ID: 969198706

View in Genome Browser
Species Human (GRCh38)
Location 4:5584622-5584644
Sequence GATCCTGGAGTCGCACAGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969198706_969198712 28 Left 969198706 4:5584622-5584644 CCCGGCTGTGCGACTCCAGGATC 0: 1
1: 0
2: 0
3: 14
4: 204
Right 969198712 4:5584673-5584695 CAGATGCACTCAGCTCTTCCAGG 0: 1
1: 0
2: 2
3: 22
4: 227
969198706_969198710 -4 Left 969198706 4:5584622-5584644 CCCGGCTGTGCGACTCCAGGATC 0: 1
1: 0
2: 0
3: 14
4: 204
Right 969198710 4:5584641-5584663 GATCTGTGTGCAGGCCGACTTGG 0: 1
1: 0
2: 0
3: 8
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969198706 Original CRISPR GATCCTGGAGTCGCACAGCC GGG (reversed) Exonic
900116785 1:1032504-1032526 CTTCCTGGAGTCCCCCAGCCGGG - Intronic
901333131 1:8425624-8425646 GGTCCTGGCGTTCCACAGCCTGG - Intronic
901924872 1:12559866-12559888 CCTCCTGGAGTCACACAGCCAGG + Intergenic
902327200 1:15709087-15709109 GATTCTGGAGTCGGACAACTTGG - Intronic
904237691 1:29124944-29124966 GGTCCCGGAGCCGCACGGCCAGG + Intergenic
904461742 1:30684818-30684840 GAACCTGGAGTCAGACAGGCTGG + Intergenic
907249946 1:53131378-53131400 GACCCTGGTGTCACACAGCCTGG - Intronic
908646442 1:66283125-66283147 GATTCTGGAGCCACACTGCCTGG + Intronic
911485522 1:98500470-98500492 GATCCTGTAGTCAGAAAGCCAGG + Intergenic
911910587 1:103629265-103629287 GATCCAGGAATCCCACAGCTAGG + Intergenic
911918003 1:103723390-103723412 GATCCAGGAATCCCACAGCTAGG + Intronic
912249362 1:107994907-107994929 GATTTTGGAGTCAGACAGCCGGG - Intergenic
912930746 1:113958180-113958202 GTTCCTGGAGTTGCCCAGCAGGG + Exonic
915268564 1:154735585-154735607 TATCCTTGAGTAGCACAGGCTGG + Intronic
915541989 1:156573244-156573266 GATCCTGGAGGCACAGGGCCAGG + Intergenic
916426462 1:164685850-164685872 GATCCTGAACTCTCACTGCCAGG - Intronic
916618570 1:166471452-166471474 CTTCCTGGAGTCACAAAGCCTGG + Intergenic
918056236 1:181023886-181023908 CTTCCTGTAGTCACACAGCCTGG + Intergenic
918256750 1:182755405-182755427 GATCCTGGAGTCACACTGTCCGG + Intergenic
920035209 1:203060919-203060941 GATCCTGGGGACCCACACCCAGG + Intronic
922749722 1:228064774-228064796 GATCCTGGAGGCTGCCAGCCTGG + Intergenic
922999147 1:229991794-229991816 GATTCAGGAGTAGCTCAGCCAGG + Intergenic
924250187 1:242125061-242125083 GATTCTGGAGTCAGACTGCCTGG + Intronic
924402578 1:243702345-243702367 GACTCTGGAGTCACACAGCTTGG + Intronic
1068923820 10:62513944-62513966 GAACCTGGAGTCAGACTGCCAGG + Intronic
1070102111 10:73398204-73398226 TATCCTGGTGCCCCACAGCCAGG - Exonic
1070889122 10:79929035-79929057 GATTCTGGAGTCAGACTGCCTGG + Intergenic
1072671118 10:97430158-97430180 GATTCTGGAGTCCCACAGCATGG + Intronic
