ID: 969185091

View in Genome Browser
Species Human (GRCh38)
Location 4:5468770-5468792
Sequence TATCTAGAGGAGGCCGGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 921
Summary {0: 1, 1: 0, 2: 17, 3: 122, 4: 781}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969185084_969185091 5 Left 969185084 4:5468742-5468764 CCTCAGGCTCGGTTCCAGCCAAT 0: 1
1: 0
2: 0
3: 7
4: 99
Right 969185091 4:5468770-5468792 TATCTAGAGGAGGCCGGGCGCGG 0: 1
1: 0
2: 17
3: 122
4: 781
969185085_969185091 -9 Left 969185085 4:5468756-5468778 CCAGCCAATGATAATATCTAGAG 0: 1
1: 0
2: 0
3: 5
4: 87
Right 969185091 4:5468770-5468792 TATCTAGAGGAGGCCGGGCGCGG 0: 1
1: 0
2: 17
3: 122
4: 781

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969185091 Original CRISPR TATCTAGAGGAGGCCGGGCG CGG Intronic
900253550 1:1684463-1684485 TAAGAATAGGAGGCCGGGCGCGG + Intronic
900332068 1:2140360-2140382 TATGAGCAGGAGGCCGGGCGCGG + Intronic
900701438 1:4051016-4051038 ATTCCAGAGGAGGCCAGGCGCGG - Intergenic
901256630 1:7834208-7834230 AACCTAGAGCAGGCTGGGCGTGG - Intronic
901462766 1:9401281-9401303 AAACAAAAGGAGGCCGGGCGCGG + Intergenic
901478353 1:9506281-9506303 CGTCTAGATGAGGCCGGGCGGGG - Intergenic
901554022 1:10017483-10017505 TATCTTGAGCAGGCCGGTCGCGG - Intergenic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
903080570 1:20808389-20808411 AATGAAGAGGTGGCCGGGCGCGG + Intronic
903320782 1:22541980-22542002 TGTTTAGGGGAGGCCGGGCGTGG + Intergenic
903403509 1:23076679-23076701 TATCCAGGGAAGGCCGAGCGTGG + Intronic
903465938 1:23552872-23552894 TAGGTATAGGAGGCCGGGCGCGG + Intergenic
903565238 1:24260220-24260242 GTTCTAGAGCTGGCCGGGCGCGG + Intergenic
903840159 1:26233442-26233464 ATTGTATAGGAGGCCGGGCGCGG - Intergenic
903899983 1:26637159-26637181 AAAGTAAAGGAGGCCGGGCGCGG - Intergenic
904232371 1:29086560-29086582 GATCTTAAGGTGGCCGGGCGCGG - Intronic
904420130 1:30385800-30385822 TTACTAGATGAGGCCGGTCGGGG + Intergenic
904518995 1:31079489-31079511 ATTGTAGAGGAGGCCGGGCATGG + Intergenic
905121549 1:35686018-35686040 TGTTAAGAGGGGGCCGGGCGCGG + Intergenic
905136610 1:35805427-35805449 CAACTAGAGTTGGCCGGGCGCGG - Intergenic
905332944 1:37220266-37220288 AATAAAGAGGAGGCCGGGCATGG + Intergenic
905783651 1:40734649-40734671 TATATAAAGCAGGCCGGGCACGG - Intronic
906071039 1:43016593-43016615 TCTCAAGATGAGGCCGGGCACGG + Intergenic
906362609 1:45176553-45176575 AATGTAGACCAGGCCGGGCGCGG - Intronic
907004691 1:50899738-50899760 TATTTAAAGGAGGCTGGGCGTGG - Intronic
907831110 1:58064998-58065020 TATCTATTGTTGGCCGGGCGCGG - Intronic
907889127 1:58621028-58621050 TCACTTGAGGAGGCTGGGCGTGG - Intergenic
908138243 1:61155381-61155403 ATTCTAGAGTTGGCCGGGCGCGG + Intronic
908625237 1:66032942-66032964 TAGATAAATGAGGCCGGGCGTGG - Intronic
908837615 1:68243834-68243856 TATAAAGAGTTGGCCGGGCGTGG + Intergenic
908862788 1:68508342-68508364 TCTTCATAGGAGGCCGGGCGCGG - Intergenic
909484236 1:76155765-76155787 TAAAAATAGGAGGCCGGGCGCGG - Intronic
909899185 1:81110989-81111011 ATTCTACAGGAGGCCGGGTGTGG + Intergenic
910395926 1:86793911-86793933 TATCCAAATGAGGCCGGGCACGG + Intergenic
910970056 1:92847032-92847054 TAATTATAAGAGGCCGGGCGTGG - Intronic
911381780 1:97124211-97124233 TATTTAGAGCAGGGCGGGGGTGG - Intronic
912076114 1:105878468-105878490 TAGTCAGAGCAGGCCGGGCGTGG + Intergenic
912343897 1:108946017-108946039 TAGCCAGACGTGGCCGGGCGCGG + Intronic
912362379 1:109105592-109105614 AGTCAAGTGGAGGCCGGGCGTGG + Intergenic
912415231 1:109503787-109503809 TATATAAACTAGGCCGGGCGCGG - Intergenic
912675564 1:111677082-111677104 AATCTAGAAAAGGCCGGGCACGG - Intronic
912685533 1:111759682-111759704 AATGAAGAGCAGGCCGGGCGCGG + Intronic
913373469 1:118126501-118126523 TGGATAAAGGAGGCCGGGCGCGG - Intronic
914397891 1:147288401-147288423 GATCTATGGGAAGCCGGGCGTGG + Intronic
914424432 1:147562036-147562058 TACCTGGTAGAGGCCGGGCGTGG + Intronic
914475084 1:148015602-148015624 AATAGAGAGAAGGCCGGGCGCGG - Intergenic
914749118 1:150521089-150521111 TATGAAAATGAGGCCGGGCGTGG - Intergenic
915501055 1:156318000-156318022 TAACTGGAGCTGGCCGGGCGTGG - Intronic
915502019 1:156325871-156325893 GATCAAGAGAAGGCCAGGCGTGG - Intronic
915566251 1:156714776-156714798 AATTTGGGGGAGGCCGGGCGTGG - Intergenic
915750744 1:158207568-158207590 TATCTTGAGGCGGCCGGGCGCGG - Intergenic
916102010 1:161400690-161400712 AATTAAGAAGAGGCCGGGCGCGG + Intergenic
916156450 1:161854579-161854601 GATTTAGGGGAGGCTGGGCGTGG + Intronic
916238104 1:162611086-162611108 CTTCTAGAAGAGGCTGGGCGTGG + Intergenic
916797643 1:168181500-168181522 TATGGAGAGGAGGCCGGGTGCGG - Intronic
917330524 1:173875615-173875637 TATATAATGCAGGCCGGGCGCGG - Intronic
917390833 1:174534484-174534506 TAACTAGAGCAGGCCAGGCAAGG + Intronic
917558522 1:176118470-176118492 TAGCTAGAAGAGGCCAGGCATGG + Intronic
917986379 1:180324167-180324189 GACATAGAGTAGGCCGGGCGCGG - Intronic
918068899 1:181120691-181120713 TACTTAAAGGAGGCCGGGCGTGG - Intergenic
918077847 1:181183872-181183894 GATGTATAGGAGGCCGGGTGTGG - Intergenic
918371828 1:183868823-183868845 TATCCAGAGCTGGCCGGGCGTGG + Intronic
918791319 1:188834203-188834225 GGGCTAGAGGAGGCCGGGCGCGG + Intergenic
919677120 1:200394596-200394618 TCACTAATGGAGGCCGGGCGTGG - Intergenic
920106977 1:203560564-203560586 TCTCTGGAGGAGGCCAGGCATGG - Intergenic
920162502 1:204010172-204010194 AAACTATATGAGGCCGGGCGTGG - Intergenic
920994738 1:210978326-210978348 GAATTAAAGGAGGCCGGGCGCGG - Intronic
921102089 1:211937298-211937320 TAACTGAAGGAGGCCGGGCATGG + Intergenic
921480200 1:215656022-215656044 TAACTAGCACAGGCCGGGCGCGG - Intronic
923005434 1:230045673-230045695 TCTTGGGAGGAGGCCGGGCGCGG + Intergenic
923603114 1:235420769-235420791 TAGCCAGACGAGGCCAGGCGTGG - Intronic
923742456 1:236668235-236668257 TAGCTAGGGGAGGCCGGGCATGG - Intergenic
923842124 1:237684224-237684246 TATCTGAACGAGGCCGGGCACGG - Intronic
924418817 1:243887830-243887852 AAACTAGAGGCGGCTGGGCGCGG + Intergenic
924473201 1:244361517-244361539 AATGTAGAACAGGCCGGGCGCGG - Intronic
1063185192 10:3644167-3644189 AATCTAGAAGTGGCCGGGCACGG - Intergenic
1063444246 10:6099173-6099195 AATCTATATGAGGCCGGGCACGG - Intronic
1063449094 10:6139590-6139612 TAAGTAAATGAGGCCGGGCGCGG - Intergenic
1063743637 10:8854682-8854704 TATCTGCTTGAGGCCGGGCGCGG + Intergenic
1063778519 10:9292857-9292879 TATTTTGAGCAGGCCAGGCGAGG - Intergenic
1064018638 10:11791958-11791980 TATTTAAAGGGGGCCGGGCGAGG + Intergenic
1064665874 10:17650773-17650795 TTTCTAGAGAGGGCTGGGCGCGG + Intronic
1065196172 10:23267615-23267637 TAGCTTGAGAAGGCCGGGCACGG + Intronic
1065371935 10:24996155-24996177 TATGTTGAGGAGGCCGGGCACGG + Intronic
1065618152 10:27550105-27550127 TATCTATTCAAGGCCGGGCGCGG - Intergenic
1065708168 10:28490093-28490115 TAACTAAAAGAGGCCGGGCGTGG - Intergenic
1065802484 10:29365529-29365551 AACCTAGAGGTGGCCGGGCGCGG - Intergenic
1066118196 10:32258640-32258662 TTACAAGAGGAGGCCAGGCGCGG - Intergenic
1066652481 10:37670806-37670828 TAACTAAAAGAGGCTGGGCGTGG + Intergenic
1068234467 10:54215749-54215771 TATGTCGAGACGGCCGGGCGCGG + Intronic
1068845346 10:61665595-61665617 TATCTAGGGAAGGCCGGGCGCGG + Intronic
1068984254 10:63092525-63092547 TTGCTAGGAGAGGCCGGGCGTGG - Intergenic
1069037581 10:63661527-63661549 CATCAAGAAGAGGCCGGGCGTGG + Intergenic
1069526434 10:69176138-69176160 TAGCAAAAGCAGGCCGGGCGCGG + Intergenic
1069533822 10:69238664-69238686 TACCTGGTGTAGGCCGGGCGCGG - Intronic
1069923604 10:71832738-71832760 TATCAAGAGAGGGCCGGGCCGGG + Intronic
1070906264 10:80076199-80076221 CACATAGAGTAGGCCGGGCGAGG + Intergenic
1071364930 10:84889945-84889967 AATATACAGAAGGCCGGGCGCGG + Intergenic
1071577960 10:86743707-86743729 GTTATAGAGCAGGCCGGGCGAGG - Intergenic
1072095555 10:92175797-92175819 TATCTAAACGTGGCCGGGTGTGG + Intronic
1072427124 10:95338996-95339018 TGTCTGCAGGAGGCCGGGTGTGG - Intronic
1072756800 10:98026887-98026909 TAACAAAAGGGGGCCGGGCGCGG + Intronic
1072819727 10:98544418-98544440 GAACTAGAGAAGGCCGGGCGCGG + Intronic
1073026989 10:100495114-100495136 TAGCTACAGTAGGCCTGGCGTGG - Intronic
1073287787 10:102398921-102398943 AATCTGGGGGAGGCCGGGCGTGG + Intronic
1073343500 10:102764102-102764124 AATACAGAGAAGGCCGGGCGTGG - Intronic
