ID: 969195354

View in Genome Browser
Species Human (GRCh38)
Location 4:5558889-5558911
Sequence CTGTTGGAATGGAGAGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 605
Summary {0: 1, 1: 0, 2: 7, 3: 69, 4: 528}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969195347_969195354 22 Left 969195347 4:5558844-5558866 CCACATAAGTAAATGGCTGGGAA 0: 1
1: 0
2: 0
3: 10
4: 142
Right 969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG 0: 1
1: 0
2: 7
3: 69
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969195354 Original CRISPR CTGTTGGAATGGAGAGGAGA AGG Intronic
900090867 1:919857-919879 GTGTTGGCAGGGGGAGGAGAGGG + Intergenic
900539209 1:3194429-3194451 CTGTTGGAATTTAAAGGATAAGG - Intronic
900924921 1:5699017-5699039 GTGTAGGAATGGAAGGGAGAGGG - Intergenic
902230301 1:15023378-15023400 ATGTTTGAATAAAGAGGAGATGG + Intronic
902259891 1:15216877-15216899 CTGTGGGATTGGAGAGGGGTAGG + Intronic
902615441 1:17621063-17621085 ATGGTGGAAGGGAAAGGAGAAGG + Intronic
902618087 1:17634812-17634834 CTGTTGGAACAGAGAGGACAAGG - Intronic
902969023 1:20033297-20033319 GTGTTGGAAGTGGGAGGAGAGGG + Intronic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
903830294 1:26170395-26170417 CTGTAGGAATGGAAGTGAGAAGG - Intronic
904309772 1:29621236-29621258 CAGTGGGAATGGGAAGGAGAAGG + Intergenic
904485661 1:30823212-30823234 GTGGTGGAAGGGAGAGGAAAAGG - Intergenic
905201155 1:36318030-36318052 CTGTTGGAATGTCCAGGTGAAGG + Intronic
905473204 1:38208169-38208191 CTGCTGGGATGGAGACCAGAGGG + Intergenic
905544358 1:38785994-38786016 CAATGGGAATGGAGAGGAAAGGG + Intergenic
906075049 1:43045998-43046020 CTGCAGGAATGGAGAGTACAAGG - Intergenic
906929056 1:50150602-50150624 CTATTGGGTTGAAGAGGAGAGGG + Intronic
906996522 1:50800870-50800892 ATGTTTGAATTGAGAGGAAAGGG + Intronic
907240630 1:53079092-53079114 CTGTCTGAAGGGTGAGGAGAAGG + Intronic
907379603 1:54075283-54075305 CTGTGGGAATACAGGGGAGACGG + Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907855363 1:58298428-58298450 CTGTTGGAATAGGAATGAGATGG + Intronic
908686862 1:66730577-66730599 CTGTTGAAATGTATTGGAGAGGG - Intronic
910895388 1:92064141-92064163 CTGTTGGAACGGAAAGGGAAAGG + Intergenic
911424977 1:97697309-97697331 CTGTTTGGATGCAAAGGAGAAGG + Intronic
911522069 1:98941120-98941142 CTGTTGGAAGGGATAACAGAGGG + Intronic
913501783 1:119478401-119478423 CTGTTAGAATGGAGCGAAGAAGG + Intergenic
913509678 1:119550316-119550338 CTGTTAGAATGGAGAGAGGAAGG + Intergenic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
914758105 1:150577900-150577922 CTGTTTTAATGGAGAAGATATGG - Intronic
914830139 1:151165255-151165277 CTGTTGGCAGGGTGAAGAGATGG - Exonic
915993025 1:160536219-160536241 CTGTTGGGATGAGGAGGGGATGG + Intergenic
916530939 1:165655713-165655735 CTGCTGGAAGGGTGAGGAGAGGG - Intronic
916735781 1:167605736-167605758 CTGTCTGGTTGGAGAGGAGAAGG - Intergenic
916769149 1:167891325-167891347 CTGTTGTGTTGGAGAGAAGAGGG - Intronic
917318222 1:173751186-173751208 CTGTCAGAATGGAGATGAAACGG - Intronic
917727254 1:177839590-177839612 GTGTCGGGGTGGAGAGGAGAAGG - Intergenic
917797314 1:178541751-178541773 CTGTTGGCCTGGGGTGGAGAGGG + Intronic
919725237 1:200878169-200878191 TTGTAGCCATGGAGAGGAGATGG + Intergenic
919775492 1:201191604-201191626 CTGTTGGATTGGAGACTAGAGGG - Intronic
919936104 1:202251834-202251856 CACCTGGAAGGGAGAGGAGATGG + Intronic
920234523 1:204494121-204494143 CTGCTGGAGTGGAGTGGAGTGGG + Intronic
920388803 1:205586144-205586166 ATATGGGAATGGAGAGGAGCCGG - Exonic
920950130 1:210564801-210564823 CTGATGGAATGGGGAGGGGAGGG + Intronic
921327778 1:214004528-214004550 GTTTTGGCATGGAGAGGACAGGG - Intronic
922566617 1:226605582-226605604 CTGAGGGGATGGAGAAGAGATGG - Exonic
923128443 1:231053573-231053595 CTGTCAGGATGGAGAAGAGAGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923448837 1:234097657-234097679 CTGTGGGAATTAAGAGGAGGAGG + Intronic
923512866 1:234667729-234667751 CTGATGGAAAGAAGAGAAGAGGG - Intergenic
923721961 1:236474539-236474561 TTATTGGTTTGGAGAGGAGAGGG - Intronic
923738639 1:236635498-236635520 CTGTTGGAATGGAGAGGGTATGG + Intergenic
924074978 1:240324280-240324302 CTGTCGGATTGAATAGGAGAGGG + Intronic
924552232 1:245089540-245089562 CAGATGTAGTGGAGAGGAGAGGG + Intronic
924667337 1:246086875-246086897 CTGTCGGAAGGGCGAGGGGAGGG - Intronic
924793503 1:247274858-247274880 CTGTTGCAATGGAAAGGAGGGGG + Intergenic
924811022 1:247402160-247402182 CTGATGAGATGGAGAGGTGAAGG + Intergenic
924840231 1:247702141-247702163 CTGTTTGAAAGGAGAGAAGAAGG + Intergenic
1063414540 10:5862849-5862871 CAGTTGGAAGGGAGAAGGGAAGG + Intronic
1063780757 10:9320614-9320636 CTGTTGGAATGCAGTGAACAAGG - Intergenic
1064471075 10:15636642-15636664 GTGATGGAAGGGAGAGGAGGTGG - Intronic
1065285745 10:24186037-24186059 GTGTTGGGAAGGGGAGGAGAAGG - Intronic
1065492002 10:26291569-26291591 CAATTGTAATGGAGATGAGATGG - Intronic
1065855107 10:29823684-29823706 CTGATGGATGAGAGAGGAGATGG + Intergenic
1066379752 10:34891145-34891167 CTGCAGGAAGGGAGAGGACAAGG + Intergenic
1066435365 10:35392642-35392664 CTGGTTGAAAGCAGAGGAGAGGG + Intronic
1066512084 10:36111854-36111876 CTGTTGGCATGCTGAGGTGATGG + Intergenic
1067725459 10:48767615-48767637 ATGTTAAAATGGGGAGGAGAAGG + Intronic
