ID: 969196178

View in Genome Browser
Species Human (GRCh38)
Location 4:5565761-5565783
Sequence AATGGTGAACACTCTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969196178 Original CRISPR AATGGTGAACACTCTGGGGA TGG (reversed) Intronic
902715948 1:18272814-18272836 AATGGGGAAAATTCTGGGGGAGG - Intronic
903033740 1:20481266-20481288 AATGGTGAGCAAGCTGGGGCTGG - Intergenic
908125040 1:61022314-61022336 ATTTGTGAACAGTCTGGGAAGGG - Intronic
908280647 1:62531124-62531146 AATGATGAGGAATCTGGGGAAGG - Intronic
909729959 1:78878144-78878166 AATGGTGAACCCAGTGGGGAGGG - Intergenic
910937804 1:92500121-92500143 AGTGGTAACCACTCTTGGGATGG - Intergenic
911255079 1:95623948-95623970 AAAGGTGAATGCTCTGGTGAGGG + Intergenic
912265134 1:108149801-108149823 AATGGGCATCACTGTGGGGATGG - Intronic
912525572 1:110280376-110280398 AAGGTTGAAGACTCTGGGGGAGG + Intronic
912821231 1:112869458-112869480 TATTGTTAACACTATGGGGAAGG - Intergenic
913095288 1:115510722-115510744 AATGGTGAACCCAGTGGGGAGGG + Intergenic
913692485 1:121292610-121292632 AAAGGATAACACTCTCGGGATGG - Intronic
914145071 1:144987484-144987506 AAAGGATAACACTCTCGGGATGG + Intronic
915489008 1:156241318-156241340 AGTGTTAAACACCCTGGGGAGGG - Intronic
916398344 1:164416795-164416817 AATGGAGAAAACTCTGAAGAAGG - Intergenic
917554475 1:176069622-176069644 GAGGGAGAACCCTCTGGGGATGG - Intronic
918118440 1:181516906-181516928 CATGGTGTAGACTCTGGGGAGGG + Intronic
918524113 1:185446527-185446549 AAAAGTGATTACTCTGGGGAAGG + Intergenic
920310399 1:205044888-205044910 ACTGGTGGGCACCCTGGGGAGGG - Intronic
920345808 1:205305029-205305051 AATGTTGAGACCTCTGGGGAAGG - Intronic
920479804 1:206310967-206310989 AAAGGATAACACTCTCGGGATGG - Intronic
920779605 1:208975751-208975773 AATGGTGACCTCCCTGGGGCTGG - Intergenic
920838039 1:209530033-209530055 ACAGGGGAACTCTCTGGGGAAGG + Intergenic
920908535 1:210192964-210192986 AATGGTGAACCCAATGGGGAGGG - Intergenic
921788172 1:219257954-219257976 AATAATTAACACCCTGGGGAAGG - Intergenic
921804965 1:219443886-219443908 AATGGTGACCTGTCTGGGGCTGG - Intergenic
922368981 1:224890898-224890920 AATGGTGAACCCAATGGGGAGGG - Intergenic
923805375 1:237251836-237251858 AATGGGGAATACTGTGGGAAAGG - Intronic
924374557 1:243391632-243391654 ACTGGTGCCCACCCTGGGGAAGG - Intronic
1066292411 10:34026475-34026497 AATGATGAATACTTTAGGGATGG + Intergenic
1068726148 10:60305587-60305609 AGTGGGGAAGACTGTGGGGAGGG - Intronic
1069318099 10:67133094-67133116 AATGATAAACACTCAGGTGATGG + Intronic
1070743549 10:78918641-78918663 AATCGTGAGCAATCTGGGGTGGG + Intergenic
1071788933 10:88933832-88933854 GATGGTGAACAGCCTGGGCAAGG + Intronic
1072607955 10:96999572-96999594 CTTGGTGAGCCCTCTGGGGAAGG + Exonic
1072617864 10:97061467-97061489 AATGGTGGTTACTTTGGGGAAGG - Intronic
1072636747 10:97183202-97183224 AATGGTGAGCTCTCAGGAGAGGG - Intronic
1072689710 10:97564007-97564029 AACGGTGAACCCAATGGGGAGGG + Intronic