1072710149 10:97711097-97711119 GGTCCTGGAGTCAGACTGCCTGG - Intergenic
1074308365 10:112299696-112299718 GCTCCTGGAGTCTTCCAGCCAGG + Intronic
1074693750 10:116029600-116029622 CATCCTGGAGTCAGACAGACTGG - Intergenic
1075519102 10:123133482-123133504 GATCCGGTAGCCGCACAGCAGGG + Intergenic
1075649033 10:124115547-124115569 GAGCCTGGAGTCAGACTGCCTGG - Intergenic
1076541746 10:131219363-131219385 GGTCCTGGGGTCGGCCAGCCAGG - Intronic
1076594282 10:131616243-131616265 GACCCTGGATTAGCACAACCTGG + Intergenic
1077081588 11:726815-726837 GTTCCTGGGGTCGCAGAGCAAGG + Intronic
1078484101 11:11705982-11706004 GACCCTGGAGTCCCACCACCAGG + Intergenic
1078735931 11:14020762-14020784 AGTTCTGGAGTCCCACAGCCAGG + Intronic
1079532165 11:21467151-21467173 GATTCTGGAGTCAGGCAGCCTGG + Intronic
1080432138 11:32209090-32209112 TATCCTGGTGTGGCAGAGCCTGG + Intergenic
1083705424 11:64510928-64510950 GACCCTGGAGAGGCACCGCCTGG + Intergenic
1084328095 11:68413427-68413449 GAACCTGGAGTCTCGCTGCCTGG + Intronic
1084525727 11:69696914-69696936 TCTCCTGGAGCCACACAGCCTGG - Intergenic
1084529230 11:69717284-69717306 GATCCTGCACACACACAGCCTGG - Intergenic
1090343566 11:126047750-126047772 GGTCCTGGAGTCAGAGAGCCTGG - Intronic
1090410010 11:126501564-126501586 GAACTTGGAGTTGAACAGCCTGG - Intronic
1090921503 11:131210107-131210129 GATCCAGCAGTCTCACAGCTGGG + Intergenic
1091133475 11:133166449-133166471 GACACTGGAGTTGCACATCCTGG - Intronic
1092678643 12:10951924-10951946 GATCTTGGAGTCAGACTGCCAGG + Intronic
1092686641 12:11056426-11056448 GATCTTGGAGTCAGACTGCCAGG + Intronic
1099665018 12:85617486-85617508 GACCCTGGAGCCAAACAGCCTGG - Intergenic
1100914861 12:99408984-99409006 GATCCTGCAGTCACACTGCTAGG + Intronic
1101210304 12:102528912-102528934 GATCCTGGAGATCCACATCCTGG + Intergenic
1103723666 12:122987545-122987567 CATCCCTGAGTCGCACCGCCTGG - Exonic
1104960689 12:132487376-132487398 GCTCCCGGAGACACACAGCCCGG + Intergenic
1106126473 13:26903794-26903816 CCTCCTGGAGTCACAAAGCCTGG - Intergenic
1112590622 13:100760875-100760897 GATTCTGGAGCCAGACAGCCTGG - Intergenic
1113791053 13:113028497-113028519 CATCTGTGAGTCGCACAGCCTGG + Intronic
1114098954 14:19361316-19361338 GGTTCTGCAGTGGCACAGCCAGG - Intergenic
1114649319 14:24273763-24273785 GATCCTGGAGCCAGACTGCCTGG + Intergenic
1121751614 14:96362865-96362887 GAGCCTGGAGCAGCTCAGCCTGG - Exonic
1122548464 14:102537793-102537815 TTGCCTGGAGTCACACAGCCTGG - Intergenic
1122952638 14:105054107-105054129 GATCATGGAGTCCCACCTCCAGG + Intronic
1124864920 15:33480208-33480230 GACCCTGGAGTCAGACTGCCTGG + Intronic
1124871726 15:33550187-33550209 GATGCCGGAGTCGGAAAGCCTGG - Exonic
1128228136 15:66017073-66017095 GCTGCTGGAGAAGCACAGCCCGG + Intronic