1068117794 10:52752994-52753016 CTGTGGGCTTGGACAGGAGAAGG + Intergenic
1068269328 10:54699993-54700015 CTGCTGCAATGGAGAGGTTAAGG - Intronic
1068518563 10:58053777-58053799 CTGGTAGAATAAAGAGGAGAAGG + Intergenic
1069041422 10:63699476-63699498 GTGTGGAAGTGGAGAGGAGAGGG + Intergenic
1069323547 10:67203595-67203617 GAGTTGGAATGGAAAGGAGAGGG - Intronic
1069750770 10:70743851-70743873 CCATTGGAGGGGAGAGGAGATGG + Intronic
1070183158 10:74033927-74033949 CAGTGTGAATGGAGATGAGAGGG - Intronic
1070224139 10:74483001-74483023 CTATTGGAATGGTGAGAAGAGGG - Intronic
1070488254 10:76951446-76951468 CTATTGAAATGTAGGGGAGAAGG - Intronic
1070616951 10:77976651-77976673 CTGCTGCAATGGGGATGAGATGG - Exonic
1071499570 10:86193759-86193781 CTGGTGGAATGGAGACAAGCTGG - Intronic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071856104 10:89626047-89626069 CTGTAGGCATGAAGGGGAGAAGG - Intronic
1072233333 10:93431689-93431711 CTCTTGTAATGGAGAAGTGATGG - Intronic
1072474819 10:95750209-95750231 CTGTGGGAAAGGAGCGGGGATGG + Intronic
1072738598 10:97896132-97896154 CTGTTAGGAAGGATAGGAGATGG - Intronic
1072753575 10:98001870-98001892 CAGTAGGACTGGAGAAGAGAAGG + Intronic
1072910762 10:99498837-99498859 CGAAGGGAATGGAGAGGAGAAGG - Intergenic
1073042556 10:100617511-100617533 CTCTGGGAAGGGAGTGGAGATGG + Intergenic
1073693952 10:105844521-105844543 CTGTGAGAAGGGAGAGGAGGGGG - Intergenic
1073755120 10:106573034-106573056 CTGTGGGAATGGAAAGGTTAAGG + Intergenic
1074461419 10:113641320-113641342 CTGTTGGGATGGAGTGGGGCAGG - Intronic
1075306839 10:121375541-121375563 CTTTTGGTCTGGAGAGGAGATGG - Intergenic
1075659783 10:124185243-124185265 CTGCTGGGATGGGGAGGGGAGGG - Intergenic
1075961053 10:126567988-126568010 CTCTGGGAAAGGAGAGGAAATGG + Intronic
1076619129 10:131775793-131775815 AGGTGGGAGTGGAGAGGAGAAGG + Intergenic
1076642928 10:131931115-131931137 CTGATGGAGGGGAGAGGAGAGGG - Intronic
1077470658 11:2758848-2758870 CTGTAGGGATGGAGATCAGATGG + Intronic
1077483463 11:2827407-2827429 CTGCTGGAATGCAGATGTGATGG - Intronic
1077490514 11:2858849-2858871 CTGTTGTAGGGAAGAGGAGACGG + Intergenic
1077980161 11:7292026-7292048 TTCTTGGAATGGAGAAGTGAGGG + Intronic
1078493829 11:11796310-11796332 CAGGTGGAATGGAGAGGAGAGGG - Intergenic
1078818616 11:14852613-14852635 GTGCTAGAATGGAAAGGAGATGG + Intronic
1079393041 11:20038903-20038925 CTGATTGAAAGAAGAGGAGACGG + Intronic
1079478162 11:20853245-20853267 GTGTGGGAAAGGAGAGGAAAAGG + Intronic
1079660849 11:23035193-23035215 GTGCTGAAATGGACAGGAGACGG + Intergenic
1080271202 11:30452390-30452412 CTGTGGGAATGGAGAAGGTATGG - Intronic
1081729457 11:45359532-45359554 GTGTTGGGATGGAGAGGTGATGG + Intergenic
1082640161 11:55649956-55649978 CTGTTTGATTTGAAAGGAGAGGG - Intergenic
1082653875 11:55828223-55828245 GTGTTGGAGTAGAGAGAAGAAGG + Intergenic
1082952685 11:58834260-58834282 CTGTAAGAATACAGAGGAGAAGG + Exonic
1083159348 11:60845202-60845224 CTGCTGGAATGAGGGGGAGAAGG + Intronic
1083373588 11:62201841-62201863 CTTTGGGAATAGGGAGGAGATGG + Intergenic
1083471851 11:62889352-62889374 CTGTTGTAGTGCAGAGGATATGG + Intergenic
1085242671 11:75071599-75071621 CTGCTGGAATGGGCAGGAGGAGG + Intergenic
1085249273 11:75131487-75131509 CTGCTGGAATGGGCAGGAGGAGG + Intronic
1085567110 11:77524277-77524299 ATGTTGGGATGGGCAGGAGATGG - Intronic
1085721215 11:78913932-78913954 CTGTTAGCCTGGAGAGGAGAAGG + Intronic
1086942669 11:92814703-92814725 CTGTTGGAGTGTAGGGGACAAGG + Intronic
1087234659 11:95704789-95704811 TTATTCTAATGGAGAGGAGAGGG + Intergenic
1088406476 11:109485405-109485427 ATGTTGGGATAGAGAGTAGAAGG + Intergenic
1088993724 11:114977818-114977840 CTCTTAGAGAGGAGAGGAGAGGG + Intergenic
1089156262 11:116405279-116405301 CTCTTGGCATGGAGAAGGGATGG - Intergenic
1089771795 11:120808509-120808531 CTGTTGGTGAGGAGAGGCGATGG + Intronic
1090095308 11:123737100-123737122 GTGTTGGAATACAGATGAGAAGG + Intronic
1090311557 11:125745844-125745866 CTCTAGGAATGGAGAAGAGAGGG - Intergenic
1090414478 11:126531197-126531219 CAGTGGGAATAGAGAGGAAAGGG - Intronic
1090531239 11:127593064-127593086 TTGATGAAATGGAGAGGAGGAGG + Intergenic
1090536373 11:127646086-127646108 CCTTTGGGATGGGGAGGAGATGG + Intergenic
1090863785 11:130677009-130677031 CTTTTAGAAAGGAGAGGAAATGG + Intronic
1091082552 11:132685162-132685184 CTATTGGCATGGAGATGACAGGG - Intronic
1091293190 11:134453818-134453840 CTGTTGGCACTGGGAGGAGATGG + Intergenic
1091819113 12:3461309-3461331 TTGGAGGAATGGAGAAGAGATGG + Intronic
1091998387 12:5013674-5013696 CAGCTTGATTGGAGAGGAGAAGG + Intergenic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1092947675 12:13472024-13472046 CGGGTGGATTGGAGAGGACAAGG - Intergenic
1095203769 12:39415773-39415795 TTGTTGGAATAGAGAGTAGGTGG - Intronic
1095284348 12:40390214-40390236 CTGATGGAATGAGTAGGAGATGG + Intergenic
1095434599 12:42173674-42173696 ATCTTGGATTGGAAAGGAGAAGG - Intronic
1095498600 12:42811938-42811960 CTGTGGGAGTGGAGAAGGGAGGG + Intergenic
1095582031 12:43811291-43811313 CTGTTGGAATGAAGATGTGATGG + Intergenic
1096690078 12:53315186-53315208 CTGTTGGAATATTGAGGAGATGG - Intronic
1097234875 12:57532531-57532553 CTGAGGGAGTGGAAAGGAGATGG + Intronic
1097441302 12:59612044-59612066 CTGGTGGAACTGTGAGGAGAAGG - Intronic
1098863311 12:75733620-75733642 CTGTTGGAAAGTAGGGGAAACGG + Intergenic
