ID: 969185386

View in Genome Browser
Species Human (GRCh38)
Location 4:5470601-5470623
Sequence GGGTCGGCTGATGCATCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 52}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969185386_969185394 -1 Left 969185386 4:5470601-5470623 CCCCAAGATGCATCAGCCGACCC 0: 1
1: 0
2: 1
3: 3
4: 52
Right 969185394 4:5470623-5470645 CCATCCCCACCTCATCTTGTGGG No data
969185386_969185392 -2 Left 969185386 4:5470601-5470623 CCCCAAGATGCATCAGCCGACCC 0: 1
1: 0
2: 1
3: 3
4: 52
Right 969185392 4:5470622-5470644 CCCATCCCCACCTCATCTTGTGG 0: 1
1: 0
2: 2
3: 26
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969185386 Original CRISPR GGGTCGGCTGATGCATCTTG GGG (reversed) Intronic
900573647 1:3372335-3372357 GGCTGAGCTGATGCAGCTTGGGG - Intronic
900827051 1:4935248-4935270 GGGTGGGCTGATGCTTTTGGGGG + Intergenic
903033446 1:20479489-20479511 GGGTCAGTGGAGGCATCTTGGGG - Intergenic
904118270 1:28178036-28178058 GGGTCGGCTGATGTATCTGAGGG - Intronic
915914933 1:159935197-159935219 GGGGCTGCTGCAGCATCTTGAGG - Intronic
917441985 1:175076383-175076405 GACTGGGCTGATTCATCTTGGGG - Intronic
917647145 1:177040419-177040441 GGGGATGCTGAAGCATCTTGAGG - Intronic
917869696 1:179229927-179229949 GGGTCGGCTGAGGCGGATTGAGG - Intergenic
919790890 1:201290306-201290328 GGGTGGGCAGATGCTTCCTGAGG + Intronic
923435465 1:233963915-233963937 AGGTTGGCTGATGCACCTGGGGG + Intronic
923441055 1:234021074-234021096 AGGTGGTCTGATGCATCATGGGG - Intronic
1073650815 10:105356047-105356069 GGGTTCAGTGATGCATCTTGCGG + Intergenic
1077815315 11:5681241-5681263 GGGTCGGCTGCTGCTTCTTGCGG + Intronic
1092670230 12:10853843-10853865 GAGTCTGCTGATGCAGCTGGGGG + Intronic
1099577938 12:84404259-84404281 GGGTCCCCAGATTCATCTTGTGG + Intergenic
1101364377 12:104058147-104058169 GGGACTGCTGATGCTTCTAGTGG + Intronic
1102951571 12:117034889-117034911 GGGCAGGCTGATGCGTCTTGTGG - Intergenic
1107474060 13:40717821-40717843 GGCTTGACTGTTGCATCTTGAGG - Intergenic
1113898254 13:113779489-113779511 GCGTCTGCTGATACATCTAGGGG + Intronic
1126093910 15:45074276-45074298 GGGTGGGCTGGGGCATGTTGGGG - Exonic
1134378531 16:13702421-13702443 GCGTGGGCTGATGGATCTTTGGG - Intergenic
1141891718 16:86930648-86930670 GGGTGGGGTGGTGAATCTTGGGG - Intergenic
1142646131 17:1315079-1315101 GGTGAGGCTGATGCATCTTAAGG - Intergenic
1146193305 17:30789202-30789224 GGGCCTGGTGATGCATCTTTAGG + Intronic
1147250884 17:39151843-39151865 GGGGCGGCTGATGCTTCTAGGGG - Intronic
1156452828 18:37276145-37276167 GGGGCTGCTGAGGCATCTTCAGG - Intronic
1160864857 19:1252067-1252089 GGGTCAGGTGGTGAATCTTGGGG - Intronic
1161638018 19:5401468-5401490 TGGCCGGCTGCTGCTTCTTGAGG - Intergenic
1162745047 19:12793427-12793449 GGTTCGGCGCAGGCATCTTGTGG + Intronic
1164722689 19:30444078-30444100 GGGTCCGCAGGTGAATCTTGAGG - Exonic
933211066 2:79569314-79569336 GGGTCGGCTGGGGGGTCTTGAGG + Intronic
934897891 2:98134328-98134350 GGGCCTGCGGATGCAGCTTGAGG + Intronic
935667177 2:105522947-105522969 CGGTCTGCTGCTGCATCTGGAGG - Intergenic
941620240 2:167769536-167769558 GGGTTGCCTGATGGATTTTGGGG - Intergenic
945005876 2:205405357-205405379 GGGTTGGATGATTCATGTTGTGG - Intronic
948210724 2:236191284-236191306 GGGTCAGCTGATGGAGCTGGGGG + Intergenic
1172115985 20:32573974-32573996 GGGGCTGCTGCTCCATCTTGGGG - Intronic
1172917879 20:38457412-38457434 AGGAAGGCTGCTGCATCTTGTGG + Intergenic
1174609939 20:51790721-51790743 GGGTGCGATAATGCATCTTGAGG + Exonic
1180229889 21:46420957-46420979 GGGTGGCCTGAGGCATTTTGAGG + Intronic
950032643 3:9862691-9862713 GGCTCGGGTGAGGCATCTGGAGG + Intergenic
956890464 3:73608089-73608111 GGGTCTGCTGATGAATGTGGTGG + Intronic
967411238 3:189168575-189168597 GGGTAGACAGATGCATATTGGGG + Intronic
969185386 4:5470601-5470623 GGGTCGGCTGATGCATCTTGGGG - Intronic
993185140 5:84608142-84608164 GGGGCTGCTGATGCATGTTCTGG + Intergenic
995940095 5:117571142-117571164 GGGTTGGCTGAAGCATTTTTAGG + Intergenic
1000382606 5:160642531-160642553 GGGGGTGCTAATGCATCTTGTGG + Intronic
1000916052 5:167083167-167083189 TGGTCCGTTGATGCTTCTTGGGG + Intergenic
1001289250 5:170444881-170444903 GGGTGGGCTGAGGCAGCTGGAGG - Intronic
1001891961 5:175347046-175347068 GGCTCGGCTGCTGCATCAGGAGG + Intergenic
1023035848 7:36130817-36130839 GGGGCTGCAGAAGCATCTTGGGG + Intergenic
1048071608 8:131027494-131027516 GGGTGGCTTGATGAATCTTGGGG + Intronic
1059340624 9:113595526-113595548 GGGTAAGCTGAGGCATCTTAAGG + Intronic
1061762611 9:132860821-132860843 GGGTGGGCTGCTGCAGATTGTGG + Intronic
1186477351 X:9867840-9867862 GGGAAGGCTGATGGATGTTGTGG + Intronic
1187295979 X:18001022-18001044 GGGTATTCTGATGCATGTTGAGG - Intergenic
1193326427 X:80182948-80182970 TGGGCACCTGATGCATCTTGTGG + Intergenic