1129220445 15:74128984-74129006 GATCCTGTGGTGGGACAGCCAGG - Exonic
1130208450 15:81900599-81900621 GATCCTGGAAACGTGCAGCCTGG - Intergenic
1130559148 15:84945045-84945067 GTTCCCGGTGTTGCACAGCCTGG + Intronic
1131394634 15:92076758-92076780 CTGCCTGTAGTCGCACAGCCTGG + Intronic
1131487773 15:92836417-92836439 GATTCTGGAGCCAGACAGCCTGG - Intergenic
1133944907 16:10340015-10340037 CCTCCTGGAGTCACAAAGCCTGG - Intronic
1134770156 16:16801271-16801293 GATCCTGGAGTTTCTCAGACAGG - Intergenic
1135149217 16:19990742-19990764 AAGCCTGGAGTTGAACAGCCAGG + Intergenic
1137317331 16:47339306-47339328 GATCCTGCAGTCCCACTGCTAGG - Intronic
1137892062 16:52173319-52173341 GACTCTGGAGTCCCACAGTCTGG - Intergenic
1139176980 16:64700767-64700789 GAACCTGGAGTTGCAGGGCCTGG - Intergenic
1139690317 16:68637496-68637518 GACTCTGGAGTCACACTGCCTGG - Intronic
1140231789 16:73123422-73123444 GATCCTGGAGACACATAGCCTGG + Intergenic
1140864792 16:79050544-79050566 GATACTGCAGTCCCAAAGCCCGG + Intronic
1141669691 16:85485312-85485334 GAGCCTGCAGTCACACAGCAGGG + Intergenic
1141908895 16:87045144-87045166 GCTCCTGGAGACCCACAGCCAGG + Intergenic
1141977013 16:87523460-87523482 GGTCCTAGAGTCACACGGCCAGG + Intergenic
1142535422 17:614170-614192 TGTCCTGGAGTTGCACAGCTGGG + Intronic
1143218061 17:5239908-5239930 CCTCCTGGAGTCACAAAGCCTGG + Intergenic
1143350205 17:6282596-6282618 TGTCCTGCAGTCTCACAGCCAGG - Intergenic
1144221407 17:13103165-13103187 GATCCACCAGTCCCACAGCCTGG - Intergenic
1144725341 17:17499075-17499097 GATCCCGGAGTCCCACAGAGAGG + Intergenic
1146521963 17:33532281-33532303 GATCATGCATTCCCACAGCCTGG - Intronic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1149679736 17:58497385-58497407 GTTCCTGGAGTCCCATAGGCAGG + Intronic
1149863259 17:60136084-60136106 GATCCTGGATTTGCAGGGCCAGG - Intergenic
1152430626 17:80246602-80246624 GATCTTGGTGTCGAACAGCGGGG - Exonic
1155455022 18:26002637-26002659 GAACCTGGAGTCAGACTGCCTGG - Intergenic
1156529305 18:37799447-37799469 GATCCTGGAGTTTCACCTCCAGG - Intergenic
1161252256 19:3286411-3286433 GATTCTGGAGTCTGACAGTCAGG + Intronic
1161543974 19:4868616-4868638 GATCCAGCAGTCACAGAGCCTGG - Intergenic
1161850779 19:6737118-6737140 GACCCTGGAGCCGCACAGCGGGG - Intronic
1161913260 19:7210517-7210539 CCTCCAGGAGTCGCACAGCGAGG - Intronic
1168106419 19:54168338-54168360 GCTCCTGGAGCTGCACAGTCAGG + Intronic
925011512 2:488928-488950 GAGCTTGGAGTCCCTCAGCCAGG + Intergenic
931444240 2:62313663-62313685 GTTCCAGGAGAAGCACAGCCAGG - Intergenic
932445722 2:71779805-71779827 GCTCCTACAGTCCCACAGCCTGG - Intergenic
932570406 2:72935529-72935551 GATCCTGGAGAAGCACAGATGGG - Intronic