1098936730 12:76488735-76488757 CTGATGGAATAGAGAAGAGCCGG - Intronic
1100449039 12:94687913-94687935 GTGTTGGAAGGGAGTGGGGAAGG - Intergenic
1100557602 12:95711603-95711625 CTGTTGAACTGGTGAGTAGAAGG + Intronic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1102049578 12:109852864-109852886 GTGTTGGAAGGGAAAGGAAAAGG + Intronic
1102287455 12:111670350-111670372 ATGTTGGATGGGAGAGAAGAAGG - Intronic
1102495560 12:113316714-113316736 CTGGTGGGATGGAGCGGGGAAGG - Intronic
1103852328 12:123941230-123941252 CTGTGGGAATGCAGAGGAACAGG - Intronic
1104090501 12:125512928-125512950 CTGATGTCCTGGAGAGGAGAGGG - Intronic
1104874394 12:132023754-132023776 CTGTTGAAACGTAGAGGAAAAGG - Intronic
1106317182 13:28604940-28604962 TTCTTGGAGGGGAGAGGAGAGGG + Intergenic
1106558836 13:30832112-30832134 CTGTTGGAACGAAGATGATATGG + Intergenic
1106605285 13:31223292-31223314 CTGGGGGAATGCAGAGGGGAAGG + Intronic
1107097191 13:36549673-36549695 CTGTTTGTAGGGAGAGGGGATGG - Intergenic
1107739614 13:43435363-43435385 CAGTTGGAATGGAGAAGTGGAGG - Intronic
1108416876 13:50206550-50206572 CTGTAGGAATGGTGTTGAGAGGG + Intronic
1108682852 13:52794253-52794275 ATATTGGAGTGGAGGGGAGATGG - Intergenic
1109580473 13:64325544-64325566 ATTTTGGAATGGAGTGGAGTGGG + Intergenic
1109808441 13:67475343-67475365 CTCTTGGCATGGAGCAGAGAAGG + Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112664043 13:101548123-101548145 CTGTTAGAATGTAGAAAAGAAGG + Intronic
1112932692 13:104761751-104761773 CTGCTGGAATGGTGTGGTGAAGG - Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1114230913 14:20781820-20781842 CTGTTGCATTGGAGAGGACTTGG - Exonic
1115478782 14:33841567-33841589 CTGCTGGAATGGAGAGGGGCAGG - Intergenic
1116351668 14:43871360-43871382 CCTTTGGAAAGGAGAGGAAATGG - Intergenic
1116873041 14:50085644-50085666 GTGATGGAGTGGAGAGGACACGG + Intronic
1117002979 14:51390537-51390559 TTGTTTGAATGGAGAGTAGAAGG - Intergenic
1117641622 14:57805615-57805637 CTGTTGGAGTGGGGAGTAGGGGG + Intronic
1117747655 14:58887302-58887324 CTGATGGAAGGAGGAGGAGAGGG - Intergenic
1117990584 14:61429118-61429140 CTGTTGGTCTGGAGAATAGAAGG + Intronic
1118245028 14:64101925-64101947 GTGATAGAATGGAGATGAGAAGG + Exonic
1118329052 14:64801625-64801647 CTGCTGAAGGGGAGAGGAGAAGG + Intronic
1118361792 14:65063123-65063145 CTCTTGGAGGGGAGAGAAGATGG + Intronic
1118929118 14:70223763-70223785 CTGTTTGCATGGGGAGGAGTCGG - Intergenic
1119481905 14:74963253-74963275 CTGTGAAAAGGGAGAGGAGATGG + Intergenic
1119647617 14:76359702-76359724 CTGTTGGAATGGGCAGGCCAGGG + Intronic
1119726108 14:76922689-76922711 CTGGGGGAAGGGAGATGAGAGGG - Intergenic
1119909229 14:78334702-78334724 CAGTCTGAATGAAGAGGAGAGGG + Intronic
1120915781 14:89708879-89708901 CTGTTAGAATTGAGAAGAGATGG + Intergenic
1121275711 14:92666282-92666304 CTGTTGGAACAGCGAGGAAAGGG + Intronic
1121360169 14:93249838-93249860 CTGTAGGGCTGGAGAGGGGATGG + Intronic
1121469232 14:94139010-94139032 AATGTGGAATGGAGAGGAGAGGG - Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1122826282 14:104372382-104372404 CTGTTGGCAAGGATAGGAGGGGG + Intergenic
1123989964 15:25675939-25675961 CCGTTGGAAAGGAAAGGGGAAGG + Intergenic
1124909765 15:33907630-33907652 TTGTCAGAATGGAGAGGTGAGGG - Intronic
1125715649 15:41818449-41818471 CTGTTGGGATGGAGAGGACTTGG + Intronic
1125771194 15:42167217-42167239 CTCTTGGAATTAAGAGGATAGGG - Intronic
1125968228 15:43891343-43891365 CTGTTAGATGGGAGTGGAGAAGG + Intronic
1126142297 15:45448435-45448457 CTGCTGGGATGTAGAGGAGGGGG + Intronic
1127053420 15:55108370-55108392 CTGTTGGAATGGTTAGGGGAAGG - Intergenic
1127376548 15:58390114-58390136 CTGTTGGACTGGAAGGGAGTTGG - Intronic
1127897055 15:63310472-63310494 AGGTTGGAAAGGAGAGAAGAAGG + Intergenic
1128214000 15:65921950-65921972 CTGTGGGAGTGCAGAGGAGCTGG - Intronic
1128547416 15:68577839-68577861 CTGGGGGAACAGAGAGGAGATGG - Intergenic
1128579539 15:68799256-68799278 CTGCTGGAAGGAAGGGGAGAGGG + Intronic
1128906992 15:71476192-71476214 CCATTGGAATAGATAGGAGATGG - Intronic
1129481879 15:75833059-75833081 GTTTTGGAATGGAGAGTGGAAGG - Intergenic
1130060834 15:80568858-80568880 CTGATGGAAGGCAGGGGAGATGG - Intronic
1130908980 15:88257997-88258019 CTGTGGGAAAGGAGAAGAAAGGG + Intergenic
1131056096 15:89376030-89376052 CTGGGGTAATGGAGAGGACAAGG - Intergenic
1131536259 15:93240286-93240308 CTTCTGGGCTGGAGAGGAGAGGG + Intergenic
1132422213 15:101680151-101680173 CTGTTGGAATGGGTAAGAGAAGG - Intronic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1132924422 16:2421123-2421145 CTGTTTGAATAGGGAGAAGAGGG + Intergenic
1133272897 16:4619330-4619352 CTAGTGGGAGGGAGAGGAGAAGG + Intronic
1134461712 16:14435209-14435231 TTGTAGGAAGGGAGAGGAGCAGG + Intergenic
1134774113 16:16837085-16837107 CTGGGGGAAAGGAGAGGGGAGGG + Intergenic
1134819757 16:17237393-17237415 GTGTGGGAAGGCAGAGGAGAGGG - Intronic
1135050167 16:19186023-19186045 CTCTTCAAATGGAAAGGAGATGG - Intronic
1135376825 16:21954239-21954261 CTATTGGCATGGAGAGGCCAGGG + Intronic
1135865705 16:26099916-26099938 CTGTTTGAGTAAAGAGGAGAAGG + Intronic
1135975205 16:27104227-27104249 GGGGTGGAAAGGAGAGGAGAAGG - Intergenic
1137281036 16:46976899-46976921 GGGTTGGGATGGAGAGGAGGTGG + Intergenic
1137637821 16:50002428-50002450 CAGTTGGAAGGGAGAGAACAGGG + Intergenic
