAGAAGAGGG + Intronic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
907513303 1:54978337-54978359 CAGAGAGGCCAGTGAGAGGCAGG + Intergenic
909931405 1:81503446-81503468 CAGAGGGACCAGCTGGTGGAGGG - Intronic
912044406 1:105436892-105436914 GGGAGAGGCCAGGCAGTGGAAGG - Intergenic
915064775 1:153215775-153215797 GACAGAGGCCTGAGAGTGGAAGG - Intergenic
915805782 1:158848006-158848028 CAGAGAGTCCAGCGAGTGGAAGG + Intronic
917435964 1:175021675-175021697 GAGAGGGGCCAGAGAGTTGATGG - Intronic
918125546 1:181580440-181580462 CAGAGAGGCCAGGGAGGAGAGGG + Intronic
919463984 1:197910593-197910615 CAGCGAGGCCATCGAATGGATGG - Intergenic
919910306 1:202106915-202106937 AAGAGAGGACAGGGTGTGGAAGG + Intergenic
919976306 1:202615299-202615321 CAGTGGGCCCAGAGAGTGGATGG + Intronic
922100473 1:222474014-222474036 CAGAGAGGCCGCCGAGAGGCCGG + Intergenic
1065204465 10:23344127-23344149 CGGGGAGGGCCGCGAGTGGAGGG + Intronic
1065850085 10:29780593-29780615 CAGAGAGGTGAGGGAGTGGATGG - Intergenic
1066206753 10:33197022-33197044 CACAAAGGCCAGTGAGAGGAAGG + Intronic
1066300354 10:34090511-34090533 AAGAGAGGCCAGCATGTAGAAGG - Intergenic
1066453294 10:35550514-35550536 CAGGGAGGCCAGGGAGAGAAGGG - Intronic
1067280027 10:44864296-44864318 CCCAGAGGCCAGCGAGTGTCAGG - Intergenic
1068542747 10:58313516-58313538 CAGAGAGGCAAGCTAGAGTATGG - Intergenic
1069774729 10:70919693-70919715 CAGAGAGGCCAGCCAGAGAATGG - Intergenic
1070791273 10:79190918-79190940 AACAGAGGCCAGAGAGGGGAGGG - Intronic
1070923621 10:80204522-80204544 CAGAGAGGTCAAGGATTGGAGGG + Intronic
1071335013 10:84593561-84593583 CAGGGAGGCGAGGGAGTGGAGGG - Intergenic
1071906408 10:90179297-90179319 CAGAGAGGTCAGAATGTGGAAGG + Intergenic
1072799936 10:98385748-98385770 CACAGAGGCCAGGGGGAGGAAGG - Intronic
1073136611 10:101223886-101223908 CAGAGAAGAGAGCCAGTGGAAGG - Intergenic
1073580791 10:104663893-104663915 CAGAGAGGCCGGGGTGGGGAAGG - Intronic
1074232168 10:111548551-111548573 CAGAGAGGCCAGAGAGAAAAGGG - Intergenic
1075521509 10:123146416-123146438 CCGGGAGGCCAGCGAGGGGCAGG - Intergenic
1075800698 10:125151877-125151899 CACAAAGGCCAGCGGGAGGAAGG + Intronic
1076480573 10:130782662-130782684 CAGAGAGACCAGCAGGGGGAGGG + Intergenic
1076528457 10:131127597-131127619 CAGAGATGCCAGGGAATGGAGGG + Intronic
1076586474 10:131551839-131551861 CAGAAAGGCCAGCCTGTGGCCGG + Intergenic
1077065152 11:637766-637788 CAGACAGCGCAGCGGGTGGAAGG - Intronic
1077360533 11:2138589-2138611 GAGAGAGGACAGCGAGAGGCGGG + Intronic
1077539900 11:3141582-3141604 CAGAGAGGACAGGGAGGGGCTGG + Intronic
1077848047 11:6046574-6046596 CAGAGAGGCCTCCAGGTGGATGG + Intergenic
1078130618 11:8611253-8611275 CAGAGAGGACAGCGAGGGATAGG + Intergenic
1078328348 11:10398417-10398439 CAGGGAGGCCAGAGGGTGCATGG + Intronic
1078522629 11:12075619-12075641 CAAAAAGGACAGAGAGTGGATGG - Intergenic