1073992341 10:109276626-109276648 TACCTACATTAGGCCGGGCGCGG + Intergenic
1075037002 10:119077841-119077863 AATTCAGAGGAGGCCGGGCGTGG - Intronic
1075092097 10:119449508-119449530 TATAAAGAGTAGGCCGGGCACGG + Intronic
1075335047 10:121602636-121602658 GATCTAGGAGAGGCCGGGTGCGG - Intergenic
1075825552 10:125354677-125354699 TAGCTAGACGAGGCCGGGCGCGG + Intergenic
1076036892 10:127206432-127206454 AATATACAGTAGGCCGGGCGCGG - Intronic
1076745851 10:132513213-132513235 TATTAAGAATAGGCCGGGCGTGG + Intergenic
1077246048 11:1539139-1539161 TGTGTGGACGAGGCCGGGCGCGG + Intergenic
1077808769 11:5616239-5616261 TAAAAAGATGAGGCCGGGCGCGG - Intronic
1077815962 11:5685580-5685602 TATCTGGAGAGGGCCGGGCGCGG + Intronic
1078114427 11:8431153-8431175 TATGTTAAGGAGGCCGGGTGCGG - Intronic
1079101556 11:17545041-17545063 TATCCAGAGAAGGCCGGGCGCGG - Intergenic
1079221966 11:18571060-18571082 TGTCTATTGAAGGCCGGGCGTGG + Intronic
1079789457 11:24717703-24717725 TAACTATTGGGGGCCGGGCGCGG - Intronic
1080338072 11:31222351-31222373 AAACTAGAGGAGGCCAGGCGTGG - Intronic
1081195992 11:40161461-40161483 AAATTAGAGGAGGCCGGGCACGG + Intronic
1081473140 11:43395388-43395410 GTTCTACATGAGGCCGGGCGCGG - Intronic
1081985337 11:47298076-47298098 TATGTAAAGAAGGCCGGGCGCGG - Intronic
1081999232 11:47384034-47384056 TACACAGAGGGGGCCGGGCGTGG + Intergenic
1082031689 11:47609162-47609184 AATCTCAAGGAGCCCGGGCGCGG + Intergenic
1083246839 11:61435170-61435192 TCACTAGAGGAGGCCAGGCACGG - Intronic
1083989720 11:66239365-66239387 TAGCCACAGGAAGCCGGGCGTGG + Intronic
1084224710 11:67708730-67708752 TATAGAGCTGAGGCCGGGCGTGG - Intergenic
1084262529 11:67988595-67988617 TATAGAGCTGAGGCCGGGCGTGG - Intergenic
1084286256 11:68133012-68133034 TGTAAAGGGGAGGCCGGGCGCGG + Intergenic
1084322821 11:68383166-68383188 TCACTAAAGTAGGCCGGGCGCGG - Intronic
1084600015 11:70139612-70139634 TATTTGGTGCAGGCCGGGCGTGG - Intronic
1085117556 11:73943565-73943587 ACTCTAAATGAGGCCGGGCGTGG - Intergenic
1086029176 11:82332982-82333004 TTGCTAGTGTAGGCCGGGCGTGG + Intergenic
1086440381 11:86823714-86823736 AATTCAGAGCAGGCCGGGCGCGG + Intronic
1086457335 11:86972287-86972309 TATCTTGGTGAGGCTGGGCGCGG + Intergenic
1087664166 11:101024113-101024135 AATTTAAATGAGGCCGGGCGCGG + Intergenic
1088079123 11:105888574-105888596 TAGAAAAAGGAGGCCGGGCGTGG - Intronic
1088120322 11:106361350-106361372 GAACCAGAGGAGGCTGGGCGCGG - Intergenic
1088638126 11:111844292-111844314 TCTCAGAAGGAGGCCGGGCGCGG - Intronic
1090040300 11:123284912-123284934 AATGAAGATGAGGCCGGGCGCGG + Intergenic
1090180279 11:124692288-124692310 GACATAGCGGAGGCCGGGCGTGG + Intronic
1090784192 11:130033905-130033927 TATAAAGAGTAGGCTGGGCGTGG - Intergenic
1091872812 12:3909194-3909216 TACCTGAAGAAGGCCGGGCGCGG + Intergenic
1092133660 12:6130864-6130886 TAAATAGAATAGGCCGGGCGTGG + Intergenic
1092153226 12:6265580-6265602 TATGAAGAAGCGGCCGGGCGTGG + Intergenic
1092603290 12:10090552-10090574 TACCTAGAATTGGCCGGGCGCGG - Intronic
1092736201 12:11585382-11585404 TAGCCAGGCGAGGCCGGGCGCGG + Intergenic
1092876187 12:12850189-12850211 TAAATAGACGTGGCCGGGCGCGG + Intergenic
1093060318 12:14595384-14595406 TAACCAGAGATGGCCGGGCGTGG - Intergenic
1094007753 12:25773449-25773471 TATATAGATGAGGCCAGGAGCGG - Intergenic
1095411614 12:41931637-41931659 CACCTACTGGAGGCCGGGCGCGG + Intergenic
1095966280 12:47869244-47869266 TAGGAAGAGAAGGCCGGGCGCGG + Intronic
1096061876 12:48708254-48708276 AGTTTAGAGTAGGCCGGGCGTGG + Intronic
1096066507 12:48744978-48745000 TATATTAAAGAGGCCGGGCGTGG + Intergenic
1096129247 12:49144349-49144371 AAAGTAAAGGAGGCCGGGCGCGG - Intergenic
1096222178 12:49837575-49837597 TACCTACATGCGGCCGGGCGCGG - Exonic
1096257051 12:50069582-50069604 AATAAAGAGGAGGCTGGGCGCGG - Intronic
1096517172 12:52163362-52163384 AATGAAGAGTAGGCCGGGCGCGG + Intergenic
1096855239 12:54476718-54476740 AATCTATAGGAGGCTGGGGGTGG - Intergenic
1096977912 12:55710068-55710090 AAACTAGACGGGGCCGGGCGCGG + Intronic
1097046955 12:56194146-56194168 AAACTTCAGGAGGCCGGGCGCGG - Intergenic
1097064269 12:56309258-56309280 TAGCCAGTGCAGGCCGGGCGCGG + Intronic
1097115008 12:56690706-56690728 TGTCTCCTGGAGGCCGGGCGCGG + Intergenic
1097262793 12:57728867-57728889 TATCGGGAGAAGGCCGGGCACGG + Intronic
1097977134 12:65698719-65698741 AATCTATAAGTGGCCGGGCGTGG + Intergenic
1098390388 12:69963836-69963858 CATCTAGTGAAGGCCGGGCGCGG + Intergenic
1099676996 12:85773624-85773646 GACATAGGGGAGGCCGGGCGCGG - Intergenic
1099936372 12:89130567-89130589 AAAATAGAGTAGGCCGGGCGCGG - Intergenic
1100264142 12:92959718-92959740 TATGTAGTAGAGGCCGGGCACGG + Intergenic
1100277233 12:93082272-93082294 TATGGAAAGCAGGCCGGGCGCGG + Intergenic
1100545597 12:95599063-95599085 TATAGGGAAGAGGCCGGGCGCGG - Intergenic
1100549751 12:95636084-95636106 TTAGTAGAGGAGGCCGGGCACGG - Intergenic
1100895606 12:99179136-99179158 AATTTAGTTGAGGCCGGGCGCGG + Intronic
1101009962 12:100439162-100439184 TATCTAGATGAGGCTGGGCCTGG + Intergenic
1101354472 12:103964406-103964428 TAACGTGAGGAGGCCGGGCGTGG - Intronic
1101678714 12:106943591-106943613 AAACCAGAGCAGGCCGGGCGCGG - Intergenic
1102905060 12:116668068-116668090 TAAGTGGAGGAGGCCGGGTGCGG + Intergenic
1102927078 12:116834407-116834429 TAGTTACTGGAGGCCGGGCGTGG - Intronic
1103631709 12:122266690-122266712 GATCTGGAGTAGACCGGGCGCGG + Intergenic
1103647952 12:122409820-122409842 AATCCAAATGAGGCCGGGCGCGG - Intronic
1103756969 12:123215945-123215967 GACCAAGAGAAGGCCGGGCGCGG + Intronic
1103831885 12:123786845-123786867 TATATAGATGAGGCCGGGTGCGG + Intronic
1104028381 12:125046261-125046283 TGTTTAAAAGAGGCCGGGCGCGG + Intergenic
1104095551 12:125554131-125554153 TATCAACAGTAGGCCGGGCGCGG + Intronic
1104569921 12:129916170-129916192 AATGTAGACTAGGCCGGGCGTGG + Intergenic
1105012172 12:132762896-132762918 TATCTAAATTAGGCGGGGCGCGG - Intergenic
1105367281 13:19776795-19776817 TACATATAGTAGGCCGGGCGCGG - Intronic
1105568605 13:21577515-21577537 TACCCAGATGAGGCTGGGCGTGG + Intronic
1105714078 13:23044101-23044123 AAACTAGAGGAGGCTGGGAGAGG - Intergenic
1105985592 13:25563117-25563139 TTTCAAGAGGAGGCCAGGTGCGG + Intronic
1106050351 13:26184319-26184341 TAATTTGAGGCGGCCGGGCGCGG - Intronic
1106390685 13:29332923-29332945 GAACTAGAGAAGGCCGGGCGCGG - Intronic
1106507846 13:30387088-30387110 AAAATAAAGGAGGCCGGGCGCGG + Intergenic
1106664420 13:31836691-31836713 TATATAAAGAGGGCCGGGCGTGG + Intergenic
1107100128 13:36581445-36581467 CATCTCAAGGAGGCCGGGCATGG + Intergenic
1107224649 13:38032636-38032658 TATCTTATGGCGGCCGGGCGCGG - Intergenic
1107770066 13:43779864-43779886 AATCTGCATGAGGCCGGGCGTGG + Intronic
1107870936 13:44745972-44745994 TATCTACCGAAGGCTGGGCGCGG - Intergenic
1108008976 13:45983715-45983737 TAAGTAGAAGGGGCCGGGCGCGG - Intronic
1108152540 13:47551220-47551242 TTTTTAAAAGAGGCCGGGCGCGG - Intergenic
1108273717 13:48787578-48787600 GAGCAAGAGGAGGCCGGGCGCGG + Intergenic
1108354702 13:49619785-49619807 TATGTAGGGGTGGCCCGGCGCGG + Intergenic
1109582104 13:64354432-64354454 TATCTCAAGAAGGCCGGACGCGG + Intergenic
1110601337 13:77377849-77377871 TATAAAGCAGAGGCCGGGCGCGG - Intergenic
1111197798 13:84896190-84896212 TATCAAAATGGGGCCGGGCGCGG - Intergenic
1112456859 13:99570917-99570939 AATCCAGTGGAGGCCGGGTGCGG - Intergenic
1112570663 13:100590116-100590138 TATTAATATGAGGCCGGGCGCGG - Intergenic
1113111052 13:106823958-106823980 CATGAAGAAGAGGCCGGGCGCGG - Intergenic
1113196901 13:107818580-107818602 AATCCAGTTGAGGCCGGGCGCGG + Intronic
1113480059 13:110614198-110614220 TATTATGAAGAGGCCGGGCGTGG - Intergenic
1113798584 13:113074752-113074774 GACCCAGAGGAGGCCGGGCAGGG - Intronic
1113993421 14:16047090-16047112 TATCAAGAGAAGGCCAGGCAAGG - Intergenic
1114181013 14:20367897-20367919 TACCCAGAGGAGGCCGGGCATGG - Exonic
1114218374 14:20674694-20674716 TATCCAGGTGAGGCTGGGCGTGG - Intergenic
1114428567 14:22640809-22640831 TATCAAGAAGAGGCTGGGTGTGG - Intergenic
1114456460 14:22857744-22857766 AAACTGGAAGAGGCCGGGCGCGG + Intergenic
1114510593 14:23256660-23256682 TGAATAGAGGAGGCCAGGCGTGG - Intronic
1114695135 14:24620195-24620217 TGTTTATAGTAGGCCGGGCGCGG + Intergenic
1115076632 14:29400127-29400149 TATATAAAAGAGGCCGGGCACGG - Intergenic