933173954 2:79156263-79156285 GAGCCTGGGGTCACAGAGCCTGG + Intergenic
934615292 2:95766977-95766999 CCTCCTGGAGTCACAAAGCCTGG - Intergenic
934645614 2:96057582-96057604 CCTCCTGGAGTCACAAAGCCTGG + Intergenic
934839018 2:97613671-97613693 CCTCCTGGAGTCACAAAGCCTGG + Intergenic
942427185 2:175872329-175872351 AATCCTGGACTGGCACATCCAGG - Intergenic
944142874 2:196476055-196476077 GACCCTAGAGTCAAACAGCCTGG + Intronic
945983824 2:216338986-216339008 GGTCCTGGATTCAAACAGCCTGG - Intronic
946428795 2:219613782-219613804 GATCCTGCAGGGGAACAGCCAGG - Exonic
947217107 2:227759536-227759558 CTTCCTGGAGTCACAAAGCCTGG + Intergenic
948804649 2:240448261-240448283 GATCCAGGAGGCAGACAGCCTGG - Intronic
1172321625 20:33999487-33999509 CATCCGGGTGTGGCACAGCCTGG + Intronic
1172779201 20:37425801-37425823 GATTCTGGAGCCAGACAGCCTGG - Intergenic
1174738178 20:52985169-52985191 GATCTTGGAGTCTGACAGACAGG + Intronic
1176088495 20:63308729-63308751 GGCCCTGGAGTCTCACCGCCGGG + Intronic
1177601298 21:23318280-23318302 TCCCCTGGAGTCGCACAGCTTGG + Intergenic
1179101471 21:38358787-38358809 GGTACTGGAGTAGCAGAGCCAGG + Intergenic
1179831001 21:43995829-43995851 GATCCTGGTGTCGGACAGCTGGG + Intergenic
1183393584 22:37559896-37559918 GACCCTGGAGCCGGACAGCCTGG - Intergenic
1184075016 22:42171195-42171217 GCTCCTGGAGACCGACAGCCAGG + Intronic
1184968588 22:47998933-47998955 GCTCCTGGAGGCACACGGCCAGG - Intergenic
1185012665 22:48323955-48323977 GGTCCTGGAGACCCACAGCTAGG - Intergenic
949344086 3:3060641-3060663 GATCCTGGAGTTTGACTGCCTGG + Intergenic
949768749 3:7555014-7555036 GATACTGAAGTCAGACAGCCAGG + Intronic
950536582 3:13582416-13582438 GGTCCTAGAGGCCCACAGCCTGG - Intronic
950676026 3:14555036-14555058 AAGCCTGGGGTCACACAGCCTGG + Intergenic
954111916 3:48438595-48438617 GATCCTGGATTTGGAAAGCCAGG - Intronic
954248551 3:49350744-49350766 CAGGCTGGAGTCGCACAGGCTGG + Intergenic
954540437 3:51390204-51390226 GCTCCTGGAGTAGCTCAGGCAGG - Intergenic
955412378 3:58664055-58664077 GATCCTGGAGCTGGACTGCCTGG + Intronic
956187516 3:66576649-66576671 GACCGTGGAGTCACACACCCTGG - Intergenic
963039793 3:141060487-141060509 TAACCTGGGGTCACACAGCCAGG - Intronic
964985378 3:162732082-162732104 CCTCCTGGAGTCACAAAGCCTGG + Intergenic
965405141 3:168258997-168259019 GATTCTAGAGTCAGACAGCCTGG - Intergenic
969198706 4:5584622-5584644 GATCCTGGAGTCGCACAGCCGGG - Exonic
969203291 4:5622691-5622713 GATCCTGGAGGAGCACGGCAAGG - Exonic
969214597 4:5711630-5711652 GCTCAAGGAGTCGCAGAGCCGGG - Intronic
971233418 4:24819296-24819318 GACCCTGGAGTTGGACAACCTGG - Intronic
972770783 4:42195044-42195066 GATTCTGGAGTCAGACTGCCTGG + Intergenic
975591439 4:76004079-76004101 GGTTCTGGAGTCTCACAGACTGG - Intronic