1078670829 11:13363786-13363808 CACAGGGGCCAGCCAGTGGCAGG - Intronic
1078857626 11:15219568-15219590 CAGAGAGGCCAAGGATTTGATGG - Intronic
1079315524 11:19404947-19404969 CAGAGAGCACAGAGAGAGGAGGG - Intronic
1079919096 11:26409158-26409180 CAGAGAAGCCATCCAGAGGAAGG - Intronic
1081996952 11:47371873-47371895 CAGAGAGGCCAGTGAGCACAGGG - Intronic
1082260349 11:50073007-50073029 CAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1082883985 11:58065112-58065134 CAGAGGGGCTATGGAGTGGACGG + Intronic
1084031999 11:66486696-66486718 CCGAGGGGACAGGGAGTGGAGGG + Intronic
1084313489 11:68330477-68330499 CAGAGATTCCAGCAAGAGGAGGG - Intronic
1084322375 11:68380785-68380807 CACAGAGGCCAGAGAGAGGGTGG - Intronic
1084650160 11:70484890-70484912 CCAAGAGGGCAGCGAGTGGGTGG - Intronic
1085464952 11:76716913-76716935 CAGAGAGGGCTGGGATTGGAAGG + Intergenic
1087007441 11:93483510-93483532 GAGAGAGGCCTGGGGGTGGAGGG + Intronic
1089303299 11:117511652-117511674 CAGAGAGGAGAGAGGGTGGAGGG - Intronic
1090805018 11:130197538-130197560 CAGAGAGGCCAGCTGGTCGCAGG - Intronic
1090846114 11:130531300-130531322 CAGAGAGGCCATCCTGTGGTTGG + Intergenic
1090968287 11:131617209-131617231 CAGAGAGTGCTGAGAGTGGAGGG + Intronic
1091143862 11:133260207-133260229 CATTGGGGCCAGTGAGTGGAGGG + Intronic
1096245268 12:49981386-49981408 CAGCCAGGCCAGCGTGTGGCAGG + Intronic
1101598756 12:106190090-106190112 CATAGAGGCCAGAGGGTGGCTGG + Intergenic
1101937482 12:109069962-109069984 CAGGGAGGCCAGGGCGGGGAGGG + Intronic
1102473982 12:113176763-113176785 CAGAGAGGTCAACCAGAGGAAGG - Intronic
1104357529 12:128101082-128101104 CAGAGAGGCCAACATGGGGAGGG - Intergenic
1104951485 12:132442608-132442630 CAGAGACGCCAGAGTGTGGGGGG - Intergenic
1107795529 13:44047401-44047423 GAGAGAGGCTATGGAGTGGAAGG + Intergenic
1112320234 13:98399675-98399697 CAGAGCAGCCAGTGAGTGGCTGG - Intronic
1112326141 13:98443894-98443916 CAGTGAGGCCAGGGAGTGGCGGG + Intronic
1112368529 13:98775052-98775074 CACAGAGGGCAGTGGGTGGAGGG + Intergenic
1113465562 13:110510328-110510350 GAGAGAGGCCACCGAGGGGAGGG - Intronic
1113618075 13:111695109-111695131 CAGAGAGCGGAGAGAGTGGAGGG - Intergenic
1113623608 13:111780370-111780392 CAGAGAGCGGAGAGAGTGGAGGG - Intergenic
1113885324 13:113655847-113655869 CAGAGAAGCAAGGGAGTGCAGGG + Intronic
1115724307 14:36196050-36196072 CAGAGAGGCCAGCAAGAACAAGG - Intergenic
1115734371 14:36308760-36308782 CAGAAAGGCCACAGTGTGGAGGG - Intronic
1117038875 14:51752265-51752287 CAGAGATGCCAGAGTGTGGAGGG + Intergenic
1117268468 14:54115683-54115705 CAGAGAGGCAAGCTAGTGAGTGG - Intergenic
1121307952 14:92918626-92918648 CAGAGAGGCCGGAGTGTGGCAGG + Intergenic
1121467654 14:94126393-94126415 CCGAGAAGCCAGCGAGAGGAAGG - Intergenic
1122079218 14:99255436-99255458 CAGGGGGGCCAGGGGGTGGAAGG + Intronic
1122750279 14:103928138-103928160 TAGAGAGGCCAGGGAGTGACCGG + Intronic