1072904205 10:99436220-99436242 AATGTTGAGCACTCTTGAGAAGG + Intergenic
1073559717 10:104486491-104486513 AAGGGTGAATACTCTGGGGCAGG + Intergenic
1074760225 10:116661968-116661990 AATCCTGAACCCTGTGGGGAAGG + Intergenic
1076008682 10:126969096-126969118 CATGGTGAACACTCAGGTAACGG - Intronic
1078478078 11:11651211-11651233 CATGATGAACACTCTGGACATGG + Intergenic
1078665191 11:13318761-13318783 AATGGTGGTCACTCTAGGGGAGG + Intronic
1078804564 11:14684729-14684751 AATAATGAAGACTCTGGGAAAGG - Intronic
1084266499 11:68008038-68008060 AATGGGGAGCCCTCTGGGTAGGG - Intergenic
1084974259 11:72787945-72787967 ACTGGTGGGGACTCTGGGGAGGG + Intronic
1086181607 11:83958070-83958092 AATGGTGAACAAACTGGTCAAGG - Intronic
1087784341 11:102338246-102338268 AATAGGGAATACTCAGGGGAAGG + Intronic
1091228529 11:133972792-133972814 ACCGGTGAACATTCTGGGGAGGG - Intergenic
1091663009 12:2398582-2398604 AATGATGACAACTCTGTGGAAGG - Intronic
1093024582 12:14234295-14234317 AATGGTGAACCCAATGGGGAGGG - Intergenic
1093769644 12:23003665-23003687 AAAGGTGGACAGCCTGGGGAGGG - Intergenic
1094232159 12:28118796-28118818 CATTGGGAACCCTCTGGGGAGGG - Intergenic
1097347114 12:58505773-58505795 AAAGGTGAACAGTCAGGGGAGGG + Intergenic
1097962502 12:65546206-65546228 AATGGTGGCCACTGCGGGGAAGG - Intergenic
1099168652 12:79338057-79338079 AATGGAGAACAGTTTGGGGATGG - Intronic
1099231965 12:80037171-80037193 GATGGTGGAGACTCTGGGGTGGG + Intergenic
1101844429 12:108351190-108351212 TATGGTGAACAATTTGAGGAGGG - Intergenic
1108695085 13:52896038-52896060 GATGGTGAACACTCTGATGCAGG - Intergenic
1110493683 13:76139585-76139607 AATAGTGAACAGTTTGGGGAAGG - Intergenic
1111993132 13:95136735-95136757 GGTGGTGGACACGCTGGGGAAGG + Intronic
1112226036 13:97541462-97541484 GATGGTGACCACTTAGGGGATGG - Intergenic
1117174664 14:53133937-53133959 AATGGTGAACCCAATGGGGAGGG - Intronic
1117936689 14:60914608-60914630 AATAGAGTCCACTCTGGGGATGG + Intronic
1120575672 14:86177298-86177320 AATGGTAAATAATCTGGCGATGG + Intergenic
1120881945 14:89420341-89420363 CATGGTGAAACATCTGGGGAAGG + Intronic
1121451867 14:94013250-94013272 AATGGTGAGGAATCTGGGAAAGG + Intergenic
1121708097 14:96015887-96015909 CATGGGGTACACTCTGGGGGTGG + Intergenic
1126807141 15:52362243-52362265 AATGGAGGAAACTCTAGGGAGGG - Intronic
1127081580 15:55385641-55385663 AAAGATGAACATTCTGGGGCGGG + Exonic
1129122763 15:73411821-73411843 AATGGTGAACAGGCTTAGGAAGG + Intergenic
1130246372 15:82253466-82253488 GATGAGCAACACTCTGGGGAGGG - Intronic
1130353512 15:83110625-83110647 AATGGTGAACAGCCTGAGGCAGG - Intronic
1130454263 15:84089490-84089512 GATGAGCAACACTCTGGGGAGGG + Intergenic
1131378393 15:91944196-91944218 AATGGTGAACACTTACGTGAGGG - Intronic
1137745760 16:50818931-50818953 AATGGTGTACCCTCAGGGGCAGG - Intergenic
1138817523 16:60220433-60220455 ATTGGAGAAGACACTGGGGAGGG - Intergenic
1141291627 16:82723115-82723137 CCTGGGGAACAGTCTGGGGAAGG + Intronic