1115311311 14:31981019-31981041 AATGTAGAGAAGGCCGGGCGCGG - Intergenic
1116607448 14:47019551-47019573 TACCTGGTGTAGGCCGGGCGCGG + Intronic
1117099384 14:52331210-52331232 AAGAGAGAGGAGGCCGGGCGCGG + Intergenic
1117392843 14:55279004-55279026 GATTTAGTGAAGGCCGGGCGTGG + Intronic
1117500495 14:56346435-56346457 TATTTACAGTTGGCCGGGCGTGG + Intergenic
1117777235 14:59195431-59195453 TAACAAGATGAGGCCAGGCGCGG - Intronic
1118360230 14:65050303-65050325 TAACTAAAGCTGGCCGGGCGTGG + Intronic
1118555166 14:67010258-67010280 AATCAAGAATAGGCCGGGCGCGG + Intronic
1118681362 14:68245145-68245167 GATCTAGAGGAGGCCCAGCCAGG + Intronic
1119223846 14:72929124-72929146 GGCCCAGAGGAGGCCGGGCGGGG - Intronic
1119875321 14:78054415-78054437 TACCTGGAACAGGCCGGGCGCGG - Intergenic
1120002891 14:79323567-79323589 TTTATATAGTAGGCCGGGCGTGG + Intronic
1120026632 14:79593338-79593360 TACCTTGAGAAGGCCGGGTGTGG + Intronic
1120315755 14:82890575-82890597 TATATAGAGGAGGCCAGGCGTGG - Intergenic
1121000155 14:90445963-90445985 TACCTAGAAGAGGCCGGGCATGG - Intergenic
1121090624 14:91179459-91179481 TATATAGATGAGGCTGGGTGCGG + Intronic
1121103948 14:91268815-91268837 TAAGTAAAAGAGGCCGGGCGTGG + Intergenic
1121122727 14:91386151-91386173 AAAGTAGAGCAGGCCGGGCGCGG + Intronic
1121809458 14:96869081-96869103 TTTTTACACGAGGCCGGGCGTGG - Intronic
1122096700 14:99377653-99377675 AAGGCAGAGGAGGCCGGGCGCGG + Intergenic
1122159253 14:99771072-99771094 TATCAGTGGGAGGCCGGGCGCGG - Intronic
1122749518 14:103922215-103922237 TATGCAGAGCAGGCCGGGCGCGG - Intronic
1124042126 15:26115221-26115243 TATCTATAATAGGCCAGGCGCGG - Intergenic
1124945375 15:34260546-34260568 TAACTAAACAAGGCCGGGCGCGG - Intronic
1125503794 15:40255195-40255217 AATCTAGGGTAGGCCGGGCGCGG + Intronic
1125632460 15:41158448-41158470 AAGCTACAGTAGGCCGGGCGCGG + Intergenic
1125805755 15:42492199-42492221 TAAATATAGGCGGCCGGGCGCGG - Intronic
1126395661 15:48213811-48213833 ATTCTAGAGGAGGCTGGGTGTGG - Intronic
1126448488 15:48778657-48778679 TGAGTACAGGAGGCCGGGCGCGG + Intronic
1127120669 15:55769118-55769140 TGTCTAATGAAGGCCGGGCGCGG + Intergenic
1127699499 15:61484266-61484288 AATGTAGAATAGGCCGGGCGCGG - Intergenic
1127784088 15:62340987-62341009 TATATAGATGAGGCCGAGCGTGG + Intergenic
1127990793 15:64114849-64114871 TTTCTGGAGGAGGCCAGGCACGG + Intronic
1128193634 15:65728777-65728799 TAGCCAAAGGGGGCCGGGCGCGG - Intronic
1128208572 15:65874529-65874551 TATCTCAACTAGGCCGGGCGTGG - Intronic
1128277492 15:66365833-66365855 TATGCAGAGCAGGCTGGGCGCGG - Intronic
1128367601 15:67015450-67015472 TAAGAAGTGGAGGCCGGGCGCGG - Intergenic
1128860333 15:71065284-71065306 TATCTGGATGAGGCCAGGCACGG + Intergenic
1129074167 15:72977254-72977276 TATCTGGAGGAAGCCAGGCCAGG - Intergenic
1129226057 15:74171070-74171092 AATTTAGAGGAGGCCAGGAGAGG + Intergenic
1129349713 15:74948380-74948402 AACCCAGAGGAGGCCGGGCGCGG + Intergenic
1129495751 15:75978105-75978127 TAGCTAGAAGAGGCTGGGCACGG - Intronic
1129873718 15:78958462-78958484 ATTCTAGAGCAGGCCGGGCGTGG - Intergenic
1130389147 15:83439677-83439699 TACTTGGATGAGGCCGGGCGCGG - Intergenic
1130423464 15:83772142-83772164 GAGCCAAAGGAGGCCGGGCGTGG - Intronic
1131515396 15:93073297-93073319 TAGCCGGAGGCGGCCGGGCGGGG + Intronic
1131554522 15:93385676-93385698 GAATTAGAGCAGGCCGGGCGCGG + Intergenic
1131563352 15:93463196-93463218 TATTCAGAGCTGGCCGGGCGTGG + Intergenic
1131810444 15:96167955-96167977 AATTTAGAGGAGGCCAGGTGTGG + Intergenic
1132520576 16:385912-385934 TATTCAGAGTAGGCCGGGCGCGG - Intronic
1132821731 16:1876168-1876190 GAGCTACTGGAGGCCGGGCGTGG + Intronic
1132839738 16:1973149-1973171 TAGGTAGGGGAGGCCGGGCGCGG + Intronic
1133201881 16:4208799-4208821 TATCTAAAACAGGCCGGGCCTGG + Intronic
1134507118 16:14817005-14817027 TATATATATCAGGCCGGGCGCGG - Intronic
1134542531 16:15079098-15079120 TATGAAGAGGAGGCCGGGCGTGG - Intronic
1134694818 16:16215762-16215784 TATATATATCAGGCCGGGCGCGG - Intronic
1134911088 16:18026963-18026985 TAACCAGAGTAGGCCGGGAGCGG - Intergenic
1135032285 16:19047987-19048009 CATCAAGAGTAGGCCGGGTGCGG - Intronic
1135064461 16:19297955-19297977 TATGTACAGGTGGCCGGGTGCGG + Intronic
1135165333 16:20134094-20134116 TAGCTAGAGGTGGCGGGGCATGG + Intergenic
1135360108 16:21805176-21805198 TATGAAGAGGAGGCTGGGTGTGG - Intergenic
1135757415 16:25109384-25109406 TAGCTAGAGTGGGCTGGGCGCGG - Intergenic
1136127824 16:28197624-28197646 TATTCAGACTAGGCCGGGCGCGG + Intronic
1136262698 16:29091764-29091786 TATGAAGAGGAGGCCGGGTGTGG + Intergenic
1136502843 16:30682052-30682074 TACGTATAGGAGGCCGGGTGCGG + Intergenic
1136549029 16:30972344-30972366 AATACATAGGAGGCCGGGCGCGG + Intronic
1137378197 16:47973056-47973078 TACCTAGAGGATGCTGGGCATGG - Intergenic
1138379190 16:56588752-56588774 TATAAAAAGGAGGCCGGACGTGG - Intergenic
1138856237 16:60696976-60696998 TATATAATGGAGGCCGGGCACGG + Intergenic
1138905109 16:61322522-61322544 TATCTGTAGGTGGCCGGGCGCGG + Intergenic
1139541604 16:67622064-67622086 TATTTAGTGTAGGCCGGGCGCGG + Intronic
1139778425 16:69331155-69331177 AATTTAAGGGAGGCCGGGCGCGG + Intronic
1139785738 16:69390538-69390560 TTTCTAGTGGAGGCTGGGCGTGG - Intronic
1139869119 16:70089765-70089787 AAACTAGACTAGGCCGGGCGCGG - Intergenic
1140056419 16:71529855-71529877 TCTCAAGAGGGGGCTGGGCGCGG + Intronic
1140098911 16:71897653-71897675 TATTGAGTGGAGGCCGGGCACGG + Intronic
1140236071 16:73160051-73160073 AATCTAGCTTAGGCCGGGCGTGG - Intergenic
1140343034 16:74184280-74184302 TAACTAAAAGAGGCCGGGAGTGG + Intergenic
1140386264 16:74542375-74542397 AAACTAGACTAGGCCGGGCGCGG + Intronic
1140392395 16:74598600-74598622 TATATAAATAAGGCCGGGCGCGG + Intronic
1140760934 16:78108214-78108236 TATCTAGAGGCCGTCGGGAGCGG - Intronic
1140813783 16:78602520-78602542 TATCGAGAAGAGGCCGGGTGTGG - Intronic
1141718376 16:85740410-85740432 TATCCAGGTGTGGCCGGGCGCGG + Intronic
1142554508 17:764716-764738 CATGTTGAGTAGGCCGGGCGCGG + Intronic
1142856343 17:2732424-2732446 AACCTAGAGGTGGCTGGGCGTGG + Intergenic
1142918262 17:3161605-3161627 TAACGAGAAAAGGCCGGGCGCGG - Intergenic
1143170238 17:4925212-4925234 TGTATAGAAGATGCCGGGCGTGG - Intergenic
1143235145 17:5393243-5393265 TAGCTAGGTGAGGCCAGGCGTGG - Intronic
1143785308 17:9251257-9251279 GACCCAGAGGAGGCAGGGCGGGG - Intronic
1144101827 17:11948518-11948540 GAGCCAGAGGAGGCCGGGTGCGG - Intronic
1144430138 17:15183674-15183696 TACTAAGAGGAGGTCGGGCGCGG - Intergenic
1144638563 17:16925623-16925645 CAGCTAGGGGAGGCCGGGCAGGG + Intergenic
1144701099 17:17340812-17340834 AAACAAGAGCAGGCCGGGCGCGG - Intronic
1145037189 17:19549482-19549504 TTGCTGGAGCAGGCCGGGCGCGG - Intronic
1146210722 17:30940593-30940615 TCTGTAAAGGAGGCCGGGCATGG - Intronic
1146374113 17:32282910-32282932 TCTCCACAGAAGGCCGGGCGCGG - Intronic
1147028133 17:37607496-37607518 TAAATAGAGGATGCCGGGCGTGG + Intronic
1147071593 17:37962615-37962637 TATCTAATACAGGCCGGGCGCGG + Intergenic
1147083119 17:38042139-38042161 TATCTAATACAGGCCGGGCGCGG + Intronic
1147099062 17:38166112-38166134 TATCTAATACAGGCCGGGCGCGG + Intergenic
1147127742 17:38383832-38383854 AATATAGAGCAGGCTGGGCGCGG - Intronic
1147596566 17:41721858-41721880 TATCTGGGGGAGGCCAGGCGCGG - Intronic
1147735254 17:42633363-42633385 AAGCCAGAGGGGGCCGGGCGTGG + Intergenic
1147999699 17:44380535-44380557 CATCAAGAGGAGGCCAGGCCAGG - Intronic
1148001279 17:44388953-44388975 TGCAGAGAGGAGGCCGGGCGCGG - Intronic
1148261307 17:46186083-46186105 ATTCTAAAGGAGGCCGGGCGCGG + Intronic
1148400182 17:47352190-47352212 ATACTAGATGAGGCCGGGCGTGG - Intronic
1148878046 17:50704222-50704244 AATCTACAAGAGGCCGGGCGCGG + Intronic
1149151372 17:53568268-53568290 TAAGTAGAGGGGGCCGGGCATGG + Intergenic
1149151510 17:53570235-53570257 TAAACAGAGGAGGCCGGGTGCGG + Intergenic
1149546928 17:57510716-57510738 AACCAAGAGGAGGCCGGGTGTGG - Intronic
1149616991 17:58008858-58008880 AAACTAGATGAGGCTGGGCGTGG + Intergenic
1149618542 17:58022999-58023021 TACCTACAGTAGGCAGGGCGAGG - Intergenic
1149718440 17:58818027-58818049 AAACTAGAGTGGGCCGGGCGCGG - Intronic
1149743821 17:59075271-59075293 TATACAGAGAAGGCCGGGCACGG + Intronic
1149809384 17:59653481-59653503 GAGGGAGAGGAGGCCGGGCGTGG - Intronic