1123028561 14:105439912-105439934 CAGAGGGGGCAGCGGGGGGAAGG + Intronic
1124491953 15:30163650-30163672 CAGTGGGCCCAGAGAGTGGATGG + Intergenic
1124751584 15:32374667-32374689 CAGTGGGCCCAGAGAGTGGATGG - Intergenic
1126188658 15:45855808-45855830 CAGAGAGGCAACCTAGTGAATGG + Intergenic
1128151754 15:65367621-65367643 GAGAGTGGCCAGCGGGTGGCGGG - Intronic
1129183208 15:73889892-73889914 CAGAGGGGCCAGCTAGAGCATGG - Intergenic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129295069 15:74595751-74595773 CAGAGGGACCAGCTGGTGGAGGG - Exonic
1129523741 15:76201313-76201335 CAGAGTGGCCTGAGAGTGGGAGG - Intronic
1130147827 15:81288050-81288072 CAGAGAGGCCACAGAGGTGAGGG + Intronic
1130970036 15:88725202-88725224 CAGAGAAGCCAGGGAGAGCAAGG + Intergenic
1131033220 15:89203860-89203882 CAGAGAGGCCAGTTAATGAAAGG - Intergenic
1131166556 15:90145850-90145872 CAGAGAGGCAAGAGAGGGGATGG + Intergenic
1132088728 15:98929865-98929887 CAGAAAAGCCAGCCAGGGGAAGG - Intronic
1132336964 15:101053875-101053897 CAGAGTGGCCAGAGGGTGAAAGG + Intronic
1132770418 16:1559084-1559106 CAGAGAGGCGATGGAGTGGAGGG + Intronic
1132880746 16:2160741-2160763 CAGAGAGGCCAGAGAATTGAAGG + Intronic
1133056301 16:3147189-3147211 CACAGAGGGCAGCCAGTGGCTGG + Intronic
1133286281 16:4692296-4692318 GCGAGAGGGCAGCGAGGGGAAGG - Intergenic
1133837101 16:9377192-9377214 CAGAGAGGCAGCAGAGTGGATGG - Intergenic
1134136976 16:11683467-11683489 CTGAGAGACAAGCAAGTGGAAGG + Intronic
1135046917 16:19163495-19163517 CAGGGAGGCCAGTGAGGAGATGG - Intronic
1135619077 16:23937812-23937834 CAGAGAAGCCAGCAAGGGAAGGG + Intronic
1136073170 16:27801088-27801110 CAGAGAGAACAGCAAGTGCAAGG + Intronic
1136271193 16:29149183-29149205 CAAAGAGGCCAGCGTGAGGAAGG + Intergenic
1138213644 16:55184066-55184088 GAGAGGGGTCAGAGAGTGGATGG + Intergenic
1139356974 16:66372406-66372428 GAGAGAGGACAGCAAGTGCACGG + Intronic
1139529431 16:67535806-67535828 CAGAGAGGCCAGCGATAGGCAGG + Intronic
1139758672 16:69166419-69166441 CAAAGAGGCAAGAGAGTGGGAGG - Intronic
1141039515 16:80660966-80660988 CTGAGAGGGCAGGAAGTGGAGGG + Intronic
1141765852 16:86059737-86059759 CAGGGAGGCCTGTGAGTGGGAGG + Intergenic
1141883993 16:86879352-86879374 CAGAAAGGCCCGGAAGTGGACGG + Intergenic
1142074806 16:88111172-88111194 CGAAGAGGCCAGCGTGAGGAAGG + Intronic
1142141977 16:88476523-88476545 CAGAGAGGGCAGCCAGGGCAGGG + Intronic
1142869317 17:2809921-2809943 CAGAGGAGCCAGCGGGAGGAAGG - Intronic
1143358313 17:6347477-6347499 AAGAGAGGCCAGGGTATGGAAGG - Intergenic
1143743254 17:8969706-8969728 CAGAGAGGACAGAGAGAGGAAGG - Intergenic
1144560249 17:16315412-16315434 CAGAAAGGCCAGAGTGAGGAGGG - Intronic
1146459394 17:33033589-33033611 TAGAGAGGCCAGGCAGTGGGAGG - Intronic
1146668826 17:34722900-34722922 CAGTGAGGCCAGCCAGTGGGAGG + Intergenic
1147122455 17:38343676-38343698 CAGAGGGGGCAGAGAGCGGATGG + Exonic