1138086281 16:54136509-54136531 CTGGTGGACTGAAGGGGAGAGGG - Intergenic
1138311492 16:56027322-56027344 CTGGTGGCAGGAAGAGGAGACGG - Intergenic
1138391104 16:56670342-56670364 CAGCATGAATGGAGAGGAGATGG + Intronic
1138488845 16:57364352-57364374 CTTTTGGCAGGGAGAGGGGAGGG - Exonic
1139325568 16:66150259-66150281 TTGTTAGAATGGGGAAGAGAAGG - Intergenic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1140970951 16:80011851-80011873 GTGTTAGAATGGGAAGGAGATGG - Intergenic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1141492840 16:84386459-84386481 TTGTTGGCAAGGTGAGGAGATGG - Intronic
1141753765 16:85977639-85977661 CTGCTGGCATGGAAATGAGAAGG - Intergenic
1142344517 16:89545462-89545484 CTGTTGGGATGGAGAGTGAAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142700934 17:1660325-1660347 CAGGTGGAATCGAGGGGAGAGGG - Intronic
1142700941 17:1660366-1660388 CAGGTGGAATTGAGGGGAGAGGG - Intronic
1143286959 17:5797262-5797284 CTTTTGGAATGGGGAGGTGCAGG - Intronic
1143502408 17:7347074-7347096 CTGGTGGAATGGCCAGGGGAAGG + Exonic
1144472606 17:15558183-15558205 CTGTTGGGATCGAGAGCAGAAGG - Intronic
1144923875 17:18786508-18786530 CTGTTGGGATCGAGAGCAGAAGG + Intronic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1146390226 17:32415365-32415387 CAGTAGGAAAGGAAAGGAGAAGG + Intergenic
1147031966 17:37645759-37645781 ATGTGTGAATGGAGAAGAGAAGG + Intergenic
1147426135 17:40346739-40346761 GTGTTGGAGTGAAGAGCAGACGG + Intronic
1147505359 17:41011186-41011208 CTGTTGGAATGAAGACGGAAAGG + Intronic
1147685936 17:42286991-42287013 GAGTGGGAAAGGAGAGGAGAGGG + Intergenic
1147804850 17:43123799-43123821 GTGTTGAAAAGGAGAGGAGTGGG + Intronic
1148484807 17:47983737-47983759 TTCTTGGAAAGGAGAGGTGAGGG + Intergenic
1148796991 17:50201764-50201786 GAGTTGGAATGGAGAGGGGGAGG + Intergenic
1148899973 17:50867684-50867706 CTCCAAGAATGGAGAGGAGAGGG - Intronic
1149541585 17:57471863-57471885 CTGGAGGAGAGGAGAGGAGAGGG + Intronic
1150308290 17:64105456-64105478 CTGTTGGAGTGGAGGTGTGATGG - Intronic
1150494698 17:65598244-65598266 CTGTTGGTCAGGAGAGGATAGGG + Intronic
1151432944 17:74076916-74076938 TTGTTGGACTTTAGAGGAGAGGG - Intergenic
1151758171 17:76086519-76086541 ATGTTCGAATGTAGGGGAGAAGG - Intronic
1151902378 17:77025033-77025055 CTGTGGGAGTTCAGAGGAGAGGG - Intergenic
1152519514 17:80846986-80847008 CTCTTGGGAAGGACAGGAGATGG + Intronic
1152615399 17:81335667-81335689 GGGTAGGAAGGGAGAGGAGAAGG - Intergenic
1153175835 18:2371915-2371937 CTCTGGGAATTTAGAGGAGAGGG - Intergenic
1154145358 18:11862136-11862158 CTGTGGCAGTGGAGAAGAGAGGG + Intronic
1154222662 18:12470685-12470707 CAGTTGGAATAGACACGAGAGGG - Intronic
1154336667 18:13471431-13471453 CTTTCGTAATGGAGAGAAGAGGG + Intronic
1155697506 18:28700077-28700099 CTGTTGGAAGGGGGTGGTGAAGG + Intergenic
1156415752 18:36887794-36887816 CTCTTTGTATGGAGAGGAGGTGG + Intronic
1156429305 18:37054168-37054190 AGGTTGGAATGCAGAGGAAAGGG + Intronic
1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG + Intergenic
1157428133 18:47601585-47601607 ATGCTGGGAGGGAGAGGAGATGG - Intergenic
1157852301 18:51067041-51067063 CAGTTGGAATGTAAAGGTGAAGG + Exonic
1158045658 18:53152620-53152642 CTGTTGTCATGGAGAAGAGGAGG - Intronic
1158334203 18:56397660-56397682 TTTTTGCAATGGAGAGGAAAAGG - Intergenic
1158452199 18:57576858-57576880 CTGTCTGGAGGGAGAGGAGATGG - Intronic
1158558169 18:58492109-58492131 CTGTTTGAAGGCAGAGGGGAAGG - Intronic
1158828943 18:61257021-61257043 GTGTTTGCATTGAGAGGAGAGGG + Intergenic
1160237460 18:77097403-77097425 CTTTTGTTATGCAGAGGAGATGG - Intronic
1160433146 18:78826101-78826123 GGGGTGGAATGGAGAAGAGAAGG - Intergenic
1161614569 19:5262876-5262898 CTGTTAGTTTGGTGAGGAGAAGG + Intronic
1163261119 19:16190655-16190677 CTGTTGGCATGTTGACGAGAAGG + Intronic
1163318360 19:16556797-16556819 CTCTTGGAGTGCAGTGGAGATGG - Intronic
1163428379 19:17251705-17251727 CTGTTGCGAAGGAGAAGAGAGGG + Intronic
1163741826 19:19019021-19019043 CTGATGGTATTGAGAGCAGAGGG - Intronic
1164773720 19:30834150-30834172 AGGCTGGTATGGAGAGGAGATGG - Intergenic
1165376870 19:35449139-35449161 GTGTTGGACAGGAGAGGACAAGG + Intronic
1166794582 19:45418930-45418952 ATGTTGGCAAGGAGAGGGGAGGG - Intronic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1168059302 19:53882423-53882445 CAGGTGGAAGGGAGAGGAGCTGG - Exonic
1168148083 19:54430583-54430605 CTGTTGGAAGGGGTTGGAGACGG - Exonic
1168276883 19:55283893-55283915 CTGGAGGGATGGAGAGGAGGTGG - Intronic
925073124 2:987177-987199 CTGTAGGAACTTAGAGGAGATGG + Intronic
925428289 2:3769439-3769461 CTGATGGAATGGAGTGAAGACGG - Intronic
925814260 2:7732369-7732391 AAGTGGGAATGGAGAGGAGCAGG - Intergenic
928228540 2:29476193-29476215 CTGCAGGCATGGGGAGGAGAGGG - Intronic
928320415 2:30278837-30278859 TTGTTGGAAAGGAGAGGAAGGGG - Intronic
929859379 2:45663357-45663379 CTGTGGGAATTCAAAGGAGAGGG + Intronic
931271900 2:60710993-60711015 CTGCAGGAAAGGAGAAGAGAAGG - Intergenic
931287605 2:60845830-60845852 CTGTGCCAATGGAGTGGAGAGGG - Intergenic
931774432 2:65528250-65528272 CTGCAGGAATGGAAAGGAAAGGG + Intergenic
931973450 2:67616066-67616088 CTGTTGGAGTGAAGAAGAAAAGG - Intergenic
931994180 2:67824015-67824037 CTAGAGGAGTGGAGAGGAGAGGG - Intergenic
