ID: 969197396

View in Genome Browser
Species Human (GRCh38)
Location 4:5573841-5573863
Sequence CCGTGGGCCTTGCTAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969197396_969197403 -1 Left 969197396 4:5573841-5573863 CCTGCAGCTAGCAAGGCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 120
Right 969197403 4:5573863-5573885 GGTCAGCTCTCAGGTTGCGAGGG No data
969197396_969197402 -2 Left 969197396 4:5573841-5573863 CCTGCAGCTAGCAAGGCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 120
Right 969197402 4:5573862-5573884 GGGTCAGCTCTCAGGTTGCGAGG No data
969197396_969197404 13 Left 969197396 4:5573841-5573863 CCTGCAGCTAGCAAGGCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 120
Right 969197404 4:5573877-5573899 TTGCGAGGGAAACCTGCTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 83
969197396_969197406 20 Left 969197396 4:5573841-5573863 CCTGCAGCTAGCAAGGCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 120
Right 969197406 4:5573884-5573906 GGAAACCTGCTGCAGGGACTTGG 0: 1
1: 0
2: 1
3: 24
4: 209
969197396_969197407 23 Left 969197396 4:5573841-5573863 CCTGCAGCTAGCAAGGCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 120
Right 969197407 4:5573887-5573909 AACCTGCTGCAGGGACTTGGAGG No data
969197396_969197405 14 Left 969197396 4:5573841-5573863 CCTGCAGCTAGCAAGGCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 120
Right 969197405 4:5573878-5573900 TGCGAGGGAAACCTGCTGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 101
969197396_969197399 -10 Left 969197396 4:5573841-5573863 CCTGCAGCTAGCAAGGCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 120
Right 969197399 4:5573854-5573876 AGGCCCACGGGTCAGCTCTCAGG 0: 1
1: 0
2: 2
3: 10
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969197396 Original CRISPR CCGTGGGCCTTGCTAGCTGC AGG (reversed) Intronic
900101092 1:962449-962471 CCGTGGGACATGCTGCCTGCGGG - Exonic
901128925 1:6950060-6950082 CTGTGGGCCTTTCTCTCTGCTGG + Intronic
901594934 1:10377403-10377425 CCGTGGGCCGTGATGGCAGCAGG + Exonic
902705350 1:18200460-18200482 CCTGGTGCCTTCCTAGCTGCTGG + Intronic
903217694 1:21852301-21852323 CCCTGGGCTGAGCTAGCTGCAGG - Intronic
904272108 1:29356837-29356859 CCGTGGGCGGTGCTAGAGGCGGG + Intergenic
912924996 1:113905696-113905718 CCGTGGGCCTGTCTAGCACCTGG + Exonic
915589644 1:156863147-156863169 CCTGGGGCCTGCCTAGCTGCTGG - Intronic
916758639 1:167797109-167797131 GTGTGGGACTTGCTGGCTGCTGG - Intergenic
1067497406 10:46773390-46773412 CCTGGGGCCTTGCTAGGTGGGGG + Intergenic
1067586166 10:47477296-47477318 GCGTGGGCCTTGCCACGTGCTGG + Intronic
1067597245 10:47567025-47567047 CCTGGGGCCTTGCTAGGTGGGGG - Intergenic