981883002 4:149638385-149638407 GATCCAGCAATTGCACAGCCAGG + Intergenic
983502344 4:168513459-168513481 GATCCTGGAGTCCCCCTGCAGGG + Intronic
984852386 4:184165351-184165373 GAGGCTGGAGCCGCACAGCTAGG + Intronic
984953607 4:185024320-185024342 GCTTCTGGAGTCAGACAGCCTGG + Intergenic
986064705 5:4223785-4223807 GATTCTGGAGACTCACATCCTGG + Intergenic
987517081 5:18924417-18924439 GATCCAGCAGTCTCACTGCCAGG - Intergenic
988898367 5:35702706-35702728 GAACCTGGAGTCACATTGCCTGG + Intronic
995076373 5:107989652-107989674 GATCCAGCAGTCCCACAGCTGGG - Intronic
996460417 5:123734264-123734286 GAACCTGGAGTCTGACATCCAGG - Intergenic
996729449 5:126703273-126703295 CCTCCTGGAGTCACAAAGCCTGG - Intergenic
996817088 5:127586441-127586463 GATGCTGGAGTCCCACAATCTGG - Intergenic
997696295 5:135863746-135863768 GGTCATAGAGTTGCACAGCCTGG - Intronic
997752142 5:136356862-136356884 CATCCTGGCGGCGCACTGCCAGG - Exonic
997757529 5:136413629-136413651 GATTCTGAAGTCTGACAGCCAGG + Intergenic
999384545 5:151145066-151145088 GATCCTGGGTTCCCGCAGCCGGG - Intronic
1000188853 5:158888778-158888800 GTTCCTGGAGTGGCAGAGGCTGG - Intronic
1000890727 5:166798769-166798791 GATCCTGCAATCCCACTGCCAGG - Intergenic
1002721069 5:181261667-181261689 GATCCGGGCGCCGCACAGCTGGG + Intergenic
1004144660 6:13054103-13054125 GATCCTGGAGCCACACTTCCTGG + Intronic
1004679914 6:17883475-17883497 AATCCTTCAGTGGCACAGCCAGG + Intronic
1005152943 6:22773354-22773376 GATGCTGGAGCCACACTGCCTGG + Intergenic
1006512894 6:34531293-34531315 GATCCTGGAGTCAGACCTCCTGG - Intronic
1006884242 6:37367325-37367347 GATCCTGGAGTCAGACTGCCTGG - Intronic
1008391663 6:50959230-50959252 GTTTCTGGAGTGGCATAGCCTGG - Intergenic
1008506659 6:52237288-52237310 GGTTCTGGAGCCACACAGCCTGG + Intronic
1011513136 6:88123494-88123516 GAACCTGGAGTCAGACTGCCTGG + Intergenic
1012049877 6:94328263-94328285 GATCCTGGAGGTGTACAGCTTGG - Intergenic
1013329076 6:109080723-109080745 GACTCTTGAGTCTCACAGCCTGG + Intronic
1014293710 6:119591808-119591830 GATCCTAGAGTCGGACAGACTGG - Intergenic
1014894918 6:126890265-126890287 GCTCCTGGAGTAGCAGAACCTGG + Intergenic
1016387313 6:143541299-143541321 GAACCTGAAGACACACAGCCAGG + Intronic
1020771762 7:12404020-12404042 CACCGTGCAGTCGCACAGCCAGG + Intergenic
1024589701 7:50870738-50870760 ATTCCTGGAGTCACACATCCTGG + Intergenic
1024676701 7:51644125-51644147 GATCCTGGAGCCCCTGAGCCAGG - Intergenic
1025233311 7:57217389-57217411 GATCATGGAGCCGCAGACCCAGG + Intergenic
1028907925 7:96175596-96175618 CAGGCTGGAGTCGGACAGCCTGG - Intronic
1030399526 7:109031162-109031184 GATCCAGCAGTCCCACTGCCAGG - Intergenic
1030871515 7:114762025-114762047 GATTCTGGAGTCAGACTGCCTGG - Intergenic