1149888092 17:60360836-60360858 TACATAAAGTAGGCCGGGCGCGG + Intronic
1150080599 17:62235155-62235177 TATCTAATACAGGCCGGGCGCGG + Intergenic
1150330097 17:64287460-64287482 TTTTAAAAGGAGGCCGGGCGTGG + Intergenic
1150479995 17:65501849-65501871 TAACTAGAAGTGGCTGGGCGCGG + Intergenic
1150599654 17:66639704-66639726 TAAACAGAGGAGGCTGGGCGCGG + Intronic
1150975948 17:70087409-70087431 AATCTTAAGGAGGCCAGGCGCGG + Intronic
1151797453 17:76355791-76355813 TAGCCAGATGTGGCCGGGCGCGG + Intronic
1151812758 17:76454184-76454206 TATAAAAAGTAGGCCGGGCGCGG + Intronic
1152018241 17:77766071-77766093 GATTTAGAGCAGGCCGGGCGCGG + Intergenic
1152097825 17:78282162-78282184 TATCGAGATCAGGCCGGGCACGG + Intergenic
1152273283 17:79338227-79338249 TATCTGGAGAAGGCCAGGCGCGG - Intronic
1152494261 17:80659978-80660000 AATTTAAATGAGGCCGGGCGTGG + Intronic
1152731599 17:81974565-81974587 GATATACAGGAGGCTGGGCGTGG + Intergenic
1152801276 17:82331847-82331869 CTTCTAGAGTGGGCCGGGCGCGG + Intronic
1152834166 17:82519061-82519083 AATATACACGAGGCCGGGCGCGG - Intergenic
1152853678 17:82651536-82651558 AATCTACAGTAGGCCGGGCGCGG + Intergenic
1153014493 18:571376-571398 TAACTAGCTGAGGCCGGGTGAGG + Intergenic
1153331698 18:3880650-3880672 TAGAAAAAGGAGGCCGGGCGCGG + Intronic
1153579734 18:6560799-6560821 TATCTAAAGCAGGCTGGGCGTGG - Intronic
1153639728 18:7146497-7146519 TATCTAGAAGAGGCCAGGTGCGG + Intergenic
1153670374 18:7406186-7406208 TATCAATTGAAGGCCGGGCGCGG - Intergenic
1153765680 18:8372362-8372384 TATAGAGTGGAGGCCGGGCGCGG - Intronic
1153876915 18:9382205-9382227 AAACAAGAGGAGGCTGGGCGAGG + Intronic
1154257855 18:12799919-12799941 GAAAAAGAGGAGGCCGGGCGTGG - Intronic
1154937150 18:21072778-21072800 AATGTAGAGGAGGCCAGGCACGG + Intronic
1155145139 18:23077249-23077271 TAGCTAGTGGCGGCCGGGCACGG - Intergenic
1157949318 18:52017007-52017029 TATGTGGTGTAGGCCGGGCGCGG + Intergenic
1158136634 18:54215028-54215050 TACCTTGTGGAGGCCGGGCGCGG - Intronic
1158301523 18:56058052-56058074 TCCCCAGAGGAGGCCGGGCGCGG - Intergenic
1158359793 18:56659004-56659026 TAAGTACAGGGGGCCGGGCGCGG - Intronic
1158482633 18:57835495-57835517 GAAATGGAGGAGGCCGGGCGCGG - Intergenic
1158970895 18:62665449-62665471 TATGCAGAGTTGGCCGGGCGTGG + Intergenic
1158981844 18:62770398-62770420 TAACCAGAGTAGGCCGGGCACGG - Intronic
1159556933 18:69955575-69955597 TTTCCACAGGAGGCCGGGTGCGG + Intronic
1159658088 18:71057126-71057148 TAGCCTGATGAGGCCGGGCGCGG + Intergenic
1159833789 18:73311617-73311639 TGTCAAGAATAGGCCGGGCGCGG + Intergenic
1160827482 19:1087441-1087463 ATTCTGGAGGTGGCCGGGCGCGG - Exonic
1161091196 19:2360857-2360879 TTTCTAGACGAGGCCAGGCTGGG + Intergenic
1161118132 19:2510958-2510980 CATCTAGGAGGGGCCGGGCGCGG - Intergenic
1161161941 19:2766724-2766746 AAGCAAGAAGAGGCCGGGCGCGG - Intronic
1161184442 19:2907019-2907041 TCTCCAGAGGAGTCCAGGCGGGG + Intronic
1161376526 19:3941929-3941951 CAGCAAGAGGGGGCCGGGCGCGG - Intronic
1161451374 19:4347527-4347549 TATCTACAGGCAGCTGGGCGCGG - Intronic
1161679861 19:5674503-5674525 TAATAAGAAGAGGCCGGGCGCGG - Intergenic
1162324359 19:9990101-9990123 TAACTAAAAGAGGCCGGGCGTGG + Intronic
1162527010 19:11211954-11211976 TATGAAGGGGAGGCGGGGCGGGG + Intronic
1162603788 19:11691704-11691726 TTACAAGATGAGGCCGGGCGCGG + Intergenic
1162848887 19:13415448-13415470 GAACTAGATGAGGCCAGGCGTGG + Intronic
1163306711 19:16484465-16484487 CATCGAGAGTTGGCCGGGCGTGG - Intronic
1163575215 19:18107104-18107126 TAGCCAGAGTAGGCCGGGTGCGG - Intronic
1163689901 19:18732798-18732820 TAACTACAGGAGGCCGGGTGTGG + Intronic
1164000874 19:21097154-21097176 TATCCTGAACAGGCCGGGCGTGG - Intronic
1164216387 19:23154217-23154239 AATCTAGAATGGGCCGGGCGTGG - Intergenic
1165043118 19:33082946-33082968 AATAGAGATGAGGCCGGGCGTGG + Intronic
1165212206 19:34244896-34244918 AATAAAGAGGAGGCCAGGCGCGG + Intergenic
1165378276 19:35459386-35459408 TATCCACAGGAGGCAGGGCAAGG - Intergenic
1165528567 19:36377688-36377710 TACCTACTGGAGGCCGGGTGCGG + Intronic
1165557844 19:36650939-36650961 TTCCTAGAGCTGGCCGGGCGTGG + Intronic
1165559640 19:36667936-36667958 TCTCAAAAAGAGGCCGGGCGCGG - Intergenic
1165985066 19:39761311-39761333 TAACTAAAAGAGGCCGGGCATGG + Intergenic
1166144116 19:40822529-40822551 TAGCTAGAGCTGGCCGGGCGCGG + Intronic
1166183496 19:41124551-41124573 TAGCTAGAGCTGGCCGGGCGCGG - Intronic
1166193297 19:41190261-41190283 AATATAGGAGAGGCCGGGCGCGG - Intergenic
1166313028 19:41973851-41973873 TGTCTTGGGGAGGCCAGGCGTGG + Intronic
1166682285 19:44776580-44776602 TGTGTAGGGGTGGCCGGGCGTGG - Intergenic
1166721686 19:45000863-45000885 TGTTTATTGGAGGCCGGGCGCGG - Intergenic
1166780189 19:45338138-45338160 AAGCTAGAGTAGGCCGGGCATGG + Intronic
1166804857 19:45479938-45479960 TAGCGAGTGGCGGCCGGGCGCGG + Intergenic
1166928445 19:46285953-46285975 AAAACAGAGGAGGCCGGGCGCGG + Intergenic
1167122351 19:47525621-47525643 CTTCTAGAGAAGGCCGGGCAAGG + Intronic
1167261550 19:48461791-48461813 GATGAAGAGGAGGCCGGGCCCGG + Exonic
1167418181 19:49388149-49388171 TCTTAAGAGGAGTCCGGGCGGGG + Intergenic
1167435626 19:49476854-49476876 TAAACTGAGGAGGCCGGGCGTGG + Intronic
1167589387 19:50395209-50395231 TAAATAGTGTAGGCCGGGCGCGG + Intronic
1167589398 19:50395303-50395325 TAAATAGTGTAGGCCGGGCGCGG + Intronic
1167832036 19:52031705-52031727 TAGCAAGAGGAGGCCAGGCGTGG + Exonic
1167908348 19:52680900-52680922 TATTTTGTGGAGGCCGGGCGCGG - Intronic
1167983097 19:53292232-53292254 TATCCAAAGGAGGCAGGGGGCGG - Intergenic
1167990459 19:53356637-53356659 TTTGTAAATGAGGCCGGGCGTGG + Intergenic
1168046312 19:53796704-53796726 TATCTGGGTTAGGCCGGGCGTGG + Intronic
1168212637 19:54901675-54901697 TTTTTAAAGGAGGCTGGGCGTGG + Intergenic
1168362335 19:55752529-55752551 TAACTAAAAGAGGCCGGGCGCGG - Intergenic
927229520 2:20808369-20808391 TAACAAGACAAGGCCGGGCGCGG + Intronic
927500553 2:23580078-23580100 AATCTAGACCAGGCCGGGCGCGG + Intronic
927502440 2:23591655-23591677 AGTCCAGAGGAGACCGGGCGAGG - Intronic
927644022 2:24863994-24864016 GCTCTATAGGAGGCCGGACGTGG + Intronic
927663060 2:25009057-25009079 TTTATATATGAGGCCGGGCGTGG + Intergenic
927741325 2:25572175-25572197 TATCTGCACCAGGCCGGGCGCGG + Intronic
927901563 2:26823202-26823224 TATCTTTAGGCAGCCGGGCGTGG + Intergenic
928517056 2:32053611-32053633 AATCTATAGTGGGCCGGGCGAGG - Intergenic
928546413 2:32333103-32333125 TAAATAGAAGAGGCTGGGCGTGG + Intergenic
928547548 2:32342415-32342437 TAAATAAATGAGGCCGGGCGCGG + Intergenic
928611933 2:32999599-32999621 GATCCAGAGGCGGCTGGGCGCGG + Intronic
928666640 2:33556535-33556557 TTATTAGAAGAGGCCGGGCGCGG - Intronic
929032724 2:37663882-37663904 CAGGCAGAGGAGGCCGGGCGCGG + Intronic
929209653 2:39341366-39341388 AAACTTCAGGAGGCCGGGCGTGG + Intronic
929507077 2:42536567-42536589 TATATAGTGGAGGCTGGGCGTGG + Intronic
930097288 2:47574939-47574961 TATCCCAAGGAGGCCGGGTGCGG + Intergenic
930160595 2:48152550-48152572 CATCTAGAATAGGCCGGGCATGG + Intergenic
930699951 2:54449616-54449638 TAACTGGTGGAGGCCGGGCATGG + Intergenic
930709164 2:54533839-54533861 TTACTACAGCAGGCCGGGCGTGG - Intronic
930779441 2:55209161-55209183 AATAAAGAGGAGGCCGGGCACGG - Intronic
931378783 2:61732641-61732663 TATCTAGAACAGGCCGGGCGCGG - Intergenic
931902303 2:66803387-66803409 AAGATAGTGGAGGCCGGGCGTGG + Intergenic
932142725 2:69293987-69294009 TATCTGGAGAAGGCCAGGCACGG - Intergenic
932247147 2:70205365-70205387 TACCAAATGGAGGCCGGGCGCGG - Intronic
932746111 2:74334914-74334936 TATCCTGAGGAGGCGGGGAGGGG + Intronic
932856288 2:75237084-75237106 AATCAAGAAGAGGCCGGGCGCGG - Intergenic
933717462 2:85371741-85371763 TAGCAAGAGTAGGTCGGGCGTGG + Intronic
934027794 2:88015620-88015642 GATAAAAAGGAGGCCGGGCGTGG - Intergenic
934554372 2:95279583-95279605 TATGCAGAAGCGGCCGGGCGCGG - Intronic
936054340 2:109249972-109249994 GATCTGGTGCAGGCCGGGCGCGG - Intronic
936102849 2:109598550-109598572 TATCATCGGGAGGCCGGGCGTGG + Intronic
936102920 2:109599165-109599187 ACTCAAGTGGAGGCCGGGCGCGG + Intronic
936591943 2:113812746-113812768 TCCCTAGGGGAGGCCGGGCAGGG + Intergenic
936697267 2:114965686-114965708 GATAAAGAGGAGGCCGGGCGCGG + Intronic
937366946 2:121269620-121269642 TATGTAAAAGAGGCCGGGCCTGG + Intronic