1067793980 10:49307612-49307634 CAGTGGGCCTTGCAGGGTGCAGG - Intronic
1067842239 10:49690282-49690304 CCCTGGCCCTTGTTGGCTGCCGG - Intronic
1069894544 10:71672385-71672407 CCTTGGGCCTTGATGGGTGCGGG - Intronic
1070973012 10:80582793-80582815 CCAGGGGCCCTGCTTGCTGCAGG + Intronic
1074121405 10:110496856-110496878 GCCAGGGCTTTGCTAGCTGCGGG - Intergenic
1074405969 10:113180759-113180781 CCGTGGGCCTTGCCAGGTTAAGG - Intergenic
1077178161 11:1199921-1199943 CCGTGCGCCTGGCTTACTGCCGG + Intronic
1081813868 11:45928029-45928051 CTGTTGGCCTTGCTGGATGCGGG + Exonic
1082888585 11:58114105-58114127 CTGTTGGCCCTGCTACCTGCTGG - Intronic
1083324537 11:61866636-61866658 ACGTGGGCCCTGCAGGCTGCAGG + Exonic
1083650046 11:64197762-64197784 ATGCGGGCCTTTCTAGCTGCAGG + Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084155741 11:67311638-67311660 CCTTGGTCCTTGCAAGCTGTGGG - Exonic
1084212295 11:67629845-67629867 CCGTGGCCCCTGCCAGCAGCCGG + Exonic
1084741276 11:71140952-71140974 CCTTGGGCCTTGAAACCTGCTGG - Intronic
1085886929 11:80532851-80532873 CCGTGGGCATGGCAGGCTGCAGG + Intergenic
1093096917 12:14982287-14982309 CCCTGGGCCTTCCTAAGTGCTGG + Intergenic
1096279814 12:50243137-50243159 CCATGGTCCTTTATAGCTGCAGG - Intronic
1096806334 12:54143410-54143432 AGTTGGGCCTTGCTACCTGCAGG + Intergenic
1098515598 12:71373136-71373158 CCCAAGGCCTAGCTAGCTGCAGG + Intronic
1106232283 13:27830061-27830083 CCGTGGGGCCTGCGGGCTGCGGG - Intergenic
1106305040 13:28501847-28501869 CCGTAGGCCTGGCTGACTGCTGG - Intergenic
1108034701 13:46277497-46277519 CTGTAGGCCTTGGTAGATGCTGG - Intergenic
1113647763 13:112011137-112011159 CTGAGGGCTTTGCTCGCTGCTGG - Intergenic
1119479326 14:74949846-74949868 CAGAGGGCCTGGGTAGCTGCCGG - Intronic
1121546938 14:94769713-94769735 CCGTGGGCCCGGCCTGCTGCGGG - Exonic
1122999090 14:105282494-105282516 CCGTGGGCCAAGCTTGCAGCGGG + Intronic
1123036218 14:105473038-105473060 CTGTGGGGCTTGCTACCTGTGGG - Exonic
1128478596 15:68018278-68018300 CCCTCGGCCTTGCTACATGCTGG + Intergenic
1128496583 15:68201658-68201680 CTGTGGTCCTTGCCAGCAGCAGG + Intronic
1129466313 15:75726077-75726099 CCCTGGGCCTTGCTATCTCTTGG + Exonic
1131867355 15:96725396-96725418 CTGTCTGCCTTGCTAGCTGCTGG + Intergenic
1132327622 15:100984938-100984960 ACGTGGGCCCTTCTAGGTGCAGG - Intronic
1132759097 16:1500325-1500347 TCGTGGGCCATGCCACCTGCAGG + Exonic
1134692355 16:16199039-16199061 CTGTGGTCCTAGCTAGCTACTGG + Intronic
1135002867 16:18791226-18791248 CCCAGGGCCTTGCTAGCGTCTGG - Intronic
1138103110 16:54270315-54270337 CCTGTGGCCTTGGTAGCTGCTGG - Intronic
1141055666 16:80811429-80811451 CCTTGCCCCTTGCTAGCTTCTGG - Intergenic
1145065993 17:19761855-19761877 CCGTGGGCCTCTGCAGCTGCAGG + Intergenic