1142261789 16:89046088-89046110 GATGGTGATGACTGTGGGGATGG - Intergenic
1144682639 17:17205777-17205799 AAAGGTGGACACTTAGGGGAGGG - Intronic
1146306138 17:31731134-31731156 AAGCGTGTGCACTCTGGGGATGG + Intergenic
1147540338 17:41351999-41352021 AGTGGTTTACACACTGGGGAGGG + Intergenic
1149532068 17:57403388-57403410 AATGGTGGCCACTGTGGGCATGG - Intronic
1149570342 17:57667750-57667772 CATGGTGTAAATTCTGGGGATGG - Intronic
1150336756 17:64335930-64335952 AATGATGAAGAATCTGGGGATGG + Intronic
1152454460 17:80405436-80405458 AACGGTGAACCCAGTGGGGAGGG - Intergenic
1152946026 17:83197661-83197683 GAAGGTGAACACTCAGGGGCTGG + Intergenic
1203192941 17_KI270729v1_random:206267-206289 ACTGCTGAACATTCTGGGGTTGG + Intergenic
1203202305 17_KI270730v1_random:5702-5724 ACTGCTGAACATTCTGGGGTTGG + Intergenic
1154315120 18:13298146-13298168 AATGGTGCACAAGCTGGGGGTGG + Intronic
1157738199 18:50069436-50069458 AATACTGAAGACTCGGGGGATGG - Intronic
1158541904 18:58364913-58364935 AATGTTGAACAATTTGGGGATGG - Intronic
1159929635 18:74297453-74297475 AACGGTGAACCCAATGGGGAGGG - Intergenic
1160718367 19:586678-586700 GATGGGGAAGACCCTGGGGAGGG + Intergenic
1162262769 19:9546084-9546106 AATGGTGAACCCAATGGGCAGGG - Intergenic
1162287349 19:9749056-9749078 AATGGTGAACCCAATGGGGAGGG - Intergenic
1162567946 19:11454357-11454379 CAGGGTGAGCACTCTGGGGTGGG - Exonic
1163210202 19:15834638-15834660 AATGGTGAACCCAATGGAGAGGG - Intergenic
1166300372 19:41909218-41909240 CTTGGTGCCCACTCTGGGGAGGG - Intronic
1166905266 19:46103925-46103947 AATGGTGAACCCAATGGGGAGGG + Intergenic
925444298 2:3914699-3914721 AATAGTGAACGCTTTGGAGATGG + Intergenic
928724962 2:34161746-34161768 AATGACGTACACTCTGGAGAAGG - Intergenic
928919007 2:36506464-36506486 CATGGAGAACACACTGTGGATGG - Intronic
930047073 2:47181918-47181940 AATGGTAAATACGCTGGGCACGG + Intergenic
930098519 2:47585487-47585509 AATGGTGAACCCAATGGGGAGGG + Intergenic
930372229 2:50516487-50516509 AAGTGTGGATACTCTGGGGAAGG - Intronic
931446599 2:62332076-62332098 AATGCTGAACACCCTGGGGGAGG + Intergenic
931484058 2:62672237-62672259 AAACTTGAACACTCTTGGGATGG - Intergenic
932543300 2:72679827-72679849 AATGGTGACCAGTCAAGGGAAGG + Intronic
934141812 2:89054186-89054208 AATGGTGAACCCAATGGGGAGGG - Intergenic
934227429 2:90146360-90146382 AATGGTGAACCCAATGGGGAGGG + Intergenic
934615670 2:95769204-95769226 AAGGTTGAACACACAGGGGAGGG + Intergenic
935283117 2:101536595-101536617 ACTGGTCAAGACTCTGGTGAGGG - Intergenic
935481135 2:103591850-103591872 AAGGATTAATACTCTGGGGAAGG + Intergenic
935666792 2:105519103-105519125 AAGTGTGACCTCTCTGGGGAAGG + Intergenic
935793476 2:106615788-106615810 AATGGAGAAAACTCTAGGGTTGG - Intergenic
937430274 2:121832277-121832299 AATGTTCATCCCTCTGGGGATGG - Intergenic
938220382 2:129561163-129561185 CATGGTGAACAGTCTGGAGAAGG + Intergenic
940169191 2:150808420-150808442 AATAATGAAAACTCTGGGGTAGG - Intergenic