937970383 2:127544868-127544890 TAGCCAGACGTGGCCGGGCGCGG - Intronic
938033895 2:128019593-128019615 AATTCAGTGGAGGCCGGGCGTGG + Intronic
938290081 2:130144427-130144449 TTTATAGAGGGGCCCGGGCGCGG - Intronic
938466448 2:131528518-131528540 TTTATAGAGGGGCCCGGGCGCGG + Intronic
938538259 2:132263772-132263794 TATCAAGAGAAGGCCAGGCACGG + Intergenic
938725697 2:134107149-134107171 AAAATAGAGGAGGCTGGGCGCGG - Intergenic
940563511 2:155331904-155331926 TCTCTACAATAGGCCGGGCGCGG - Intergenic
940893871 2:159061945-159061967 AATATAAAGTAGGCCGGGCGTGG + Intronic
940918100 2:159280399-159280421 TACCCAGAAGTGGCCGGGCGCGG + Intronic
941649988 2:168082191-168082213 GATGTAGAGGAGGCAGGGCCTGG - Intronic
941821738 2:169850467-169850489 GATCCAGAGCAGGCCGGGTGCGG - Intronic
942025615 2:171907829-171907851 TCTCCAGTGGAGGCCAGGCGTGG - Intronic
942567047 2:177276899-177276921 CACATAGAGGGGGCCGGGCGAGG - Intronic
943023929 2:182606466-182606488 TACCTTGAGGAGGCTGGGCACGG - Intergenic
943438902 2:187901758-187901780 TAGCCAGGGCAGGCCGGGCGCGG + Intergenic
943561796 2:189472926-189472948 TATCATAAGGAGGCCGGGCACGG + Intronic
943727423 2:191266626-191266648 TTTCTAGAAGAGCCAGGGCGAGG - Intronic
943966298 2:194338171-194338193 AATCCAGCTGAGGCCGGGCGCGG + Intergenic
944191197 2:197006150-197006172 TATCATGATGCGGCCGGGCGTGG + Intronic
944239053 2:197468148-197468170 TAGTCAGAGGAGGCCGGGTGTGG + Intronic
944703290 2:202264647-202264669 TCTCTAGCGGTGGCGGGGCGCGG + Intergenic
944714090 2:202361742-202361764 AATCTATAAAAGGCCGGGCGCGG - Intergenic
944823893 2:203460824-203460846 TATAAAGATGAGGCCAGGCGTGG + Intronic
945081238 2:206088036-206088058 AATCCAGAATAGGCCGGGCGCGG - Intergenic
945254997 2:207796054-207796076 TATCTACATGCGGCCGGGTGTGG + Intergenic
945330918 2:208538057-208538079 GAGAGAGAGGAGGCCGGGCGCGG + Intronic
945389581 2:209247665-209247687 AAGCAACAGGAGGCCGGGCGCGG + Intergenic
945448301 2:209964496-209964518 TAACAAGATAAGGCCGGGCGCGG + Intronic
946259534 2:218475325-218475347 TATGTAAAGAAGGCTGGGCGAGG + Intronic
946981037 2:225215379-225215401 TAGCACGAGTAGGCCGGGCGCGG - Intergenic
947176621 2:227373638-227373660 TGTGTGGAAGAGGCCGGGCGCGG + Intronic
947359655 2:229334255-229334277 TATCTGTTGGAGGCCGGGCGTGG - Intergenic
1169344224 20:4817638-4817660 TCTCCAGAGGAGGCCTGGAGAGG - Intronic
1169436281 20:5594580-5594602 TACCTGGAGGCGGCCGGGCCTGG - Intronic
1169854585 20:10089292-10089314 TATCTATAGGAGGATGGGTGTGG + Intergenic
1170067194 20:12325893-12325915 TAGTTACAGGAGGCCGGGCGCGG + Intergenic
1170826195 20:19798139-19798161 TAAGTAGAATAGGCCGGGCGTGG - Intergenic
1171507569 20:25651005-25651027 TATCTATACAAGGCTGGGCGTGG - Intergenic
1172211495 20:33201857-33201879 TGTCTGGATGAGGTCGGGCGAGG - Intergenic
1172420449 20:34812723-34812745 AATCTAGAAGAGGTCAGGCGTGG + Intronic
1172636507 20:36413707-36413729 TGTCCAGAATAGGCCGGGCGCGG - Intronic
1172687836 20:36770352-36770374 TATCTAGAGTGGGCCAGGCACGG - Intronic
1172739455 20:37154287-37154309 AATCCAGAAGAGGACGGGCGTGG + Intronic
1173111351 20:40193331-40193353 TATCTATGTGTGGCCGGGCGCGG - Intergenic
1173239149 20:41278051-41278073 TAGCTAGGGGAGGCTGGGTGTGG + Intronic
1173513129 20:43645917-43645939 TTTCTATAGTGGGCCGGGCGCGG + Intronic
1173804337 20:45914042-45914064 TATAAATAGGCGGCCGGGCGCGG - Intergenic
1173930963 20:46818226-46818248 TACATAGAAGTGGCCGGGCGTGG + Intergenic
1173942444 20:46923075-46923097 GTTCTAGATGAGGCCGGGCACGG + Intronic
1174079246 20:47959306-47959328 TATCTATAGTGGGCCGGGCGCGG - Intergenic
1174770061 20:53291179-53291201 TATCAAGAGCAGGCTGGGAGCGG + Intronic
1175188934 20:57198484-57198506 CATCAGGAGGAGGCCGAGCGGGG - Intronic
1175562921 20:59947214-59947236 AATTTAGAGGTGGCTGGGCGTGG + Exonic
1175730710 20:61352005-61352027 TAACTAAAGGAGGCCGGGTGCGG - Intronic
1175856221 20:62122340-62122362 TATTTAAAGGACGGCGGGCGCGG + Intergenic
1177219368 21:18171495-18171517 GAACTAAAGAAGGCCGGGCGCGG - Intronic
1177365800 21:20133942-20133964 TATGTAAGGGAGGCCGGGTGCGG - Intergenic
1177546828 21:22569414-22569436 GATATAGAAGAGGCTGGGCGCGG + Intergenic
1177679511 21:24347556-24347578 TATTGAGAAGAGGCTGGGCGTGG - Intergenic
1177830459 21:26133493-26133515 CAACTAGAATAGGCCGGGCGCGG + Intronic
1178310024 21:31522159-31522181 TATTAAGAGCCGGCCGGGCGTGG - Intronic
1178325768 21:31644312-31644334 TATCCAGTTTAGGCCGGGCGTGG + Intergenic
1178498502 21:33106964-33106986 AATTTCAAGGAGGCCGGGCGTGG + Intergenic
1179096326 21:38319049-38319071 TATCTATTGGTGGCCGGGCACGG + Intergenic
1179175453 21:39004985-39005007 GTTCAAGAGGAGGCCTGGCGTGG - Intergenic
1179509969 21:41866029-41866051 GATCTAGTAGAGGCTGGGCGTGG - Intronic
1179786519 21:43733434-43733456 AAACTAGCGGAGGCCGGGCTTGG + Intronic
1180206209 21:46262675-46262697 AATAAAAAGGAGGCCGGGCGCGG + Intronic
1180313847 22:11260423-11260445 TATCAAGAGAAGGCCAGGCAAGG + Intergenic
1180341502 22:11623134-11623156 TATCAAGAGAAGGCCAGGCACGG - Intergenic
1180627569 22:17204324-17204346 TAAGAAGAGGAGGCCAGGCGTGG + Intronic
1180637745 22:17274420-17274442 TAACTAAAATAGGCCGGGCGCGG - Intergenic
1180674198 22:17576061-17576083 AAGGTAGAGGAGGCCGGGCATGG + Intronic
1180894007 22:19314670-19314692 TAACTAAAAGAGGCCAGGCGCGG + Intergenic
1181719993 22:24766610-24766632 TATCTAGGCTAGGCCAGGCGCGG - Intronic
1181815976 22:25437234-25437256 TATCTACACTAGGCCAGGCGTGG - Intergenic
1181828244 22:25537474-25537496 TACCCAAAGGAGGCCGGGCGCGG + Intergenic
1181845148 22:25700872-25700894 TACCCAAAAGAGGCCGGGCGCGG - Intronic
1182197746 22:28536332-28536354 TACTTAGAGGCGGCCGGGCGCGG + Intronic
1182217958 22:28735115-28735137 TATATACAGGGGGCCAGGCGCGG + Intronic
1182339151 22:29605462-29605484 TAGCTAGGTGAGGCTGGGCGGGG - Intronic
1182536502 22:31007756-31007778 TAAGAAGAGGAGGCCGGGTGTGG + Intergenic
1183120761 22:35728511-35728533 TGTCTAAAGTCGGCCGGGCGCGG - Intronic
1183222747 22:36527548-36527570 TATTTCTTGGAGGCCGGGCGCGG + Intronic
1183241513 22:36661166-36661188 TCTCTAGAGGAGTCCGGAAGTGG + Intronic
1183937144 22:41269442-41269464 TACCTAGAAGATGCCGGGCATGG + Intronic
1184000122 22:41667174-41667196 AAACCAGAAGAGGCCGGGCGCGG + Intergenic
1184623796 22:45705722-45705744 TAACAAGTGGAGGCCGGGCGCGG - Intronic
1184970230 22:48014489-48014511 AATCAAAAGGAGGCCGGGCATGG - Intergenic
1185290663 22:50025374-50025396 TACACAGAAGAGGCCGGGCGCGG + Intronic
949919424 3:8989446-8989468 GTTCTAGAGGAGGCCAGGCAGGG - Intronic
950061896 3:10078642-10078664 AAGCAAGATGAGGCCGGGCGCGG - Intronic
950722512 3:14893636-14893658 TAGCTAGAAGAGGCCAGGCATGG - Intronic
951226276 3:20125031-20125053 TATATACATGAGGCCGGGCGCGG + Intronic
951369940 3:21833492-21833514 AATCTAGAAGAGGCCAGGAGTGG + Intronic
951810439 3:26693038-26693060 GATCAAGAGCAGGCCGGGCGCGG + Intronic
952492846 3:33888446-33888468 TATCTGGAGTAGGCCTGGGGAGG + Intergenic
952498273 3:33935184-33935206 TGTCCAGAATAGGCCGGGCGCGG - Intergenic
952938214 3:38417899-38417921 TATATATATCAGGCCGGGCGTGG + Intronic
953164019 3:40448129-40448151 TACCTAAAAGAGGCCGGGCGCGG + Intergenic
954055628 3:48021634-48021656 TCTATAGATTAGGCCGGGCGTGG - Intronic
954606984 3:51919696-51919718 TATACAGATGAGGCCGGGTGCGG + Intergenic
954785104 3:53086945-53086967 TATGTGAAGGAGGCCAGGCGCGG + Intronic
955228472 3:57079412-57079434 TGTCGAGCGGTGGCCGGGCGTGG - Intergenic
955771010 3:62384609-62384631 AGTGTAGAGGAGGCTGGGCGCGG - Intergenic
956115926 3:65918667-65918689 AATGTTGTGGAGGCCGGGCGCGG - Intronic
956212414 3:66815247-66815269 TAACAAAAGGAGGCTGGGCGCGG + Intergenic
956510621 3:69989261-69989283 TTACCAGAGGGGGCCGGGCGCGG - Intergenic
956606502 3:71078120-71078142 TATACAGAGGAGGCCGGGCGGGG - Intronic
956726801 3:72163108-72163130 AATCCAGGGGAGGCCAGGCGCGG + Intergenic
956816530 3:72913326-72913348 AAACCTGAGGAGGCCGGGCGCGG - Intronic
956817441 3:72921109-72921131 TATATGCATGAGGCCGGGCGTGG - Intronic
957529685 3:81425349-81425371 TATTTCCAGGAGGCCGGGTGTGG + Intergenic
957832715 3:85544286-85544308 AAAAAAGAGGAGGCCGGGCGCGG + Intronic
957899733 3:86473839-86473861 TAACTAGAATAGGCCGGGTGCGG - Intergenic
959057427 3:101582028-101582050 TAGAAAGAGTAGGCCGGGCGTGG - Intronic
959087958 3:101871059-101871081 TATCATGCAGAGGCCGGGCGCGG - Intergenic