1147137272 17:38441540-38441562 CAGAGAGGGCGGGGACTGGAGGG + Intronic
1150699738 17:67436500-67436522 TAGGGAGGCCAGGGAGGGGAAGG + Intronic
1151440953 17:74128781-74128803 CAGAGAGGACAGAGAGGGCAAGG + Intergenic
1151671438 17:75573666-75573688 CAGAGAGGGCAGGGAGGGGCGGG - Intronic
1152063724 17:78098385-78098407 CAGAGAGGCTTGCGTGTGGGAGG - Exonic
1153813143 18:8769671-8769693 CAGCCTGGCCAGCAAGTGGAAGG - Intronic
1154370628 18:13758929-13758951 CAGAGAGGCCAAGGAGAGGGAGG + Intronic
1157300846 18:46477957-46477979 CAGAGAGGTGGGAGAGTGGAGGG + Intronic
1159456782 18:68669366-68669388 CAGGGGGACCAGCGAGTGCAAGG + Intergenic
1159766004 18:72489223-72489245 CAGAGAGGCCAGAGTGTGGGGGG + Intergenic
1159930727 18:74310629-74310651 CTGAGAGGGCACCTAGTGGAAGG - Intergenic
1159954946 18:74512675-74512697 CAGAGGGACAAGTGAGTGGAAGG - Intronic
1160411898 18:78680884-78680906 CAGAGAGGCCGGCTGGTGGTGGG - Intergenic
1160939005 19:1611483-1611505 GAGCGAGGCCAGTGAGTGGTAGG + Exonic
1160944375 19:1634416-1634438 GGGAGAGGCCTGCGAGTGGACGG + Intronic
1161673087 19:5625026-5625048 CAGAGATGACAGCGAGTGATGGG - Intronic
1162829576 19:13276016-13276038 CCGAGAGGCTAGAGAGTGGGTGG - Intronic
1163770695 19:19189335-19189357 CAGAGAGGCCAGGGAGAAGGTGG - Intronic
1164050881 19:21585281-21585303 CAGAGAGGCCAGTGAGAGGCAGG + Intergenic
1164611566 19:29636200-29636222 CAGAGAGGCCAGGAAGTGAGGGG - Intergenic
1164971004 19:32532501-32532523 CAGAGAAGCCAAAGACTGGAAGG + Intergenic
1165133039 19:33645160-33645182 CAGAGAGGGCACCCAGTGAAAGG + Intronic
1165256448 19:34579479-34579501 CAGAGGGGTCAGAGAATGGATGG + Intergenic
1165259162 19:34597970-34597992 CAGAGGGGGCAGAGAATGGAGGG + Intronic
1167205018 19:48095563-48095585 CAGAGAAGCCAGCGTGGTGAGGG + Exonic
1167497423 19:49827800-49827822 CAGACAGCCCAGAGAGGGGAGGG + Intronic
1167752256 19:51388140-51388162 CACAGAGGTCAGTGAGTGGGTGG - Intergenic
1167761022 19:51449358-51449380 CACACAGGCCAGCAAGTAGAGGG - Intergenic
1168714039 19:58516884-58516906 CAGCGAGGCCAGTGGGTGCAGGG + Exonic
925154156 2:1637388-1637410 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154165 2:1637462-1637484 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154201 2:1637684-1637706 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154217 2:1637759-1637781 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925476068 2:4216390-4216412 TACAGAGGCCAGAGTGTGGATGG + Intergenic
927398274 2:22681250-22681272 CGGAGAGGGCAGTGACTGGAAGG - Intergenic
927488613 2:23505774-23505796 AAGAGAGGCCAGAGAATGGTGGG + Intronic
927744406 2:25603744-25603766 CAGAGAGTCCAGTCAGTAGAAGG + Intronic
928518180 2:32063584-32063606 CGGAGAGGACAGCGACAGGAAGG + Intergenic
928683600 2:33727083-33727105 CACATAGGCCAGCAAGTTGACGG + Intergenic
929609277 2:43257917-43257939 CAGAGAAGCCAGTGGGAGGAAGG + Intronic
932430646 2:71671983-71672005 AAGAGAGGTCAGAGAGTGGAAGG + Intronic