941208825 2:162609836-162609858 AGTGCATAACACTCTGGGGACGG + Intronic
946943114 2:224790782-224790804 AATTGTGAACATTGTAGGGAAGG + Intronic
947079662 2:226381928-226381950 GATGTTGAAAACGCTGGGGATGG - Intergenic
947258391 2:228191845-228191867 AATGCTGCAGACACTGGGGAGGG - Intergenic
1170384699 20:15803556-15803578 AATGGTGGTCACTCTGTTGAAGG + Intronic
1170562963 20:17572932-17572954 AATGGTTATAACTCTAGGGAGGG - Intronic
1173136939 20:40447095-40447117 AATGCTGAACACCCTGGCAATGG + Intergenic
1174898188 20:54472680-54472702 AATGGTGAAACCCCAGGGGAGGG - Intergenic
1175143058 20:56874681-56874703 ATTGGTGAGCGCCCTGGGGACGG + Intergenic
1177510904 21:22086679-22086701 AATTGTGCACACTCTGAGGCTGG - Intergenic
1177867104 21:26525496-26525518 AGTGCTGAAGCCTCTGGGGAAGG - Intronic
1178112822 21:29386087-29386109 CATGGTGAACACCCTGGCCATGG + Intronic
1179521544 21:41948654-41948676 TGTGGTGACCACTGTGGGGAAGG - Intronic
1180825283 22:18857109-18857131 GATGGGGACCCCTCTGGGGATGG + Intronic
1181187446 22:21117438-21117460 GATGGGGAGCCCTCTGGGGATGG - Intergenic
1181211752 22:21293055-21293077 GATGGGGAGCCCTCTGGGGATGG + Intergenic
1181397754 22:22633831-22633853 GATGGGGAGCCCTCTGGGGATGG - Intergenic
1181610463 22:24008068-24008090 GAAGGTGAACCCCCTGGGGAAGG - Intergenic
1181705722 22:24648512-24648534 GATGGGGAGCCCTCTGGGGATGG - Intergenic
1182826375 22:33268512-33268534 AATGGTGAGAACCCGGGGGACGG - Intronic
1183164448 22:36136924-36136946 AATGGGGAAAATTCTGGGTATGG - Intergenic
1183570544 22:38650048-38650070 AATGGTGAAGACTGTGAGGAAGG - Exonic
1184038851 22:41931761-41931783 AAGTGAGAGCACTCTGGGGATGG + Intergenic
1203215201 22_KI270731v1_random:2377-2399 GATGGGGACCCCTCTGGGGATGG - Intergenic
1203275432 22_KI270734v1_random:83012-83034 GATGGGGACCCCTCTGGGGATGG + Intergenic
949529112 3:4936540-4936562 GATGCTGAACACCCTGAGGATGG - Intergenic
950435346 3:12976153-12976175 AGTGGTGTACACTCTGGGAGTGG - Intronic
951357492 3:21685966-21685988 AATGGTGAAAACTGAGGGGCAGG + Intronic
954161171 3:48723723-48723745 AATGGTGAACCCAATGGGGAGGG + Intronic
954844275 3:53541718-53541740 AATAGTGAACACCGTGAGGAAGG + Intronic
955370357 3:58346125-58346147 ATTGGTGAAGATTCTGGGGTGGG + Intronic
955401245 3:58593098-58593120 AACGGTGAACCCAATGGGGAGGG - Intronic
960997999 3:123352106-123352128 AGTGGTGAGCAGTGTGGGGAAGG + Intronic
961611751 3:128145014-128145036 AATGGTGACAACTCAGAGGAAGG + Intronic
962457126 3:135574881-135574903 AAGGGTGAAGACACTGTGGAAGG - Intergenic
965458517 3:168932492-168932514 AATGGTAAACCCAGTGGGGAGGG + Intergenic
966604988 3:181812809-181812831 AATGGTAAACAGGCTGGGCATGG - Intergenic
967671981 3:192247275-192247297 AGTGCTGAAGTCTCTGGGGATGG - Intronic
968329970 3:197859880-197859902 AAAGATGAACAGTCTGGGAAAGG - Intronic
968412514 4:402327-402349 AATGGTGAACCCAATGGGGAGGG + Intergenic
969187574 4:5488335-5488357 AATGGTGAGCACTCTGGACTTGG + Intronic
969196178 4:5565761-5565783 AATGGTGAACACTCTGGGGATGG - Intronic