959115159 3:102168449-102168471 TAAATAAAGTAGGCCGGGCGCGG - Intronic
959819524 3:110716030-110716052 TATTTAGTGGAGGCTGGGCATGG - Intergenic
960076478 3:113491328-113491350 TATCTATAGCAGGCCGGGCGTGG + Intronic
960139383 3:114137699-114137721 TAGCCAGATGTGGCCGGGCGCGG + Intronic
960232399 3:115243825-115243847 TAACTAGGGGAGGCTGGGCGCGG + Intergenic
961534018 3:127558325-127558347 ATGCTGGAGGAGGCCGGGCGTGG + Intergenic
961739418 3:129023620-129023642 AATCAAGAGGTGGCCAGGCGCGG - Intronic
962115826 3:132506340-132506362 AATGTACAGAAGGCCGGGCGCGG - Intronic
962571530 3:136718632-136718654 TAAATAGAGGTGGCCAGGCGTGG + Intronic
962588899 3:136868945-136868967 TATCTTGTTGAGGCCGGGCGCGG + Intronic
962598531 3:136971419-136971441 TAGATAGAAGTGGCCGGGCGCGG - Intronic
962771277 3:138612389-138612411 TAGCCAGACAAGGCCGGGCGCGG - Intronic
963132649 3:141872925-141872947 CCTCTACAGTAGGCCGGGCGAGG - Intergenic
964628233 3:158779826-158779848 AATCAAAAAGAGGCCGGGCGTGG - Intronic
964906002 3:161721423-161721445 TAACAAAATGAGGCCGGGCGCGG + Intergenic
965472301 3:169109704-169109726 TACTTAGAAGAGGCCGGGTGCGG - Intronic
966222606 3:177565685-177565707 ATCCTAGAGGAGGCCGGGCGCGG - Intergenic
966402947 3:179565155-179565177 TATGTAGAAGGGGCCGGGTGCGG + Intronic
966834843 3:184041325-184041347 TATTTGGTGGCGGCCGGGCGTGG - Intergenic
966939554 3:184736937-184736959 CATATAGAGGAGGCTGGGCACGG - Intergenic
967347583 3:188475610-188475632 TATGAAAAGCAGGCCGGGCGTGG + Intronic
967594670 3:191315301-191315323 TTTGTAGAGTAGGCCGGGCGTGG - Intronic
967595932 3:191327203-191327225 GAACTAGGGGAGGCCGGGCGTGG + Intronic
968039402 3:195575914-195575936 TTTCTAGAATAGGCCAGGCGCGG - Intronic
968587045 4:1423813-1423835 TACCTAAAAGAGGCCGGGCGCGG - Intergenic
968823763 4:2877675-2877697 AATCAAGAGGGGGCCGGGTGTGG + Intronic
969185091 4:5468770-5468792 TATCTAGAGGAGGCCGGGCGCGG + Intronic
970218600 4:13784723-13784745 TACCAAAAGCAGGCCGGGCGCGG + Intergenic
970349880 4:15191806-15191828 TATGCATAGGAGGCCGGGCGCGG + Intergenic
970776024 4:19675131-19675153 TACCTATTGGGGGCCGGGCGTGG + Intergenic
971492875 4:27232641-27232663 TATCCAGAATGGGCCGGGCGTGG - Intergenic
971715135 4:30166356-30166378 TACTGAGAGCAGGCCGGGCGTGG + Intergenic
972096403 4:35352081-35352103 TATCTACAAGAGGCCAGGCGTGG + Intergenic
972487378 4:39555124-39555146 TATTTCCATGAGGCCGGGCGCGG - Intronic
972681497 4:41310866-41310888 TATCTAGTGGAGGCATGGTGGGG - Intergenic
972879766 4:43409047-43409069 AATGCAGAGGAGGCCGGGAGTGG + Intergenic
973674144 4:53247567-53247589 TAACAAGATCAGGCCGGGCGCGG + Intronic
974107049 4:57481489-57481511 TAGCTAGAAGAGGTTGGGCGAGG + Intergenic
974127793 4:57717189-57717211 GAACTAGAGAAGGCCGGGCGCGG + Intergenic
974259768 4:59510683-59510705 TATCACTAAGAGGCCGGGCGCGG - Intergenic
974687687 4:65251685-65251707 TATACTGAGGAGGCCAGGCGTGG + Intergenic
975050377 4:69856642-69856664 TAACTAAGGGCGGCCGGGCGCGG + Intronic
975242686 4:72080450-72080472 TATTTAGATTAGGCCAGGCGTGG - Intronic
975267958 4:72393212-72393234 TATCTGATGGAGGCCAGGCGCGG - Intronic
975298015 4:72756418-72756440 AACCCAGAAGAGGCCGGGCGTGG + Intergenic
975562420 4:75720222-75720244 TATTTTGAGGGCGCCGGGCGCGG + Intronic
975580899 4:75906261-75906283 TATCTAGAGGAGTCCAGCTGGGG + Intergenic
976179160 4:82382796-82382818 TATCAAAAGGAGGCTGGGAGTGG - Intergenic
976576791 4:86681635-86681657 TATATAATGTAGGCCGGGCGTGG + Intronic
976870939 4:89792609-89792631 AAACTACAAGAGGCCGGGCGCGG - Intronic
977310124 4:95375785-95375807 TATACAGAATAGGCCGGGCGTGG + Intronic
977933004 4:102768683-102768705 ATTCTAGAAGAGGCCAGGCGTGG + Intergenic
978101635 4:104848550-104848572 TATCAAGGTCAGGCCGGGCGTGG - Intergenic
978780722 4:112550560-112550582 AGTCTACAGTAGGCCGGGCGCGG + Intronic
979269961 4:118747973-118747995 TACCTATAGTAGGCCGGGCGTGG + Intronic
979480788 4:121214530-121214552 TATGGAGAGGTGGCCGGGTGAGG + Intronic
979499463 4:121422590-121422612 TCACGAGAGGAGGCCGGGTGCGG - Intergenic
979653977 4:123169769-123169791 AATATAGAACAGGCCGGGCGCGG - Intronic
979670620 4:123356964-123356986 TATCTGGCAGAGGCCGGGTGTGG - Intergenic
980445303 4:132898448-132898470 TGGCTGGAGGAGGCCGGGCGCGG + Intergenic
980933342 4:139202696-139202718 TAGTGAAAGGAGGCCGGGCGAGG + Intergenic
981314850 4:143332028-143332050 TATCCAAATCAGGCCGGGCGAGG - Intergenic
981727099 4:147860150-147860172 TAACAGGAGAAGGCCGGGCGTGG + Intronic
982160995 4:152569368-152569390 TATCTGGCCCAGGCCGGGCGCGG + Intergenic
982254803 4:153441463-153441485 TTACTAGAGCAGGCCGGGTGCGG + Intergenic
982837948 4:160146469-160146491 AATCTAGCAGAGGCCGGGCGGGG + Intergenic
982922075 4:161288374-161288396 AATCAAAAAGAGGCCGGGCGCGG + Intergenic
983081995 4:163397491-163397513 GAGCTAGTGGTGGCCGGGCGCGG - Intergenic
983729262 4:170972712-170972734 AATATATAAGAGGCCGGGCGCGG - Intergenic
983943548 4:173561959-173561981 AATCCAGATTAGGCCGGGCGTGG + Intergenic
984049516 4:174846301-174846323 AATGTAAAGGAGGCCGGGCGCGG - Intronic
984083737 4:175282721-175282743 TAGCTAGAGTCGGCCGGGCGTGG + Intergenic
984102536 4:175502535-175502557 TTATGAGAGGAGGCCGGGCGCGG - Intergenic
984281443 4:177675349-177675371 GACCTCAAGGAGGCCGGGCGCGG - Intergenic
984693642 4:182757020-182757042 GATCTTCAGGAGGCCGGGCGCGG + Intronic
984766859 4:183406482-183406504 AATAAAAAGGAGGCCGGGCGCGG + Intergenic
985026801 4:185746606-185746628 TAACCAGATAAGGCCGGGCGCGG - Intronic
985195102 4:187420795-187420817 AATCGAGCTGAGGCCGGGCGCGG + Intergenic
985300121 4:188479398-188479420 TCCCTAGAAGAGGCCGGGCGCGG - Intergenic
985335764 4:188892015-188892037 TAGCTAGAAGAGGCCGGGCGCGG - Intergenic
986550894 5:8953732-8953754 TATCAAAAGCTGGCCGGGCGTGG - Intergenic
986607860 5:9540297-9540319 TATGGAGAGAAGGCCGGGCGCGG + Intronic
986686784 5:10281867-10281889 TATATAAATGAGGCCAGGCGTGG + Intronic
987143087 5:14965187-14965209 AAACTAAAGGTGGCCGGGCGTGG - Intergenic
987178920 5:15346131-15346153 TACCTATCGGAGGCCGGGCGCGG + Intergenic
988015747 5:25556670-25556692 TATATAGAGGAGGCTGGGCATGG - Intergenic
988525607 5:31984549-31984571 TATCAAGTTGAGGCCAGGCGCGG + Intronic
988983247 5:36592770-36592792 TATCCAGTAGAGGCCGGGCACGG + Intergenic
989236584 5:39154880-39154902 AATTAAAAGGAGGCCGGGCGAGG - Intronic
989603091 5:43218299-43218321 TAGACAGAGGAGGCCGGGCACGG - Intronic
989802647 5:45563157-45563179 TATATAGTGAAGGCCGGGTGCGG + Intronic
990567138 5:57041267-57041289 TATACTGATGAGGCCGGGCGCGG + Intergenic
990743179 5:58933203-58933225 ATTCTGCAGGAGGCCGGGCGCGG + Intergenic
990963472 5:61419110-61419132 TATAAAGAGGAGGCCGGGCGTGG - Intronic
991673028 5:69065971-69065993 TAAAAATAGGAGGCCGGGCGTGG - Intergenic
991697458 5:69286521-69286543 TATCTAAAGTTGGCCGGGCGCGG - Intronic
993723068 5:91340942-91340964 AATAAAGAGGAGGCCGGGCATGG + Intergenic
993782238 5:92081507-92081529 TATCAAGTGCAGGCTGGGCGCGG - Intergenic
995100305 5:108292807-108292829 TATCTTGTTGAGGCCGGGCGTGG + Intronic
995507919 5:112879764-112879786 TATATGGAAGAGGCCGGGCATGG - Intronic
995866879 5:116701099-116701121 TATTTATTGTAGGCCGGGCGCGG + Intergenic
996359335 5:122628089-122628111 ATTCTAGAGCTGGCCGGGCGCGG - Intergenic
996555737 5:124777339-124777361 TATCTAGAGAAGGCCGGGTGTGG + Intergenic
997866026 5:137463657-137463679 TAACTAAAAGAGGCCGGGCGTGG + Intronic
997938435 5:138134991-138135013 TATTTAGTGACGGCCGGGCGCGG - Intronic
998120539 5:139573009-139573031 TATCAAGATGAGGCTGGGCGCGG + Intronic
998904147 5:146886046-146886068 TAGATAGGGGCGGCCGGGCGCGG + Intronic
999129150 5:149269671-149269693 AATTTATGGGAGGCCGGGCGCGG + Intergenic
999533399 5:152488202-152488224 GATATAGAGTAGGCCAGGCGTGG + Intergenic
999562217 5:152816333-152816355 AATATATTGGAGGCCGGGCGTGG - Intergenic
1000740896 5:164968948-164968970 TACCTGGAAGAGGCCGGGCACGG + Intergenic
1001115145 5:168933251-168933273 CAGCCAGAGGAGGCTGGGCGCGG + Intronic
1001552663 5:172615694-172615716 GATCCAAAAGAGGCCGGGCGTGG + Intergenic
1001567519 5:172709588-172709610 TAGCTGGACGTGGCCGGGCGCGG - Intergenic
1001779231 5:174353579-174353601 AAACTAGAGCAGGCCGGGCGCGG - Intergenic
1001895136 5:175372312-175372334 TAACTATTGGGGGCCGGGCGCGG - Intergenic
1002147851 5:177199883-177199905 TATTAAGTTGAGGCCGGGCGTGG - Intronic