932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG + Intergenic
932022824 2:68105021-68105043 CTGCTGGGGTAGAGAGGAGAGGG - Intronic
932639152 2:73425130-73425152 TTGTTGGAAAGAAGAGGAAAAGG + Intronic
932683763 2:73850304-73850326 CTGTCGGGATGGAGTGGAGCAGG + Intronic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
933870865 2:86563937-86563959 CAGTTGGGATGGAAAGGGGAGGG - Intronic
934751751 2:96798295-96798317 CTTGTGGAATGGGAAGGAGAAGG + Intronic
935340864 2:102058666-102058688 CTGATGGAGTGGTGAGGACAAGG - Intergenic
935445284 2:103149795-103149817 TTGTTGAAATGGTGAGGTGAGGG - Intergenic
935550797 2:104451334-104451356 CCCTTGGGATGGGGAGGAGAGGG + Intergenic
935725495 2:106020446-106020468 TTGTTAGAATCGAGAGGAGGCGG + Intergenic
936662734 2:114560209-114560231 CTGTGGGAGTTGGGAGGAGAAGG + Intronic
936957388 2:118036462-118036484 CTGTTGGAGGGGTGAGGGGAGGG - Intergenic
937027452 2:118711272-118711294 CTGTTGGCAGGGAGAAGAGGAGG - Intergenic
937338391 2:121075904-121075926 CTGACGGAATGGAGAGGGCAAGG - Intergenic
937915343 2:127096163-127096185 CTGATAGAATGGGGAGGAGAGGG - Intronic
938134901 2:128748782-128748804 CTCTAGGAATGGAGAGGATGGGG + Intergenic
938913520 2:135909583-135909605 TTGTTGGAATGGGGAGAAGATGG - Intronic
941268960 2:163401277-163401299 GTGTTGGTATGGAGGGTAGAAGG - Intergenic
941452625 2:165677967-165677989 CTAATGGAATGGAGAGGGAAGGG + Intronic
941615533 2:167714265-167714287 CTGTTCCCATGGAGATGAGAGGG + Intergenic
942133712 2:172905172-172905194 CTGTTCGGGTGGGGAGGAGAGGG - Intronic
943352067 2:186806929-186806951 CTGCTTTCATGGAGAGGAGAAGG - Intergenic
943388415 2:187230935-187230957 GTGATGGAAAGGAGAGAAGATGG - Intergenic
944302992 2:198145910-198145932 CCATGAGAATGGAGAGGAGAGGG + Intronic
944320963 2:198341654-198341676 CTGGTGGAATGCAGAGGACGTGG + Intronic
945188060 2:207159807-207159829 CTGCTCGAATGGAGGGGGGATGG + Intronic
946127018 2:217571756-217571778 GTGTTGTCATGGAGAGGAGGAGG + Intronic
946228887 2:218279547-218279569 GTGTTGGACAGGAGGGGAGATGG - Intronic
946686292 2:222274112-222274134 TTGTTGCATTTGAGAGGAGAGGG - Intronic
948104266 2:235400475-235400497 CTAGTGGAATTGTGAGGAGAGGG + Intergenic
948851672 2:240711349-240711371 TGGTTGGTAGGGAGAGGAGAAGG + Intergenic
1169930168 20:10824036-10824058 TTGGAGGAATGGAGAGGATATGG + Intergenic
1170662062 20:18351666-18351688 TTGTTGTAATTGAGAGGATAAGG - Intergenic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1173150595 20:40563555-40563577 GTGCTGGAGGGGAGAGGAGATGG + Intergenic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1173773707 20:45685376-45685398 GTGATGGAGAGGAGAGGAGAAGG - Intronic
1174149300 20:48474902-48474924 CTGGAGAACTGGAGAGGAGATGG - Intergenic
1174299011 20:49568468-49568490 GTGATGGAAGGGAGGGGAGAGGG + Intergenic
1174935382 20:54862084-54862106 CTGTTGTCATAGAGAGGAGCTGG + Intergenic
1175277207 20:57780418-57780440 TTGCTGGAAAGAAGAGGAGAGGG - Intergenic
1175387062 20:58604233-58604255 CTACTGGATTGAAGAGGAGAGGG + Intergenic
1175478333 20:59292987-59293009 CTGATGGATTGGGGAGGAAATGG - Intergenic
1176425789 21:6547541-6547563 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1176922670 21:14707205-14707227 CTGTTGGATTAGTGAGCAGAAGG - Intergenic
1177739666 21:25138830-25138852 CTATTAGAATGGAGTGGGGAAGG - Intergenic
1178378856 21:32091901-32091923 CAGTTTGGAAGGAGAGGAGAGGG - Intergenic
1179701280 21:43155858-43155880 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1180645841 22:17338008-17338030 CCGATGGAATTCAGAGGAGAAGG - Intergenic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181961108 22:26622419-26622441 CAGATGGAAAGGACAGGAGAGGG + Intronic
1182280832 22:29216981-29217003 CTGGTGGGAGGGAGAGGGGAAGG + Intronic
1182300913 22:29336426-29336448 ATGCTGGAAAGGAGAGGGGAGGG - Intronic
1182599265 22:31447566-31447588 CTGCTGAAAAGGAGAGGGGAGGG + Intronic
1183104469 22:35606412-35606434 CTGTGGGAACCCAGAGGAGAGGG - Intergenic
1183237459 22:36630285-36630307 CTGTGGGCGTGGACAGGAGATGG + Intronic
1184178274 22:42802105-42802127 CTGTGGGAAGAGTGAGGAGAGGG + Intronic
949683850 3:6546213-6546235 CTTTTGGATGGGAGAGGAGATGG - Intergenic
949958866 3:9294754-9294776 CTGTTTCTTTGGAGAGGAGAAGG - Intronic
950349063 3:12328892-12328914 CTTTTGGAATGTATGGGAGAAGG - Intronic
950500681 3:13361677-13361699 CTGTTTGAAGGGAGAGTAGATGG - Intronic
950773999 3:15334104-15334126 CATTTAGAATGGAGAGGATAGGG - Intronic
951180645 3:19654742-19654764 CTGGTGGAGTGGTGAGAAGAGGG - Intergenic
951459721 3:22937715-22937737 CTGATGGAATGGAGTGGTGGTGG - Intergenic
951543474 3:23805552-23805574 CTTTTGGAAAGGAGAGGAGTAGG - Intergenic
951983349 3:28589857-28589879 CTGCTGAAATGGAGGAGAGAAGG - Intergenic
952307955 3:32162024-32162046 CTATAGCAATGGAGAAGAGAAGG - Intronic
953327567 3:42025535-42025557 CTGTTCAAAGGGAGAGGGGAAGG + Intronic
953330381 3:42048059-42048081 CTCTTGGAGTGGAGGAGAGAGGG - Intronic
953403149 3:42644538-42644560 CAGTTGCAATGGACAGGGGAAGG - Intronic
953527521 3:43705737-43705759 CTCTTTAAATGGAGAGGACAGGG + Intronic
953885548 3:46712692-46712714 CTGTTGGAGGTGAGAGGAGTGGG - Intronic
953931011 3:47005653-47005675 GTGTAGGGATGGAGAGCAGATGG + Intronic
954069324 3:48131319-48131341 CTGGTGTAATGGAAAGGTGAAGG - Intergenic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