932706672 2:74031318-74031340 CAGACAGGCCAGAGAGACGAGGG + Intronic
934660872 2:96143058-96143080 CAGAGGGGCCAGCGGCCGGAAGG - Intergenic
934790541 2:97056034-97056056 CACAGAAGGCAGCGAGTGTAAGG - Intergenic
934815924 2:97326497-97326519 CACAGAAGGCAGCGAGTGTAAGG + Intergenic
934821771 2:97381986-97382008 CACAGAAGGCAGCGAGTGTAAGG - Intergenic
936147160 2:109987605-109987627 CAGAGAGGCCAGTGGGTGCATGG + Intergenic
936166504 2:110124655-110124677 CAGAGAGCACAGCAAGTTGAGGG + Intronic
936197532 2:110383878-110383900 CAGAGAGGCCAGTGGGTGCATGG - Intergenic
937247488 2:120503058-120503080 GAGAGAGGCAAGCCAGCGGAGGG - Intergenic
937855924 2:126671992-126672014 CAGAGAGCACAGCAAGTGCAAGG + Intronic
938110249 2:128559610-128559632 CAGAGGAGGCAGCGAGTGCAAGG + Intergenic
938143430 2:128813872-128813894 CAGTGGGGCCAGTGAGTGAAAGG - Intergenic
939005762 2:136785157-136785179 TGCAGAGGCCAGTGAGTGGAAGG - Intronic
939245080 2:139613108-139613130 CAGAGAGATCAGCCACTGGATGG + Intergenic
940005574 2:149006812-149006834 CAGGGAGGCTAGAGAGGGGAGGG + Intronic
942492026 2:176498992-176499014 CAGAGAGGGGAGAAAGTGGAGGG - Intergenic
942798243 2:179846593-179846615 CTGAGAGGCCAGCCTGTAGAGGG - Intronic
945067862 2:205962191-205962213 CAGGGTGGCCAGTCAGTGGATGG - Intergenic
947831063 2:233142178-233142200 CAGAGCAGCCACCCAGTGGAGGG + Intronic
948045486 2:234940556-234940578 CTGGGAGGGCAGAGAGTGGAGGG - Intergenic
948371785 2:237494257-237494279 GGCAGAGGCCAGAGAGTGGAGGG + Intronic
948395301 2:237640864-237640886 AAGAGAGGCCAGGGGTTGGAAGG - Intronic
1168912317 20:1458785-1458807 CACAGAGACCAGAGAGTTGAAGG + Intronic
1170633294 20:18083409-18083431 AAGGGAGGCCAGGGAGTGGTCGG - Intergenic
1172215977 20:33236058-33236080 CAGAGGGGCCACAGAATGGATGG - Intronic
1172311078 20:33918887-33918909 CAGGGAGGCCAGGGAGGGGCTGG - Intergenic
1173337235 20:42122656-42122678 CAGGGAAGCCAGCTAGTGGTTGG - Intronic
1174203950 20:48826341-48826363 AAAAGTGGCCAGCGGGTGGAGGG - Intronic
1175252383 20:57617213-57617235 CAGACAGGCCAGCACTTGGAGGG - Intronic
1175419296 20:58821255-58821277 CAGAGGGGACAGCCAGTGGAAGG - Intergenic
1175987661 20:62771947-62771969 CAGAGTGGCCGCCGAGGGGACGG + Intergenic
1175988041 20:62773968-62773990 CGAAGAGGCCAAAGAGTGGAGGG - Intergenic
1176045103 20:63088491-63088513 CAGAGCGTCCTGAGAGTGGAAGG + Intergenic
1177348122 21:19900101-19900123 CAGGGAGGCCGGCGGGGGGAAGG - Intergenic
1178589917 21:33900943-33900965 CACACAGACCAGAGAGTGGATGG + Intronic
1179179127 21:39030549-39030571 CAGAGGGGCCAGCGAGGTGTGGG - Intergenic
1179241792 21:39599360-39599382 CAGAGAGGCCAGGGATGGAAGGG - Intronic
1180850362 22:19016212-19016234 CAGAGAGGCCAGCCAGTGCGGGG + Intergenic
1182249071 22:28985119-28985141 CAGAGACAGCAACGAGTGGAGGG - Intronic
1182517462 22:30867170-30867192 CAGAGAGGCCAGGAAGGGGTGGG - Intronic