969363208 4:6678389-6678411 AATGCTGACCACTCTGGAGAGGG + Intergenic
970820801 4:20210271-20210293 AATGATGAACAAACTGGGCAAGG + Intergenic
970826325 4:20280508-20280530 GATGGTGAACACATTGGGCAAGG - Intronic
973223332 4:47753562-47753584 AATAATTAATACTCTGGGGAAGG - Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977401325 4:96535979-96536001 AATGGTGAACACTTTCCAGAAGG - Intergenic
977981176 4:103324056-103324078 AATGGTGAACACTTTCCAGAAGG + Intergenic
980298630 4:130957903-130957925 AAGGGTTAATACTCTGGGAAAGG - Intergenic
980714931 4:136616119-136616141 AAAGGTGAACACAGTGGGGAGGG - Intergenic
981278431 4:142929061-142929083 AAATATGAACAATCTGGGGAAGG + Intergenic
983562311 4:169113565-169113587 AATGGGGAGAACTCTGTGGATGG + Intronic
984463040 4:180059355-180059377 AATGATGACCACTCCGGGAAGGG - Intergenic
986767027 5:10937600-10937622 AATGCTGCAGGCTCTGGGGAAGG + Intergenic
987449488 5:18064097-18064119 AATGGAGAACGTTCTGGTGAAGG + Intergenic
988142387 5:27260474-27260496 AATAAAGAACACTCAGGGGAGGG + Intergenic
988211606 5:28211728-28211750 AATGGTGTGAACTCTGGAGATGG - Intergenic
988348449 5:30070050-30070072 AATGGTGGTCACTCAGGGCAAGG - Intergenic
988723239 5:33900115-33900137 AGTGGGGAACATTCTGGGGAAGG + Intergenic
990180667 5:53156920-53156942 AATGTTTAACACCCTGGGAATGG - Intergenic
990500605 5:56393027-56393049 AAGGATGAACACCCTTGGGAGGG - Intergenic
995446666 5:112252407-112252429 AATGGCTAACACTCAGGGTAGGG + Intronic
995843361 5:116466627-116466649 TATGCAGAACACTCTGGGGGAGG + Intronic
997157835 5:131577703-131577725 AATGGTGAACCCAATGGGGAGGG - Intronic
999050445 5:148518507-148518529 AATAGTGAAAACTTTTGGGAAGG - Intronic
1000133037 5:158318523-158318545 AAAGGTGAGCATTCTAGGGAAGG - Intergenic
1000250354 5:159488761-159488783 AATGGTGCACATTCATGGGATGG + Intergenic
1000492999 5:161938822-161938844 AATGGTGCAGACACTGTGGAAGG + Intergenic
1002476158 5:179467584-179467606 AATGCAGAACACAGTGGGGAAGG - Intergenic
1007112841 6:39322938-39322960 AAGGGTGAAGACGCTGGGGGCGG - Intronic
1007300453 6:40864132-40864154 AATAGTGAACCCAATGGGGAGGG + Intergenic
1007698333 6:43747947-43747969 AATTGCAAACACTCTTGGGAAGG + Intergenic
1009938594 6:70262244-70262266 TATGGCAAACACTCAGGGGAGGG + Intronic
1012112398 6:95253298-95253320 AATGGTAAACAATCGGTGGATGG - Intergenic
1013625080 6:111928856-111928878 AATGGTGATCACCAAGGGGAGGG - Intergenic
1015694715 6:135967204-135967226 TATGGTGTACAATCTGGGGAAGG - Intronic
1016389613 6:143561585-143561607 CATAGTGAAGTCTCTGGGGAGGG + Intronic
1016445171 6:144124603-144124625 TAGGGTGATCATTCTGGGGAAGG + Intergenic
1016714334 6:147205961-147205983 CATGGCGAACAGTCTAGGGATGG - Exonic
1017922353 6:158883429-158883451 AATGGTGAACCCAATGGGGAGGG + Intronic
1018330167 6:162718986-162719008 AATGGAGAAAACTCTAGAGAGGG + Intronic
1018626915 6:165788908-165788930 GATGGTGCACACACTGGGGGTGG - Intronic
1021981464 7:26059535-26059557 AATGGTGAGGAGTTTGGGGAGGG - Intergenic