1147962531 17:44176929-44176951 CCGAGGGCCCAGGTAGCTGCAGG + Exonic
1151231739 17:72690024-72690046 GAGGGGGCCTTGCAAGCTGCAGG + Intronic
1154446247 18:14438047-14438069 AAGTCGGCCTTGCTAGCAGCAGG - Intergenic
1155585765 18:27362583-27362605 CTCTGGGCCTTTCTACCTGCTGG + Intergenic
1157516041 18:48312196-48312218 TCCTGGGCCTTGCTACCAGCTGG + Intronic
1160938688 19:1609973-1609995 GTGTGGGCCTGGCTAGCTGGGGG - Exonic
1161995474 19:7708766-7708788 CACAGGGCCTTGCTGGCTGCCGG - Intergenic
1162951557 19:14074383-14074405 CCGTCGCCCCTGCTCGCTGCGGG - Exonic
925161966 2:1691528-1691550 CCGGTCGCCTTGCCAGCTGCAGG - Intronic
925310094 2:2875931-2875953 CCGGGGCCCTTGCTAGGTGTAGG - Intergenic
925349113 2:3188809-3188831 CCGGGAGCCATGCTGGCTGCTGG - Intergenic
925529707 2:4845723-4845745 CCTTGCCCCTTGCTAGCTTCTGG - Intergenic
926778212 2:16442981-16443003 CCTTGAGCCTTACCAGCTGCAGG - Intergenic
931668637 2:64627501-64627523 CAATAGGCCTTGCTAGCAGCTGG + Intergenic
932243988 2:70180877-70180899 CTGTGGTCCTAGCTATCTGCGGG + Intronic
933777365 2:85779139-85779161 CCATGGGCCTTTTGAGCTGCTGG + Intronic
933872808 2:86586001-86586023 CCGTGGGTTTTGATATCTGCAGG - Intronic
937104374 2:119296216-119296238 CAGTGGGCCTTTCTGTCTGCAGG - Intergenic
946386979 2:219389251-219389273 CCATGCACCTTCCTAGCTGCAGG + Intronic
947813961 2:233023614-233023636 GCGTGGGGCTTGCTACCTCCAGG + Intergenic
949026300 2:241767978-241768000 CAGTGGGCCTTGGCAGCAGCAGG - Exonic
949042064 2:241854061-241854083 CCGTGGGCCAGCCTGGCTGCAGG - Intronic
1172117028 20:32579162-32579184 CTGTGGGCCTTGGCAGCTGCGGG - Intronic
1174442888 20:50569993-50570015 CCTTGGGCCTTGCCAGGTCCAGG + Intronic
1175226024 20:57444543-57444565 CCCTGGGCCTGGCTCGCTGAGGG - Intergenic
1175277579 20:57782726-57782748 CCCAGGGACCTGCTAGCTGCAGG - Intergenic
1175540846 20:59746704-59746726 CAGGGGGCCCTGCCAGCTGCCGG - Intronic
1175918345 20:62438074-62438096 TTGTGAGCATTGCTAGCTGCCGG + Intergenic
1175920566 20:62448802-62448824 CCGTGTGCCTCGCCTGCTGCTGG - Intergenic
1176287975 21:5028821-5028843 CCTGGGGCCCTGCTGGCTGCAGG + Intronic
1176430704 21:6573832-6573854 CCTTGGGCCCTGCTAGGCGCGGG + Intergenic
1176449734 21:6851799-6851821 AAGTTGGCCTTGCTAGCAGCAGG + Intergenic
1176827906 21:13716823-13716845 AAGTTGGCCTTGCTAGCAGCAGG + Intergenic
1179706098 21:43181294-43181316 CCTTGGGCCCTGCTAGGCGCGGG + Intergenic
1179869206 21:44234654-44234676 CCTGGGGCCCTGCTGGCTGCAGG - Intronic
1179984647 21:44913726-44913748 CCGTGGGCCATCCTGGCTGCTGG - Intronic
1181273431 22:21674017-21674039 CCGTGGGCCCTGCCTGCTGCTGG - Intronic
950162305 3:10769553-10769575 CCATGGGCCTTGCTCTCAGCTGG - Intergenic