958058890 3:88451664-88451686 CAGTTGGAAGGAAGAAGAGAAGG - Intergenic
959010994 3:101076189-101076211 CTGTTGGAAAGTAGAAAAGAAGG - Intergenic
959946704 3:112133054-112133076 CTGTGGGAGAGCAGAGGAGATGG - Intronic
960835027 3:121897064-121897086 TTGCTGGGAAGGAGAGGAGAGGG + Intronic
960844983 3:121996842-121996864 CTGTAAGAGTGGAGAGGGGATGG - Intronic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
961533121 3:127552082-127552104 ATGGTGGATGGGAGAGGAGAGGG - Intergenic
962464301 3:135642338-135642360 AGGTTGGATGGGAGAGGAGATGG + Intergenic
962631220 3:137278032-137278054 ATGTTTGAAGGGAGAGGAAAAGG + Intergenic
962847274 3:139283584-139283606 CTGGTGGAGTGGACAGGAGCTGG + Intronic
963115303 3:141723896-141723918 TTCTTTGAATGGTGAGGAGATGG - Intergenic
963121541 3:141780849-141780871 GAGTTGGAAAGGAGGGGAGAGGG + Intronic
963275322 3:143324281-143324303 CTGTGGGAATGGAGAGGGAGAGG - Intronic
963941505 3:151100151-151100173 TTCTTAGAAAGGAGAGGAGACGG + Intronic
963942228 3:151106342-151106364 CTGTAGGAAAGGAAAGGAAAGGG - Intronic
964254512 3:154761215-154761237 GTGGTGGAATAGAGAGGAAATGG - Intergenic
965249717 3:166327597-166327619 CTATTGGAATTGTGAGAAGATGG - Intergenic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966876285 3:184323711-184323733 CTGTTGGGAGGGACAGGAGAGGG - Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967815818 3:193797356-193797378 CAGCAAGAATGGAGAGGAGATGG + Intergenic
967943905 3:194787141-194787163 CTGTGGGAATGGAGAGGGAGGGG + Intergenic
969010085 4:4054860-4054882 CTGGGGGAAAGGGGAGGAGATGG - Intergenic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969242133 4:5906209-5906231 ATGTTGGCATGGAGAGAAGTGGG + Intronic
969333412 4:6492976-6492998 GTGTTGGAATGGAGTGAGGAGGG - Intronic
972140282 4:35950776-35950798 ATGTTGGAAGGCAAAGGAGAAGG + Intronic
973628819 4:52799186-52799208 CTGTGCTACTGGAGAGGAGAAGG + Intergenic
976784515 4:88802813-88802835 CTACTGGAGTGGAGAAGAGATGG - Intronic
977182626 4:93896006-93896028 CTGATGGATTGGATAGGATATGG + Intergenic
977601617 4:98939404-98939426 CAGTGAGAATGAAGAGGAGAGGG - Intergenic
977925343 4:102694295-102694317 CTATTTGAAAGAAGAGGAGAGGG - Intronic
978613948 4:110574820-110574842 ATGTTGGCATTGAGAGGAAAAGG + Intergenic
978789345 4:112644297-112644319 GTGTTGCGATGGAGAGGAGGGGG + Intronic
981045485 4:140261319-140261341 CTGTTGGAGTGGTGGGGTGATGG - Intronic
981820899 4:148886482-148886504 CTGTAGGAATTGAGAGGCAAAGG + Intergenic
982829755 4:160044599-160044621 CTGTTGTACTGGAGTGGAGTAGG + Intergenic
983009983 4:162536137-162536159 GTGTTGGAAGAGAAAGGAGAGGG + Intergenic
983273916 4:165594610-165594632 GTATTGGAATGGAGTGGACAAGG + Intergenic
983372049 4:166872881-166872903 CTGGTGGAATGCAGAAGGGAAGG + Intronic
984141567 4:176010541-176010563 CTGCTGTAGTGAAGAGGAGAGGG + Intergenic
984272536 4:177565115-177565137 AGGCTGGTATGGAGAGGAGAGGG - Intergenic
984391458 4:179139220-179139242 ATGTTGGAATAGAGGGGTGATGG - Intergenic
984704004 4:182834634-182834656 CTGGGGGACAGGAGAGGAGAAGG - Intergenic
984846387 4:184111524-184111546 ATTTTGGATTGTAGAGGAGAGGG + Intronic
985379921 4:189382817-189382839 TTGTGTGAAAGGAGAGGAGAGGG - Intergenic
985991966 5:3569728-3569750 CTGATGGAACAGAGATGAGACGG - Intergenic
986774153 5:10998325-10998347 CACTTTGAATGGAGGGGAGAAGG + Intronic
987069315 5:14321178-14321200 CTGTTTGAAGGATGAGGAGAAGG + Intronic
987085228 5:14461631-14461653 ATGGTGGAGTGGGGAGGAGAGGG - Intronic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
988346710 5:30046280-30046302 ATTTTTTAATGGAGAGGAGAGGG + Intergenic
988621658 5:32829635-32829657 CATTTAGACTGGAGAGGAGAAGG + Intergenic
989240670 5:39200147-39200169 GGGTTGCAAAGGAGAGGAGAAGG + Intronic
990033719 5:51293452-51293474 TTTTAGGAATGGAGAGAAGAAGG - Intergenic
990237056 5:53779694-53779716 CTGTTGGAAGGGAGAGGAAGTGG + Intergenic
990736796 5:58873106-58873128 CTGTGGGAATGGGGAGGAATAGG + Intergenic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
991770000 5:70031445-70031467 CAGTTTGACTGGAGATGAGAAGG + Intronic
991849295 5:70906864-70906886 CAGTTTGACTGGAGATGAGAAGG + Intronic
991955557 5:71991794-71991816 CTGTCAGAATGGAGAGGAGAAGG + Intergenic
992035910 5:72775876-72775898 CTGTGGGACAGGAGAGGAGTAGG - Intergenic
992192404 5:74306576-74306598 ATGTTGGAAATAAGAGGAGAGGG - Intergenic
992230628 5:74659973-74659995 CTGATGGAATGGAGAGGATTAGG + Intronic
992880680 5:81106286-81106308 CTGTGAGAATGAAGAGGAAAGGG - Intronic
998149553 5:139748966-139748988 CTGTTGGGATGGAGTGCAGGTGG + Intergenic
998198832 5:140101249-140101271 GTGGGGGAAAGGAGAGGAGAAGG + Intergenic
998217046 5:140245327-140245349 CTTTTGGAATGTATGGGAGAAGG + Exonic
998798401 5:145843120-145843142 GGGTTGGAATGGGTAGGAGAAGG + Intergenic
998851709 5:146357235-146357257 ATATTGGAATGGTGAGGAGATGG - Intergenic
998876745 5:146607845-146607867 CAGTTGTAATGGAGACCAGATGG - Intronic
999236858 5:150103790-150103812 GTGAAGGAATGGAGTGGAGATGG + Intronic
999299443 5:150482074-150482096 CTGTGGGAATGTGGAGGGGAAGG - Intergenic
999361506 5:150990040-150990062 GTGTTGGAAGGGGGAGAAGAGGG + Intergenic
999445884 5:151639077-151639099 CAGTTGGAATGAGGAGGAGAAGG - Intergenic
1000849098 5:166318007-166318029 GAGTTGGAAAGGAGGGGAGAGGG - Intergenic