1022545860 7:31188289-31188311 AATTGTTGTCACTCTGGGGAGGG - Intergenic
1025845630 7:65194093-65194115 AATGGTGAAAAATCTGGAAAGGG + Intergenic
1026023571 7:66728528-66728550 AATGGTGAAGACACTGGTGATGG - Intronic
1026147670 7:67761422-67761444 AATGGTTAACATGCTGGGCAAGG + Intergenic
1026983022 7:74537750-74537772 AAGGGTTAAAAATCTGGGGAAGG - Intronic
1030783126 7:113625962-113625984 AATGCTGATCACTGTGGAGATGG - Intergenic
1030945877 7:115719436-115719458 AATGATGAACACACTGGGTTTGG - Intergenic
1033143959 7:138855030-138855052 AATGCTGAGCATTCTGGGGATGG - Intronic
1035312126 7:157976043-157976065 GATGGTGAGCACTCAGGTGAGGG - Intronic
1035424612 7:158760881-158760903 AATGCTGAACACTCAAGGGAAGG + Intronic
1036030002 8:4959534-4959556 CATGGTGACCACTCTGGTCACGG + Intronic
1038343424 8:26709194-26709216 AATGGTGATGACTCCAGGGATGG - Intergenic
1038975925 8:32696020-32696042 ACTGGCAAACACTCTGGGAAGGG - Intronic
1039417942 8:37411659-37411681 AAGAGGGAACACTCTGGGCACGG + Intergenic
1039466925 8:37791153-37791175 AATGGTGAACAGCCTGGGTGGGG + Intronic
1040386041 8:46915814-46915836 AATGGGGAAGACTTGGGGGAGGG + Intergenic
1040419045 8:47222104-47222126 AATGGTGATGACGCTGGGAATGG - Intergenic
1040419091 8:47222383-47222405 AATGGTGATGATGCTGGGGATGG - Intergenic
1040585428 8:48736049-48736071 AGTGCTAAGCACTCTGGGGAAGG + Intergenic
1042712409 8:71733191-71733213 AAGGGTGAACACTGAGGTGAGGG + Intergenic
1043721310 8:83549025-83549047 AATGGTGAACCTAATGGGGAGGG - Intergenic
1044618105 8:94162943-94162965 AATGGTTAAGACTCTGGGCTTGG + Intronic
1045841134 8:106582911-106582933 AAGGCTGAACACTGTGGGGAGGG - Intronic
1048265424 8:132981265-132981287 AATGCTGAACACTATGAGAATGG - Intronic
1049376575 8:142292199-142292221 AAGGGTGGAGACTCTCGGGAAGG - Intronic
1049473734 8:142787498-142787520 AATCGTGAACTCTTTGGGGCTGG + Intergenic
1051114593 9:13679955-13679977 AATGGTGAACACTTTCCAGAAGG + Intergenic
1051700020 9:19812763-19812785 AATGGTGAATACTTTCTGGAAGG - Intergenic
1052976339 9:34413284-34413306 AAAGGTGAACACTAAGGGGTTGG + Intronic
1057405799 9:94769718-94769740 AATTGTAAGCACACTGGGGAGGG + Intronic
1060850003 9:126866862-126866884 AATGGTGGTCACTGTGGGGAAGG - Intronic
1186564709 X:10650476-10650498 AATAATGAAAACTCAGGGGAGGG - Intronic
1187022902 X:15403059-15403081 TATGGTGAATACTTTGAGGAAGG - Intronic
1194586329 X:95738878-95738900 AATGGAGAACAGTTTGGAGAAGG + Intergenic
1195454223 X:105050785-105050807 AGAGCTGAACACTCAGGGGATGG - Intronic
1196969493 X:121093291-121093313 AAGGGTGAACACTCTGTATAAGG + Intergenic
1197734544 X:129841020-129841042 AATGCTCTACACTCTAGGGATGG - Intronic
1198529260 X:137533979-137534001 AATGGTGAAGAACATGGGGACGG - Intergenic
1201785992 Y:17779721-17779743 AATGGGAAACACTTGGGGGAGGG - Intergenic
1201815561 Y:18126267-18126289 AATGGGAAACACTTGGGGGAGGG + Intergenic
1201891301 Y:18946584-18946606 AATGGTGAACCCAATGGGGAGGG + Intergenic