1183182665 22:36271503-36271525 CAGAGAGGGCACCTAGGGGAAGG - Intergenic
1183985637 22:41568771-41568793 CAGAGAGACCAGAGAGCAGAAGG - Intronic
1184406684 22:44304536-44304558 CAGAGAGGCCTGCGGGTGGATGG - Intronic
1184468457 22:44682464-44682486 CAGAGAGGCCAGCGGGGACATGG - Intronic
1184479521 22:44738425-44738447 ATGAGAGGCGAGCGCGTGGAAGG - Intronic
1184738717 22:46414535-46414557 CCGAGAGGCGGGAGAGTGGACGG - Intronic
1184738726 22:46414585-46414607 CCGAGAGGCGGGAGAGTGGACGG - Intronic
1185109519 22:48893328-48893350 CAGAGAGACCTGGGTGTGGACGG + Intergenic
1185125223 22:49006835-49006857 AACAGAGGCCAGCGAGTGTCTGG - Intergenic
1185331062 22:50252226-50252248 CAGAGAGACCAGTGAGGGGCAGG - Intronic
949341730 3:3038003-3038025 TAGAGAGGCCAGTGTGTTGAAGG + Intronic
951445948 3:22781003-22781025 CAGAGAGGCCAGAAACTGGAAGG + Intergenic
951938904 3:28055433-28055455 CACAGAGGGCAGAAAGTGGAAGG - Intergenic
953813328 3:46132870-46132892 TAGAGAGGCCAGGTGGTGGAGGG + Intergenic
954288316 3:49635334-49635356 TAGAAAGGCCAGCAAGTGGAGGG + Intronic
955719774 3:61868431-61868453 CAGAGAGGCCAGGGAGCTGGGGG - Intronic
961555844 3:127696227-127696249 CAGACAGGCCAGGGAGAGCAAGG - Intronic
963708580 3:148719615-148719637 CAGTGAGCTCAGCGATTGGATGG + Intronic
964087566 3:152835678-152835700 CGGAAAAGCCAGCGAGCGGAAGG - Exonic
967052398 3:185796987-185797009 CTGGGAGGCCTGAGAGTGGATGG - Intronic
967445798 3:189565003-189565025 CAGTGAGGTCAGTGAGTGTATGG - Intergenic
968258083 3:197297657-197297679 GAGAAAGGCAAGCGAGAGGAGGG - Intronic
968295939 3:197576792-197576814 CAGAGACCCCAGGGGGTGGAGGG - Intergenic
969182413 4:5452264-5452286 CAGAGAGGCCAGCGAGTGGAGGG + Intronic
971406501 4:26325407-26325429 AAGAGAGGCAACAGAGTGGAGGG + Intronic
972833714 4:42843321-42843343 CAGAGAGGACAGGAGGTGGAGGG - Intergenic
973109771 4:46383266-46383288 CAGAGAGGCTAGCGATTGAAAGG + Intronic
979287712 4:118944972-118944994 CAGAGAGGCCAACTAGTCCAAGG - Intronic
982104500 4:151999810-151999832 GTGAGAGGGCAGCAAGTGGAAGG - Intergenic
982771847 4:159403645-159403667 CAGAGAGGCCAGGGTGTTGATGG - Intergenic
984596646 4:181676518-181676540 CAGAGAGGAGAGGGAGAGGAGGG - Intergenic
985703115 5:1385657-1385679 AAGGGAGGCCAGCCAGGGGAAGG + Intergenic
986132380 5:4943129-4943151 AGGAGAGGCCAGAGAGGGGAAGG + Intergenic
986317968 5:6603820-6603842 CAGAGAGTCCGGGGAGAGGAGGG - Intronic
986426721 5:7638980-7639002 CACAGATGGCAGCAAGTGGAGGG - Intronic
988784664 5:34555429-34555451 CACAGTGGCCAGTTAGTGGAGGG + Intergenic
990050607 5:51494932-51494954 CGGAGAGGCCACCGAGGGTATGG + Intergenic
994458222 5:100041770-100041792 CAGAGAGAGCAGGGAGTTGAGGG + Intergenic
994525638 5:100902110-100902132 CACAGAGGCCAGCGGGTGGAAGG + Intronic
996211671 5:120818357-120818379 CAAAGCTGCCAGAGAGTGGAAGG - Intergenic
998216133 5:140239814-140239836 AAGAGAGGCAAGCCAGTGCAGGG + Intronic
998481105 5:142463622-142463644 CTGAGAGGCCACTGAGAGGATGG - Intergenic