1001247612 5:170116681-170116703 ATGTTGCAATGGGAAGGAGAAGG + Intergenic
1001638693 5:173230603-173230625 CTGTGGGAAGGAAGAGGAAAGGG - Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002402097 5:178996562-178996584 CTGTTAAAATGGATAGGAGCAGG - Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002968789 6:1993127-1993149 CTGGGGCAAGGGAGAGGAGATGG - Intronic
1003425813 6:5997477-5997499 CAGCTGAAATGGCGAGGAGACGG - Intergenic
1004463840 6:15864970-15864992 CTCATGGGATGGAGAGGGGATGG + Intergenic
1004465253 6:15879150-15879172 CTGTTTGAATGGATTGGTGAAGG + Intergenic
1004586073 6:17001744-17001766 ATGTTGCAATGGAGTAGAGAAGG - Intergenic
1005183171 6:23130580-23130602 CTTTGGGAATGCAGAAGAGAAGG + Intergenic
1006308416 6:33239519-33239541 CTGGAGGAATGCAGAGGAAACGG + Intergenic
1006433009 6:34009740-34009762 CTGCTGGAATGCAGATGTGATGG - Intergenic
1006681300 6:35798439-35798461 CTCCTGGGATGGAGAGGGGAAGG - Intergenic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1008202859 6:48614068-48614090 CTGAGGGAATGGAGAGGTTATGG - Intergenic
1011104867 6:83768423-83768445 CCATCGGAATGGAGAAGAGATGG - Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1012429035 6:99144862-99144884 ATGTTGGCATGGTGGGGAGATGG + Intergenic
1013006910 6:106082264-106082286 CTGTGGGAAAGAACAGGAGAAGG - Intergenic
1013250878 6:108332014-108332036 CTCTTGGAAGGGTGAGGAGGAGG - Intronic
1013661211 6:112298960-112298982 CGGCTGGGAGGGAGAGGAGAAGG - Intergenic
1013797162 6:113900727-113900749 CTGGTGGAAAGGAGAGGCCAGGG - Intergenic
1014882219 6:126737238-126737260 CTTGTGGAATGGAGAGAACAGGG - Intergenic
1015713662 6:136168220-136168242 TTGTTGGAAAGGAGAGGTAAAGG + Intronic
1016426606 6:143942114-143942136 CAGTTGGAATGAAGGCGAGATGG + Exonic
1016555067 6:145327268-145327290 CCCTTGGAATTGAGAGTAGACGG + Intergenic
1017156067 6:151323768-151323790 CTGATAGAAAGGAGAGGAGCTGG + Intronic
1017523359 6:155221482-155221504 CTGTTTCAATGGAGAGAAAAAGG - Intronic
1018372135 6:163178066-163178088 AAGTTGGAACGGAGAGCAGACGG + Intronic
1018911017 6:168101061-168101083 GTGTTGGACTGGAGGGGAGGTGG + Intergenic
1018998257 6:168726422-168726444 CTGGTGGATGGGAGAGGAGGAGG + Intergenic
1018998810 6:168729955-168729977 CTGTTTGGATGCAGAGGGGAAGG - Intergenic
1019773971 7:2901451-2901473 CAGATGGAGAGGAGAGGAGAGGG + Intergenic
1020036989 7:4970005-4970027 CTGTTGTAATGGACAGGTAATGG - Intergenic
1020163293 7:5788672-5788694 CTGTTGTAATGGACAGGTAATGG + Intergenic
1020359821 7:7316068-7316090 CCCTTGGAATGGGGAGGGGAGGG + Intergenic
1020830704 7:13091263-13091285 CTGTTGGAATGGGAAGTGGAAGG + Intergenic
1020991014 7:15196046-15196068 CTGTCAAAAAGGAGAGGAGAGGG - Intergenic
1021418583 7:20419144-20419166 CATTTGTAATGGAGAGGAGAAGG + Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021933020 7:25600636-25600658 GTGTTGGAAGAGATAGGAGACGG - Intergenic
1022167285 7:27781121-27781143 TGGTTGGAGTGGAGAGGAGGGGG - Intronic
1022255224 7:28649455-28649477 CAGTTGCAATGGAGAACAGATGG + Intronic
1023060174 7:36319167-36319189 CTGCTGGAAGGGAGAAGAGCGGG + Intergenic
1023062626 7:36343324-36343346 CTGTAGGAGAGGAGAGGAGAGGG + Intronic
1023154848 7:37239049-37239071 CTTTTGGAAAATAGAGGAGAGGG - Intronic
1023570331 7:41565310-41565332 CTGTGGGAAACGACAGGAGAGGG - Intergenic
1025146952 7:56513550-56513572 CCATTGGAATGGAGGAGAGATGG - Intergenic
1025807014 7:64843906-64843928 CTCTTGGACTGGGGAGGTGAAGG - Intergenic
1027184587 7:75963314-75963336 CTGTGGGAACGGCGAGGACATGG + Intronic
1027767880 7:82367817-82367839 CTAGTAGAATGGAGAGGATATGG + Intronic
1028527027 7:91797881-91797903 CAGCTGGAATGCAGAGGACATGG + Intronic
1029451499 7:100643758-100643780 GTGTTGGAATGGTGAGGTGGAGG - Intronic
1029968328 7:104763818-104763840 TTGTTGGAAGGGAGAAGAGCAGG - Intronic
1030078049 7:105753619-105753641 CTGCTGTAATGGAGAGGAGAGGG - Intronic
1030088133 7:105834849-105834871 GTGATGGAGTGGAGGGGAGAGGG + Intronic
1030151218 7:106407214-106407236 CTCTTGGAACTGAGATGAGAGGG - Intergenic
1030983900 7:116218025-116218047 CTGTTAGAATGGTGGGGAGTCGG + Intronic
1031484449 7:122310754-122310776 CTGCGGGAATGCAGAGGAGAAGG - Intergenic
1031529209 7:122855873-122855895 CTGGAGGAAAAGAGAGGAGAAGG - Intronic
1032166953 7:129552999-129553021 GTGTGGGGATGGAGAGGAGGTGG - Intergenic
1032212579 7:129929399-129929421 CTTTTTGTGTGGAGAGGAGAAGG - Intronic
1032245790 7:130210899-130210921 CTTTTGTAATAGACAGGAGAAGG - Intronic
1032443057 7:131957060-131957082 CTGCTGGAATGCAGATGTGATGG - Intergenic
1032655975 7:133929858-133929880 CTCTTGGAATAGAGAAGAGAAGG - Intronic
1033459029 7:141528734-141528756 CTGTTGGAGAGGAGGGGAGATGG - Intergenic
1033735452 7:144217415-144217437 CTGTGGCAGTGGAGAGGATATGG + Intergenic
1033747602 7:144333554-144333576 CTGTGGCAGTGGAGAGGATATGG - Intergenic
1034205299 7:149309374-149309396 CTCTTGGAATACAGAGGAGAGGG - Intergenic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035023207 7:155810600-155810622 CTGTCGGAAGGGAGAGGAATGGG - Intronic
1035218605 7:157390693-157390715 CTGTGGGAAGGCAGAGGAAAAGG - Intronic
1035309635 7:157957255-157957277 CTGTTGCTGTGGAGAGGGGATGG - Intronic
1035318413 7:158012739-158012761 CTCTTGGAATGCAGATGTGATGG - Intronic
1035692710 8:1570738-1570760 CTTCTGGGATGGAGAGGAGAGGG + Intronic