1033000688 7:137501384-137501406 GATCCAGGAGTCCCACTGCTGGG - Intronic
1033452534 7:141474537-141474559 GATCATGGAGTCACAGAGACTGG + Exonic
1034235623 7:149566834-149566856 GATTCTGAAGTCAGACAGCCTGG - Intergenic
1034578126 7:152019223-152019245 GATCCTGCAGGAGTACAGCCTGG - Intronic
1034872962 7:154699905-154699927 GGCTCTGGAGTCGGACAGCCTGG + Intronic
1035530503 8:346997-347019 GAGCCTGGAGACGCAGAGCATGG + Intergenic
1035991621 8:4497206-4497228 CATCCAGGAGTAGCACAGTCTGG - Intronic
1036688401 8:10926439-10926461 GATCCTGAAGGCACCCAGCCAGG + Intronic
1037174001 8:15925966-15925988 CCTCCTGGAGTCACAAAGCCTGG + Intergenic
1037885428 8:22593736-22593758 CCTCCTGGATGCGCACAGCCTGG - Exonic
1038696494 8:29811345-29811367 TAGCCTGCAGTCACACAGCCAGG + Intergenic
1039006545 8:33044437-33044459 GATCCTGGAATCAGACAGCCTGG - Intergenic
1040952121 8:52947921-52947943 GAGACTGGAGTTTCACAGCCTGG - Intergenic
1042566795 8:70119573-70119595 GATCCAGGAGTCACACTGCTGGG - Intronic
1042803335 8:72744857-72744879 GATCCTGAGGGCCCACAGCCAGG + Intronic
1045324851 8:101110267-101110289 CAGCCTGGAGTGGCAAAGCCAGG - Intergenic
1046294658 8:112201900-112201922 TCTCCTGGAGTCACAAAGCCTGG + Intergenic
1046941355 8:119934447-119934469 GGCTCTGGAGTCACACAGCCTGG + Intronic
1047059130 8:121203387-121203409 GATCCTGCAGTCCCACTGCCGGG + Intergenic
1047191750 8:122684701-122684723 AATCCTGGAGTCAGACAGCTTGG + Intergenic
1047696398 8:127407584-127407606 GAACCTGGAGTCAGAGAGCCAGG + Intergenic
1048926743 8:139278261-139278283 GGGCCTGGAGATGCACAGCCAGG - Intergenic
1050432422 9:5575112-5575134 GACCCTGGAGACGGAGAGCCTGG - Intergenic
1053299309 9:36937333-36937355 GACTCTGGAGTCGCACTGCTGGG - Intronic
1057701580 9:97366648-97366670 GATCCTGGAGTATCAGAGCCAGG + Exonic
1058033794 9:100228668-100228690 GATTCTGGAGTCAGACTGCCTGG + Intronic
1058485089 9:105435646-105435668 CCTCCTGGAGTCACAAAGCCTGG - Intronic
1059258769 9:112955864-112955886 AATCCTGGACTCTCACAGCTGGG - Intergenic
1060106049 9:120874216-120874238 TCACCTGGAGTCGTACAGCCAGG + Intronic
1060995809 9:127874465-127874487 GATACTGGAGGCTCCCAGCCAGG + Intronic
1061022702 9:128026599-128026621 GAATCTGCAGTCACACAGCCAGG - Intergenic
1062416572 9:136454213-136454235 GGCCCTGGGGTCACACAGCCAGG + Exonic
1062473633 9:136717378-136717400 GACCCTGGAGAGGCAGAGCCAGG + Intronic
1062623940 9:137434619-137434641 GGCCCTGCAGTCACACAGCCTGG + Exonic
1188881425 X:35496770-35496792 CCTCCTGGAGTCACAAAGCCTGG + Intergenic
1190069737 X:47269960-47269982 GATCCTGGAGCCAGACTGCCAGG + Intergenic
1190217142 X:48487490-48487512 ATTCCTGGAGTCACACAGACTGG - Intergenic
1199545235 X:149001923-149001945 TTTCCTGAAGTCACACAGCCAGG + Intergenic