999203472 5:149832624-149832646 GAGAGAGGCCAGAGTGAGGAAGG - Intronic
999247892 5:150165131-150165153 CACAGAGCCCAGTGTGTGGAAGG + Intergenic
999287170 5:150401001-150401023 GAGAGAGGCCAGATGGTGGAGGG - Intergenic
1001874144 5:175184802-175184824 CAGAGAAGCCAACCATTGGAGGG + Intergenic
1002082546 5:176746072-176746094 CAGATGGGCAAGAGAGTGGAAGG + Intergenic
1002101660 5:176860916-176860938 CAGGGAGGCCAGAGAGTGAGAGG + Intronic
1002191339 5:177479318-177479340 CTGAGAGGCCAGGGTGTGGGTGG - Intergenic
1002451449 5:179321359-179321381 GTGAGAGGCAAGGGAGTGGAGGG - Intronic
1002493936 5:179599268-179599290 CAGAGTGGGCAGCTGGTGGAGGG + Intronic
1003082681 6:3034444-3034466 CAGAGAAGCCTCCGAGGGGAAGG + Intergenic
1003140791 6:3469628-3469650 CTGAGAGGACAGGGAGAGGAAGG - Intergenic
1004320617 6:14628819-14628841 GACAATGGCCAGCGAGTGGAGGG - Intergenic
1005298678 6:24450112-24450134 CAGAGATGCCAGAAAGTAGAGGG + Intronic
1005458834 6:26048138-26048160 TAGAGAGGCCAACGTGTAGAAGG + Intergenic
1006807676 6:36799131-36799153 CAGAGATGCCAGTGGGTGGGTGG - Intronic
1007402312 6:41610180-41610202 CAGAGAGGACAGCACGTGAAGGG + Intergenic
1007693729 6:43718738-43718760 CAGACAGGCTGGCGACTGGAGGG + Intergenic
1008556657 6:52679179-52679201 GAGAGAGGGCAGCCAGTGGCGGG + Intronic
1012503746 6:99920577-99920599 CAGTGAGGCCACAGTGTGGAGGG + Exonic
1012555400 6:100505518-100505540 CAGAGAGGCCAGCCAGTAGGTGG + Intergenic
1017777241 6:157689732-157689754 CACAGAGGCCACCGAGCTGAAGG + Intergenic
1019920150 7:4158144-4158166 CACAGAGGGCAGGGAGTGCAGGG - Intronic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1024060081 7:45690843-45690865 CAGAGAGGCCAGCTGATGGCTGG - Intronic
1024061354 7:45700938-45700960 CAGAGAGGTCAGAGCCTGGAGGG - Intronic
1024563062 7:50660596-50660618 CCGAGAGGCCACGGTGTGGAGGG - Intronic
1024919476 7:54542655-54542677 AAGAAAGGCGTGCGAGTGGATGG - Exonic
1025813865 7:64891903-64891925 CAGAGAGGCCAGTGAGAGGCAGG - Intronic
1025818853 7:64945032-64945054 CAGAGAGGCCAGTGAGAGGCAGG + Intergenic
1025912595 7:65840272-65840294 TAGAGAGGCCAGTGTGTGGCAGG - Intergenic
1025976734 7:66376568-66376590 CAGAGGGGCCAGCGTGAGGCAGG + Intronic
1026907320 7:74069942-74069964 CATCCAGGCCAGCGAGTTGAAGG - Intergenic
1028850751 7:95534597-95534619 CATCGAGGGCAGAGAGTGGAGGG - Intronic
1032012653 7:128356954-128356976 CAGAGTGGTCAGGGAGTGGAGGG + Intronic
1034423721 7:151002126-151002148 CAGGGAGGCCAGAGTGAGGAGGG + Intronic
1034999383 7:155600538-155600560 CAGACAAGCCAGGGACTGGAAGG + Intergenic
1035335932 7:158126896-158126918 CAGAGAGGCCAGTGAAGGCAGGG - Intronic
1035456045 7:159009521-159009543 CAGAGGTGCCACCAAGTGGATGG + Intergenic
1035662596 8:1359248-1359270 CAGGGAGGGCAGCGAGGAGAAGG - Intergenic
1038435772 8:27534984-27535006 CAGGGAGGCCAGCGAGTAGGAGG + Intronic
1042186683 8:66142760-66142782 CAAAGGGGCCAGCTGGTGGAGGG + Intronic