1002341773 5:178521261-178521283 TATTTAAAGCTGGCCGGGCGCGG + Intronic
1002687675 5:181027140-181027162 GATATAGAGTGGGCCGGGCGCGG + Intergenic
1002708013 5:181175949-181175971 AAAATAAAGGAGGCCGGGCGCGG + Intergenic
1002918886 6:1551767-1551789 GATGTAGAGATGGCCGGGCGTGG + Intergenic
1003786121 6:9489254-9489276 TCTCTAGAGGAGGCCAGACGTGG + Intergenic
1004033926 6:11903209-11903231 TCTTTAGAGTGGGCCGGGCGCGG + Intergenic
1004091904 6:12512156-12512178 TATCTAAGGGAGGCCAGGTGCGG + Intergenic
1004105232 6:12661217-12661239 AATGGAGAAGAGGCCGGGCGCGG - Intergenic
1005298687 6:24450219-24450241 TATCTAAAATAGGCCGGGCACGG + Intronic
1005572311 6:27157255-27157277 TAAAGAGAAGAGGCCGGGCGCGG + Intergenic
1005903238 6:30237683-30237705 TACATATATGAGGCCGGGCGCGG + Intergenic
1005987585 6:30884273-30884295 TACCTGGGGGAGGCCGGGCCGGG + Intronic
1006351945 6:33527366-33527388 AATCTTCAGGAGGCCGGGCACGG - Intergenic
1006514853 6:34540008-34540030 AATTTAGGGCAGGCCGGGCGTGG + Intronic
1006551789 6:34830101-34830123 TAGCCAGGGGAGGCCAGGCGCGG - Intronic
1006945414 6:37781201-37781223 GATGTGGGGGAGGCCGGGCGTGG - Intergenic
1007444606 6:41895300-41895322 TAAATAGAGGGGGCCGGGGGAGG - Intronic
1007511390 6:42376829-42376851 TAGCTAGAGGAGGCCAGGTGCGG - Intronic
1007576459 6:42928275-42928297 AATAAAGAGGAGGCCGGGCTTGG - Intergenic
1008173745 6:48240719-48240741 ATACTAGAGGAGGCCTGGCGTGG - Intergenic
1008881964 6:56389070-56389092 TATGCAAAGGAGGCTGGGCGTGG + Intronic
1009450982 6:63800507-63800529 TTTCTGGAAGAGGCTGGGCGCGG + Intronic
1010159690 6:72838658-72838680 TATGGAGCTGAGGCCGGGCGCGG + Intronic
1011686560 6:89828702-89828724 TAGCCAGGGGTGGCCGGGCGTGG + Intergenic
1011893948 6:92200938-92200960 AAGTTAGAGCAGGCCGGGCGCGG + Intergenic
1012562969 6:100609050-100609072 TATTTATAGCAGGCCAGGCGCGG - Intronic
1012881511 6:104796398-104796420 TAACTAGAATAGGCTGGGCGTGG - Intronic
1013390800 6:109684582-109684604 TAGGCAAAGGAGGCCGGGCGCGG + Intronic
1013508982 6:110827472-110827494 TAACTACAAGAGGCCGGGTGTGG + Intronic
1014488932 6:122037550-122037572 TACCATAAGGAGGCCGGGCGCGG - Intergenic
1014756657 6:125309192-125309214 TGTCTAGAGGAGGCCATGCTAGG - Intergenic
1015011506 6:128354523-128354545 CATGTAAAGGAGGCTGGGCGTGG - Intronic
1015112849 6:129612941-129612963 CATCTGGAGTAGGCCGGGCATGG + Intronic
1015600213 6:134904174-134904196 TATCTGCACCAGGCCGGGCGCGG - Intergenic
1016047444 6:139495306-139495328 TGTATGGTGGAGGCCGGGCGTGG - Intergenic
1016082225 6:139870329-139870351 TAGCCAGAGCAGGCCAGGCGCGG + Intergenic
1016100185 6:140090390-140090412 TAATTGGAGGTGGCCGGGCGTGG + Intergenic
1016279887 6:142404348-142404370 CTTCTGGAGGAGGCTGGGCGCGG + Intronic
1016578299 6:145597182-145597204 GATCTCGGAGAGGCCGGGCGCGG - Intronic
1016910953 6:149198642-149198664 AAACTAGGAGAGGCCGGGCGTGG + Intergenic
1017294580 6:152778763-152778785 AATATACAAGAGGCCGGGCGCGG - Intergenic
1017520572 6:155198370-155198392 TCTCTTAATGAGGCCGGGCGTGG + Intronic
1017575368 6:155796529-155796551 AATTTGGAGAAGGCCGGGCGCGG + Intergenic
1017902871 6:158733615-158733637 TAGGTAGAGGTGGCCGGGCACGG - Intronic
1018195004 6:161347904-161347926 AAGTTAGAGCAGGCCGGGCGCGG - Exonic
1018591095 6:165423575-165423597 TACCCAGATTAGGCCGGGCGCGG + Intronic
1019726414 7:2605328-2605350 TCCCTATAGTAGGCCGGGCGCGG + Intronic
1020036849 7:4969021-4969043 TAACTAAAAGAGGCCGGGCGTGG - Intergenic
1020065633 7:5186393-5186415 TATATATTGCAGGCCGGGCGTGG + Intergenic
1020224370 7:6268458-6268480 TTACAAGAGCAGGCCGGGCGCGG - Intronic
1020364288 7:7363934-7363956 AATGTGGAGGAGGCTGGGCGTGG - Intronic
1020525845 7:9257662-9257684 AACTTAGAAGAGGCCGGGCGCGG + Intergenic
1020530088 7:9322286-9322308 AAACTAGAACAGGCCGGGCGCGG - Intergenic
1020561469 7:9732730-9732752 TAAATAGAGGGGGCCGGGCACGG - Intergenic
1020625958 7:10579939-10579961 TATTTAGAGGGGGCGGGGCATGG + Intergenic
1020885906 7:13819158-13819180 TATCTATATTCGGCCGGGCGCGG + Intergenic
1021458783 7:20860945-20860967 TATCTAATGGCGGCCGGGCGCGG - Intergenic
1021814341 7:24432932-24432954 AAGCTGGAGGAGGCCGCGCGCGG - Intergenic
1021850236 7:24800950-24800972 TTTTTAAAGGAGGCCGGGTGTGG + Intronic
1022021950 7:26408518-26408540 TATAGAGAAGAGGCCGGGTGCGG + Intergenic
1022228188 7:28385384-28385406 TATGTATATGAGGCCAGGCGTGG + Intronic
1022618767 7:31960163-31960185 TAGCAAGTTGAGGCCGGGCGCGG - Intronic
1022704827 7:32792512-32792534 TCCCTGGAGGTGGCCGGGCGCGG + Intergenic
1022761862 7:33364236-33364258 AATATAGTGAAGGCCGGGCGCGG - Intronic
1023408971 7:39868984-39869006 TATGTAGAATAGGCTGGGCGCGG + Intergenic
1023826109 7:44010817-44010839 ACTCTAAAGGTGGCCGGGCGTGG + Intergenic
1023952056 7:44854109-44854131 TAGCCAAAAGAGGCCGGGCGCGG - Intergenic
1024237630 7:47409950-47409972 TTTAAAGAGGAGGCCGGGCTGGG - Intronic
1024666107 7:51548762-51548784 TATGTAGATAAGGCCGGGCATGG + Intergenic
1024742290 7:52367501-52367523 AACCTAGATGAGGCCGGGCGCGG - Intergenic
1025845491 7:65192740-65192762 TCAGTGGAGGAGGCCGGGCGCGG + Intergenic
1025860620 7:65323721-65323743 TAGGTAAAGGAGGCCGGGCACGG - Intergenic
1026089680 7:67289686-67289708 ACTCTAAAGGTGGCCGGGCGTGG + Intergenic
1026091076 7:67301537-67301559 TATCTGAAGTGGGCCGGGCGCGG - Intergenic
1026238213 7:68547949-68547971 TATCTAGGGAAGGCGGGGCTGGG - Intergenic
1026474680 7:70724733-70724755 TGTCAGGATGAGGCCGGGCGCGG - Intronic
1026519229 7:71102081-71102103 AATTTGGAGGCGGCCGGGCGCGG + Intergenic
1026724605 7:72860823-72860845 ACTCTAAAGGTGGCCGGGCGTGG - Intergenic
1027119273 7:75504997-75505019 ACTCTAAAGGTGGCCGGGCGTGG + Intergenic
1027229900 7:76266156-76266178 TATATAAATAAGGCCGGGCGCGG - Intronic
1027326005 7:77049697-77049719 ACTCTAAAGGTGGCCGGGCGTGG - Intergenic
1027546679 7:79536006-79536028 TCCATAGAGGTGGCCGGGCGCGG + Intergenic
1027855001 7:83500145-83500167 TACTTAAAAGAGGCCGGGCGTGG + Intronic
1028171757 7:87605422-87605444 TTGATAGAGGAGGCTGGGCGTGG - Intronic
1028255873 7:88597259-88597281 TATCTACTGGGGGCCGGGCGCGG + Intergenic
1028334803 7:89638555-89638577 AATGTAAAGTAGGCCGGGCGCGG - Intergenic
1028805707 7:95023840-95023862 GAACTAGAGAAGGCCGGGCATGG - Intronic
1029089034 7:98033653-98033675 TAACTGAAAGAGGCCGGGCGCGG - Intergenic
1029140712 7:98407866-98407888 AAACTCTAGGAGGCCGGGCGCGG - Intergenic
1029212141 7:98917829-98917851 TATGTAAAGAAGGCCGGGCACGG + Intronic
1029281644 7:99439279-99439301 GATCCAGAGGAAGCCGGGGGAGG - Intronic
1029337914 7:99918275-99918297 TATCTCATTGAGGCCGGGCGTGG + Intronic
1029647302 7:101866032-101866054 AAACTAGAGGAGGCCAGGCATGG + Intronic
1029680148 7:102102848-102102870 TATCTGGAGGAGGGCGCACGTGG + Intronic
1029718220 7:102345037-102345059 ACTCTAAAGGTGGCCGGGCGTGG - Intergenic
1029754395 7:102564219-102564241 ACTCTAAAGGTGGCCGGGCGTGG + Intronic
1029772344 7:102663300-102663322 ACTCTAAAGGTGGCCGGGCGTGG + Intronic
1030001770 7:105072019-105072041 TACCATTAGGAGGCCGGGCGCGG + Intronic
1030699375 7:112621838-112621860 AAGATGGAGGAGGCCGGGCGCGG + Intergenic
1031410033 7:121430444-121430466 TATCTAGTGGAGGCCAGACATGG - Intergenic
1032165970 7:129545242-129545264 TACCTAGGAGAGGCCAGGCGTGG + Intergenic
1032231865 7:130081287-130081309 TATATAAAAGAGGCCAGGCGCGG - Intronic
1032852455 7:135806686-135806708 TAAATATAGGAGGCCAGGCGAGG + Intergenic
1033351550 7:140566320-140566342 AATGTAAAGGAGGCCAGGCGCGG - Intronic
1033487407 7:141804656-141804678 TAACAAGAGGTGGCCGGGCCTGG + Intergenic
1033566293 7:142581284-142581306 CATCTAGAGGAGCCCGGTTGCGG - Intergenic
1033814891 7:145059756-145059778 TGTCAAGATGTGGCCGGGCGCGG + Intergenic
1034088875 7:148345671-148345693 TATCTAGTGACGGCCGGGCACGG - Intronic
1034251517 7:149695230-149695252 AAACAAGAAGAGGCCGGGCGTGG + Intergenic
1034271883 7:149807032-149807054 GATCTAGAGGTGGGCAGGCGTGG + Intergenic
1034310450 7:150083234-150083256 TATCTAGAGGAGGCTGGGCATGG - Intergenic
1034796392 7:154017407-154017429 TATCTAGAGGAGGCTGGGCATGG + Intronic
1035150188 7:156863857-156863879 TAGCTAGAGAAGACCAGGCGTGG + Intronic
1035190448 7:157163093-157163115 TACCCAGAGATGGCCGGGCGCGG + Intronic
1035749571 8:1986880-1986902 AAACTAGATGAGGCCAGGCGTGG + Intronic
1036061352 8:5324974-5324996 TAGGCAGAGCAGGCCGGGCGCGG + Intergenic