1035692926 8:1571768-1571790 CTTCTGGGATGGAGAGGAGACGG + Intronic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1035693093 8:1572586-1572608 CTGCTGGTATGGAGAGGAGAGGG + Intronic
1035889583 8:3329049-3329071 CTGTTGGCATGGAATGGAGGTGG + Intronic
1037700692 8:21271645-21271667 CTGTGGGAAAGGGGAGGAGGAGG - Intergenic
1038367174 8:26948263-26948285 GTGGTGGTATGGAGAGGAGCTGG + Intergenic
1039644590 8:39267015-39267037 CTGTTGCACTGGAGAGGCCAAGG + Intronic
1039724565 8:40202050-40202072 CAGTTTGAATGGTGAGGACAGGG + Intergenic
1041090026 8:54293349-54293371 CCGCTGGAATGGTGAGGAAAAGG - Intergenic
1041476002 8:58266684-58266706 CTTTTGGAATGGAGAGGCCCGGG + Intergenic
1041481007 8:58319829-58319851 GTGTTGGAATGGAGATAAGGAGG + Intergenic
1043106807 8:76124184-76124206 TTCTTGGAATGGAAAGGAAATGG + Intergenic
1043199717 8:77351376-77351398 TAGTTGGAATGGAGATAAGATGG - Intergenic
1044429878 8:92095942-92095964 CTGTTTGGATGGAGGTGAGATGG - Intronic
1044666827 8:94640806-94640828 CTGGATGAATGGAGAGGCGAGGG - Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1046023092 8:108689868-108689890 CTGGAGAAATGGAGAGGAGGGGG - Intronic
1046859887 8:119078471-119078493 CTGTTGGAATAGAGAGAATGGGG + Intronic
1046926581 8:119796290-119796312 TTGCTGGAGTGGAGAGGAGAGGG - Intronic
1047416264 8:124667076-124667098 CAGGTGGAGGGGAGAGGAGATGG + Intronic
1048319077 8:133384652-133384674 CTAGTGGAATGGCCAGGAGAGGG - Intergenic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1049616903 8:143579510-143579532 CTTTTGCAATGGAAAGAAGAGGG + Intergenic
1049700954 8:144012314-144012336 CTGGTGGCATGGAGAGCTGAGGG + Intronic
1049856222 8:144863612-144863634 GTGTTGGAAGGGGGAGGAAAGGG + Intergenic
1051539894 9:18203880-18203902 GTGTTGAAATGGAGTTGAGAAGG + Intergenic
1051760744 9:20461023-20461045 ATGTGTGGATGGAGAGGAGAAGG - Intronic
1051812828 9:21069617-21069639 CAGTTGGGATGGGCAGGAGAGGG - Intergenic
1052072021 9:24093212-24093234 TTGTTGGAATGGATGGGAGCCGG + Intergenic
1053122759 9:35558840-35558862 GTGCTGGAATGGAGAGGATCAGG - Intronic
1053311837 9:37025413-37025435 CTGTTGGGATGGGGGGGAGCGGG + Intronic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1054871465 9:70050767-70050789 TGGTTGGAATGAAGAGTAGATGG - Intronic
1056104561 9:83334061-83334083 CTGTTTGAATTGATAGGAGATGG - Intronic
1056838591 9:89979077-89979099 CTGATGGAATCGAGAGGCTAGGG - Intergenic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1057134299 9:92676264-92676286 GTGTTTGAATGGAAAAGAGAAGG + Intergenic
1057397527 9:94693028-94693050 CTGCTGGAATGCAGAGGGGAGGG + Intergenic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1058909857 9:109511164-109511186 CTGGTGTAAAGGAGATGAGAAGG - Intergenic
1060491097 9:124084882-124084904 TTGGTGGAATGCAGAAGAGAAGG + Intergenic
1060797188 9:126520673-126520695 CAGCTGGCATGGAAAGGAGATGG + Intergenic
1060931231 9:127490796-127490818 CTGTTGCAGGGGAGAGCAGAGGG - Intronic
1061750459 9:132773382-132773404 CAGCTGGAAGGGAGAGGACAGGG - Intronic
1061921533 9:133785159-133785181 CTGGTGAAATGGAGAGGGGAAGG - Intronic
1062571360 9:137187031-137187053 TTGTTAGTTTGGAGAGGAGAGGG - Intronic
1203350708 Un_KI270442v1:79115-79137 GTATTGGAATGGAAAGGAAAGGG + Intergenic
1185728006 X:2438235-2438257 GTATTGGACTGCAGAGGAGAGGG + Intronic
1187291755 X:17961411-17961433 CTGGTGGAATGTGGAGGTGATGG + Intergenic
1187493244 X:19772559-19772581 ATGTTGGAACGGAGAGGAAATGG - Intronic
1187754560 X:22508195-22508217 CTGTTGGAAGTGACAGGAGAGGG - Intergenic
1188002442 X:24995103-24995125 CTCTGGGAAGGGAAAGGAGAGGG + Intronic
1188403164 X:29772779-29772801 CTGTTGGAAATGAAAGTAGAAGG - Intronic
1191641126 X:63430587-63430609 GTGTTGGAAAGGGGAGGAGAGGG + Intergenic
1191760925 X:64647336-64647358 CTGTTGGAGCAGTGAGGAGAGGG + Intergenic
1192163193 X:68803982-68804004 CAGTGAGAATGGAGAGGAGGGGG + Intergenic
1192424602 X:71064239-71064261 CTGGTAGAATGGAGAGGATTTGG - Intronic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1193214664 X:78849529-78849551 GAGTTGGAATGGAGAGAAAATGG + Intergenic
1194677244 X:96809166-96809188 AAGTTGCAATGGAGAGAAGACGG - Intronic
1197129506 X:122988815-122988837 CTGTAGCAATGGAGAAAAGATGG - Intergenic
1197412804 X:126139444-126139466 TTCTTGGAGTGGAGAAGAGAGGG + Intergenic
1197929213 X:131678223-131678245 GTCTTGGCATGGAGAGGACAGGG + Intergenic
1197946113 X:131841225-131841247 GTCTTGGCATGGAGAGGACAGGG - Intergenic
1198146699 X:133864504-133864526 CAGGTGGAAAGGAGAGGTGATGG - Intronic
1198194482 X:134346135-134346157 CTGTTGGAAGGTAGGGGAGTAGG - Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199074625 X:143513717-143513739 GTGTTGGAAGGAGGAGGAGAGGG - Intronic
1199093625 X:143716980-143717002 GTGTTGGAAGGGGGAGGAGAGGG - Intronic
1199214709 X:145251180-145251202 GTGTTGGAAGGGGGAGGAGAGGG + Intronic
1199265484 X:145821842-145821864 CTGGTGGACTGCAGAGGAGAGGG + Exonic
1199610224 X:149606513-149606535 CTGTGGGAGTTGAGAAGAGAGGG - Intronic
1199946180 X:152670061-152670083 CTGCTGGAATGAAGAAGAGAAGG + Intergenic
1202163271 Y:21957664-21957686 CTGAAGGAATAGAGATGAGAAGG + Intergenic
1202228085 Y:22628704-22628726 CTGAAGGAATAGAGATGAGAAGG - Intergenic
1202315072 Y:23567472-23567494 CTGAAGGAATAGAGATGAGAAGG + Intergenic
1202555729 Y:26103121-26103143 CTGAAGGAATAGAGATGAGAAGG - Intergenic