1043372701 8:79612234-79612256 CAATGAGGCCAGCGTGGGGAGGG - Intronic
1043509835 8:80939182-80939204 CAGAGTGGGCAGCCATTGGATGG + Intergenic
1045820087 8:106326683-106326705 CAGAGGGACCAGCCAGTGCAAGG + Intronic
1048329393 8:133461794-133461816 AAGAGAGGCCAGGGAGGGGGAGG - Intronic
1048891673 8:138953898-138953920 CAGAAATGCCAGCGTGAGGATGG - Intergenic
1049214020 8:141399457-141399479 CAGGGAGGCCACCGAGGGGAGGG - Intronic
1049710863 8:144062759-144062781 CAGAGAGGCGAGGGGGTGGCTGG - Intronic
1052812808 9:33076475-33076497 CCGAGAGGCCAGGGAGTGGAGGG - Intronic
1054743751 9:68833891-68833913 CAGAGAGGCAAGTGGGTGGCTGG + Intronic
1055723311 9:79199771-79199793 CAGAGAAGACAGAGAATGGATGG + Intergenic
1056132759 9:83601931-83601953 CAGAGAGAGCAGCAAGTGCAAGG + Intergenic
1056143705 9:83708378-83708400 CAGAGAGGCAAGGGAGGGCAAGG - Intergenic
1056482081 9:87015999-87016021 CAGAGAGGTCATGGGGTGGAGGG + Intergenic
1056856235 9:90131988-90132010 CAGTGAGGAAAGAGAGTGGAAGG - Intergenic
1056985909 9:91363647-91363669 CAGGGAGTTCAGCCAGTGGAAGG + Intergenic
1058003448 9:99890735-99890757 CATAGAGGCAAGAAAGTGGATGG + Intergenic
1059247233 9:112858839-112858861 CAGAGAAGCCAGCATGTGTAGGG - Intronic
1060348527 9:122837643-122837665 GAGAGAGGCCAGCTGGTGGCGGG + Intergenic
1060406204 9:123374257-123374279 CCGGGAGCCCAGCGTGTGGAAGG + Intronic
1061730579 9:132610928-132610950 CAGAGGGACCACCCAGTGGAGGG - Intronic
1061837960 9:133341736-133341758 CAGAGAGGAAAGCCAGGGGAGGG + Intronic
1061979167 9:134090258-134090280 CACAGAGGCCAGGAAGTGGCAGG + Intergenic
1062085978 9:134648692-134648714 CGCACAGGCCAGCGAGTAGAGGG - Intronic
1062203412 9:135321271-135321293 CAGGCAGGCCAGAGAGTGCAGGG + Intergenic
1062283901 9:135764657-135764679 CAGTGAGGCCTGCGAGTGCCTGG + Intronic
1189052749 X:37663733-37663755 GAGAGAGGCCAGCAAGAGCAGGG + Intronic
1189195436 X:39148415-39148437 CAGACAAGCCAGCGAATGAAAGG + Intergenic
1189360137 X:40343782-40343804 GAGAGAGGCCAGGCAGTGGGAGG - Intergenic
1190139695 X:47831978-47832000 CAGAGATGCCACCTAGTGGTGGG - Intergenic
1192796970 X:74431997-74432019 CTGAGAGCCCAGGGAGAGGAGGG + Intronic
1196188602 X:112771610-112771632 CAGAGAGGCCAAGGAGCTGATGG + Intergenic
1198094265 X:133363030-133363052 CAGAGAGGCCAAGGAGTGTCTGG + Intronic
1198320296 X:135513334-135513356 CAGAGGGGCCAGAGAGAGGATGG - Intergenic
1199595247 X:149501831-149501853 GAAAGAGGGCAGCGGGTGGAGGG + Intronic
1199951399 X:152708834-152708856 CAAAGAGGCGAGGAAGTGGAAGG - Intergenic
1199958284 X:152759627-152759649 CAAAGAGGCGAGGAAGTGGAAGG + Intergenic
1200118507 X:153779786-153779808 CAGCGAGGTCAGAGAGTGGGAGG - Intronic
1201578366 Y:15484744-15484766 TAGAGAGTGCAGTGAGTGGATGG - Intergenic
1202381073 Y:24276855-24276877 TGGAGAGGCCACCGAGAGGACGG - Intergenic
1202489712 Y:25393271-25393293 TGGAGAGGCCACCGAGAGGACGG + Intergenic