1036929774 8:12944389-12944411 TATATAGAAGAGGCCAGGTGTGG + Intergenic
1037269855 8:17114827-17114849 ACCCCAGAGGAGGCCGGGCGCGG + Intronic
1037578094 8:20226705-20226727 TATCCAGAACAGGCCGGGCGCGG - Intronic
1037735445 8:21562176-21562198 CATGTAGAGGAGGCTGGGTGTGG - Intergenic
1038174263 8:25165983-25166005 TAACAAATGGAGGCCGGGCGCGG + Intergenic
1038200381 8:25407579-25407601 TAGGTTGAGGAGGCCGGGCATGG + Intronic
1039539413 8:38351265-38351287 TTTCTAGAAGAGGCCAGGCATGG - Intronic
1039915287 8:41855880-41855902 CATCTAGTGTAGGCCGGGCCTGG + Intronic
1041045848 8:53885321-53885343 TATACAGCAGAGGCCGGGCGCGG + Intronic
1041279138 8:56194006-56194028 TACCTAATGAAGGCCGGGCGTGG - Intronic
1041695361 8:60730568-60730590 TATTAAATGGAGGCCGGGCGTGG + Intronic
1042183858 8:66117874-66117896 TGTTCAGAGGAGGCCGGGCACGG + Intergenic
1043884753 8:85586191-85586213 TATCTATAAAAGGCCGGGCGCGG - Intergenic
1044327384 8:90875189-90875211 TAGATAGTTGAGGCCGGGCGCGG + Intronic
1044357389 8:91239078-91239100 TATATAGATGAGGCCGGGTGTGG + Intronic
1044804691 8:95992992-95993014 TACCTGAAGGGGGCCGGGCGCGG + Intergenic
1044981511 8:97720942-97720964 TATCAAACAGAGGCCGGGCGTGG - Intronic
1045044250 8:98259363-98259385 TATTTAAAGGAGGCCGGGTGCGG - Intronic
1045534366 8:103013226-103013248 ATTCTAGAAGAGGCCGGGCGCGG + Intergenic
1045924262 8:107567808-107567830 TATCCAGAAGAGGCTGGGCATGG + Intergenic
1047055492 8:121160173-121160195 AATCCTCAGGAGGCCGGGCGCGG + Intergenic
1047949743 8:129922571-129922593 TATCTAATAAAGGCCGGGCGCGG + Intronic
1048352235 8:133625428-133625450 GGTCTTGAGTAGGCCGGGCGCGG + Intergenic
1048367454 8:133750752-133750774 ATTTTAGAGTAGGCCGGGCGCGG - Intergenic
1049636831 8:143693583-143693605 AGCCCAGAGGAGGCCGGGCGCGG - Intronic
1049721568 8:144118330-144118352 TATCTAGTTTAGGCCGGGTGTGG + Intergenic
1049727521 8:144155946-144155968 TAACAAGTTGAGGCCGGGCGCGG + Intronic
1049754176 8:144301574-144301596 GCTCCAGAAGAGGCCGGGCGCGG + Intronic
1050756339 9:9008514-9008536 AATGAAGGGGAGGCCGGGCGCGG - Intronic
1051144847 9:14016059-14016081 TTTGTAGATGAGGCCGGGCATGG + Intergenic
1051277915 9:15414945-15414967 AATCTAGACCAGGCCGGGCGCGG + Intergenic
1051894512 9:21974180-21974202 TATTCAGAAGCGGCCGGGCGCGG - Intronic
1052426746 9:28314692-28314714 TAAATATATGAGGCCGGGCGCGG + Intronic
1052754340 9:32525368-32525390 GATATCGATGAGGCCGGGCGTGG - Intronic
1053071144 9:35102774-35102796 AATCCAGAGGAGGCGCGGCGCGG + Exonic
1053191065 9:36069247-36069269 TATGAAGAGCAGGCCGGGTGCGG + Intronic
1053254773 9:36607073-36607095 AATGTAGAGGTGGCCGGGCCTGG - Intronic
1053546972 9:39033138-39033160 GAACTAGTTGAGGCCGGGCGTGG - Intergenic
1054774508 9:69113785-69113807 AAGATAGAGGAGGCTGGGCGTGG - Intergenic
1054799963 9:69337296-69337318 AATATAGAGGAGTCCAGGCGCGG - Intronic
1055002719 9:71470953-71470975 TACTTAGAGGGGGCCAGGCGCGG - Intergenic
1055479605 9:76696714-76696736 AACCTAGTGGAGGCTGGGCGTGG - Intronic
1055589548 9:77797321-77797343 GATGTACTGGAGGCCGGGCGCGG - Intronic
1055961177 9:81821871-81821893 TATAAAGAGATGGCCGGGCGCGG + Intergenic
1056210007 9:84356539-84356561 TACCTAAATGAGGCCGGGCAAGG + Intergenic
1056353127 9:85771947-85771969 TATCTATATCAGGCTGGGCGCGG - Intergenic
1056648575 9:88437053-88437075 GACACAGAGGAGGCCGGGCGCGG - Intronic
1056984092 9:91345541-91345563 TACCCAGAGAAGGCCAGGCGTGG + Intronic
1057320637 9:94009583-94009605 TGTTTAGAACAGGCCGGGCGCGG + Intergenic
1057356392 9:94335147-94335169 TATCTAAAGAAGGCCAGGCACGG - Intergenic
1057601682 9:96463543-96463565 TATCTAAAGCAGGCTGGGCTCGG - Intronic
1057651357 9:96922480-96922502 TATCTAAAGAAGGCCAGGCACGG + Intronic
1058693374 9:107538215-107538237 TAACTGGTGTAGGCCGGGCGCGG + Intergenic
1058708218 9:107655233-107655255 TATATAGAGAGGGCTGGGCGTGG + Intergenic
1058780790 9:108332590-108332612 AGTATAGAGGAGGCCGGGCACGG + Intergenic
1059070826 9:111134185-111134207 TAAATATAGGAGGCCGGGCGTGG + Intergenic
1059475108 9:114540312-114540334 TATGCAAAGGAGGCCGGGTGCGG + Intergenic
1059535608 9:115077478-115077500 TATGATGAGGAGGCCGGGCGTGG - Intronic
1060082085 9:120658275-120658297 AATGTAGAAGAGGCTGGGCGCGG - Intronic
1060109220 9:120894605-120894627 TGCCAAGAGAAGGCCGGGCGCGG + Intronic
1060161807 9:121370858-121370880 AAAGGAGAGGAGGCCGGGCGCGG + Intergenic
1060642178 9:125248332-125248354 TATGAAGAGCTGGCCGGGCGCGG + Intergenic
1060674798 9:125504025-125504047 TATCTTAAGGAGGCTGGGCAGGG - Intronic
1060850888 9:126874338-126874360 TACATAGCAGAGGCCGGGCGTGG - Intronic
1061350592 9:130061651-130061673 TAGCCAGGGCAGGCCGGGCGTGG + Intronic
1061803237 9:133123521-133123543 CATCTACAGGAGCCAGGGCGGGG + Intronic
1061988840 9:134146524-134146546 TAGATAAGGGAGGCCGGGCGCGG - Intronic
1062287721 9:135780537-135780559 AAGCGAGAGGAGGCCGGGCTGGG + Intronic
1185452468 X:290135-290157 TTTTTAGTAGAGGCCGGGCGCGG + Intronic
1185509068 X:649326-649348 AAGAGAGAGGAGGCCGGGCGCGG - Intronic
1185689753 X:2144679-2144701 TAAGAACAGGAGGCCGGGCGTGG + Intergenic
1185702210 X:2239464-2239486 AATTTAAAAGAGGCCGGGCGTGG + Intronic
1185710783 X:2301924-2301946 GAGCTAGATGAGGCCGGGTGAGG - Intronic
1185730753 X:2459815-2459837 TATCTACACTGGGCCGGGCGCGG + Intronic
1186492146 X:9982202-9982224 AAGCTTGAGGTGGCCGGGCGTGG + Intergenic
1186493647 X:9994533-9994555 TAACTAAAAGAGGCCGAGCGCGG - Intergenic
1186737211 X:12478282-12478304 AAACCAGAGTAGGCCGGGCGTGG + Intronic
1186801469 X:13096577-13096599 TATACAGAGGAGGCCGGGCGTGG - Intergenic
1186804459 X:13126183-13126205 AATCTTGAGGTGGCCAGGCGCGG - Intergenic
1187016484 X:15334478-15334500 AATGTAGATGAGGCCGGGCACGG - Intronic
1187027019 X:15446117-15446139 TATCTTGAATAGGCCGGGTGTGG - Intronic
1187120344 X:16399535-16399557 TAACTAAAAGAGGCCGGGCATGG - Intergenic
1187146639 X:16643495-16643517 ATACTAGAGGAGGCCGGGCGTGG - Intronic
1187890728 X:23932702-23932724 TAGCAACAGGAGGCCGGGCGTGG + Intronic
1188176787 X:27001191-27001213 CTTCTAGTGGAGGCCAGGCGTGG + Intergenic
1188365127 X:29306238-29306260 TATTTATGGGGGGCCGGGCGCGG + Intronic
1188390016 X:29608534-29608556 TAAGAGGAGGAGGCCGGGCGCGG + Intronic
1188885376 X:35543348-35543370 TATCTTGAGATGGCCAGGCGTGG - Intergenic
1189080047 X:37961072-37961094 AATCTGGAGGAGGCCGGGCGCGG - Intronic
1189214482 X:39311338-39311360 TATATAGAGGAGCCCAGGAGTGG + Intergenic
1189391750 X:40582135-40582157 AACCTATGGGAGGCCGGGCGCGG + Intronic
1189401216 X:40670469-40670491 TATAAAGGAGAGGCCGGGCGCGG + Intronic
1189464079 X:41264931-41264953 TTGCTAGAGGGGGCCGGGCGCGG - Intergenic
1189623168 X:42865720-42865742 TATTTAGTGGTGGCCGGGCATGG - Intergenic
1190156600 X:47998564-47998586 TGCTTAGAGGAGGCCGGGTGTGG + Intronic
1190308063 X:49097616-49097638 TAGCTGGGGGAGGCCAGGCGCGG - Intronic
1192487676 X:71544074-71544096 TATATATATCAGGCCGGGCGTGG - Intronic
1194305003 X:92233003-92233025 TATTTAGGGCAGGCCGGGCGCGG - Intronic
1194478706 X:94392786-94392808 TATATGGAGGAGGCTGGGCATGG - Intergenic
1195130954 X:101851640-101851662 TAAAAAGAAGAGGCCGGGCGCGG + Intronic
1195495019 X:105521232-105521254 TAGCTATAGCAGGCCGGGCGCGG - Intronic
1195633797 X:107090083-107090105 TGTCTAATGGAGGCCGGGCGTGG + Intronic
1195642904 X:107196738-107196760 TACATAAAGGAGGCCGGGCGTGG - Intronic
1195778292 X:108432543-108432565 AAACAAGAGGAGGCCGGGTGCGG + Intronic
1195965134 X:110423035-110423057 AAGACAGAGGAGGCCGGGCGCGG + Intronic
1196013074 X:110908740-110908762 GAACTAGAGAAGGCCGGGAGTGG - Intergenic
1196301584 X:114054565-114054587 TATGTTGAGAAGGCCGGGCGTGG - Intergenic
1196329841 X:114458699-114458721 TATTTAAAAGGGGCCGGGCGCGG + Intergenic
1196780433 X:119378680-119378702 TACCTAGAAGAGGCCGGGCGCGG + Intergenic
1196924466 X:120620019-120620041 TATCTGGGGAAGGCCGGGCACGG + Intronic
1197767675 X:130069675-130069697 TATCTAGAGGAAGAGGGGCAGGG + Exonic
1197942985 X:131808911-131808933 TATCTAGCCATGGCCGGGCGCGG - Intergenic
1198005500 X:132489419-132489441 TCCCTCGCGGAGGCCGGGCGTGG + Intronic
1198831985 X:140760478-140760500 TAGCTTGAATAGGCCGGGCGCGG + Intergenic
1199980527 X:152918102-152918124 TAGCCAGAGGAGGAGGGGCGGGG - Exonic
1200764362 Y:7068009-7068031 AAACTAGAGCAGGCCAGGCGCGG + Intronic
1201983756 Y:19938803-19938825 TACATAGAATAGGCCGGGCGCGG + Intergenic