960968315 3:123120886-123120908 CAGTGGGCTATGCTAGCTGGTGG + Intronic
960971163 3:123141231-123141253 CCATGGGCCCTGCCAGCAGCTGG + Intronic
962283848 3:134070888-134070910 CAGGGGGCCTGGCTATCTGCTGG - Intronic
963349379 3:144134141-144134163 CCTTGGGCCTCTCTGGCTGCAGG - Intergenic
967420080 3:189262863-189262885 CCCAGGGCCTTGCTGGCAGCTGG + Intronic
967815513 3:193795222-193795244 CCCTGTGCCTTGCTTGCTGTCGG - Intergenic
968625309 4:1624246-1624268 CCGTGGGCCCTGCGAAGTGCTGG - Intronic
968887852 4:3344866-3344888 GTGTGGGCCCTGCTCGCTGCTGG + Intronic
969197396 4:5573841-5573863 CCGTGGGCCTTGCTAGCTGCAGG - Intronic
969592222 4:8128429-8128451 GCAGGGGCCTTGCGAGCTGCAGG - Intronic
970213573 4:13735588-13735610 CTCTGGGCCTTGGTGGCTGCTGG + Intergenic
986302327 5:6487842-6487864 CCGTGTTCCCTGCTTGCTGCAGG - Intronic
992297329 5:75337790-75337812 CCGTCTGCCCTGCGAGCTGCCGG - Intronic
994568970 5:101488596-101488618 CTGTGGCCCTTGCTAGATGCAGG + Intergenic
1002643239 5:180640471-180640493 ACGTGGGCCTTCCTGCCTGCAGG - Intronic
1019198786 6:170297145-170297167 CCCTGGGCCTGTCTGGCTGCAGG + Intronic
1026297128 7:69062758-69062780 CCGTCGGCCTTGCGGGCCGCCGG + Intergenic
1026896593 7:74013222-74013244 CCCTGGGCCATGCTGGCCGCTGG - Intergenic
1027858229 7:83540130-83540152 TCGTCGGCCTTGCAAACTGCTGG + Intronic
1037528687 8:19753116-19753138 CCATGGCCTTTGCTAGCTGGGGG + Intronic
1038477281 8:27877085-27877107 GCATGGGCCAGGCTAGCTGCAGG - Intronic
1038482602 8:27912003-27912025 CCTTGGCCCTTCCCAGCTGCTGG - Intronic
1040560553 8:48519997-48520019 TCATGGGCCTTGCTAGCTCCTGG - Intergenic
1042868930 8:73380123-73380145 CCCTGGGCATTGCTAGATACTGG + Intergenic
1044757667 8:95481797-95481819 CCCTGGGCCCTGCTGGCTGCAGG + Intergenic
1047461233 8:125067265-125067287 ACGTGGGCCTTCCAAGGTGCTGG + Intronic
1053505827 9:38642479-38642501 CCGTGGGGCTTATTAGATGCAGG + Intergenic
1057172057 9:92968962-92968984 CCCTGGGCCTTGCTCACTGTGGG + Intronic
1059325947 9:113504081-113504103 CCAAGGGCCTTGGAAGCTGCAGG - Intronic
1059388550 9:113984392-113984414 CCATGACTCTTGCTAGCTGCAGG - Intronic
1060033097 9:120232474-120232496 ACGTGGCCCTTGCTCACTGCAGG + Intergenic
1060560511 9:124538732-124538754 CCGGGTTCCTTGCTAGATGCTGG - Intronic
1061309521 9:129753102-129753124 GCGTGGGCGGTGCTGGCTGCAGG - Intergenic
1061653941 9:132073414-132073436 CCAGGCGCCTTGCTAGTTGCTGG + Intronic
1062708104 9:137956332-137956354 CTGTGGGCCCTGCTGGCTTCTGG + Intronic
1203519450 Un_GL000213v1:32718-32740 AAGTTGGCCTTGCTAGCAGCAGG - Intergenic
1190108499 X:47574712-47574734 CCGGGGGCCCTGCGGGCTGCTGG + Exonic
1200066458 X:153506429-153506451 TGGTGGGCCCTGCTACCTGCCGG - Intronic
1200944238 Y:8816649-8816671 GCCTGGGTCTTGCTAGGTGCTGG - Intergenic