ID: 969199308

View in Genome Browser
Species Human (GRCh38)
Location 4:5589971-5589993
Sequence TAGAGAAAAGAGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1199
Summary {0: 1, 1: 0, 2: 10, 3: 95, 4: 1093}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969199302_969199308 12 Left 969199302 4:5589936-5589958 CCATAAGGGAGGTCTGTATATGG 0: 1
1: 0
2: 1
3: 14
4: 210
Right 969199308 4:5589971-5589993 TAGAGAAAAGAGAAGGTGGAGGG 0: 1
1: 0
2: 10
3: 95
4: 1093

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969199308 Original CRISPR TAGAGAAAAGAGAAGGTGGA GGG Intronic
900623260 1:3596850-3596872 TAGAGCAGAGGGAAGGTGGGAGG + Intronic
900685334 1:3944564-3944586 TAAATAAAAGACAAGGAGGATGG - Intergenic
900732437 1:4271181-4271203 TACAGGAAAGAGAAGGGGCATGG + Intergenic
900738650 1:4316871-4316893 TAGAGAACACAGAAAATGGAGGG + Intergenic
902150524 1:14439227-14439249 AATACAAAAGAGAAGGAGGAAGG - Intergenic
902320341 1:15658947-15658969 TAAAGAAAGGGGAATGTGGAGGG - Intronic
902564943 1:17305310-17305332 TAGGGAAGAGAGAAGGCCGAGGG - Intergenic
902859419 1:19234320-19234342 GAGAGAAGAGAGAGGGTGGGGGG + Intronic
902977553 1:20099880-20099902 AAGACAAAAGAGAAGGATGAGGG - Intergenic
903049217 1:20588596-20588618 TAGGGCAAAGAGAAGTTGGAAGG + Intergenic
903105365 1:21073913-21073935 AAGATATGAGAGAAGGTGGAAGG - Intronic
903768815 1:25751295-25751317 AAGACAGAAGAAAAGGTGGATGG - Intronic
903868131 1:26412751-26412773 TAGAGAAGGGAGATGCTGGATGG + Intronic
903959885 1:27050227-27050249 CAGATACAGGAGAAGGTGGAGGG + Intergenic
904233371 1:29096332-29096354 GAGACAGAAGAGAAGGAGGAGGG + Intronic
904248618 1:29206152-29206174 TGGAGAATAAAGAACGTGGAGGG - Intronic
904308906 1:29612559-29612581 AAGAAGAAAGAGAAGGTGGAAGG - Intergenic
904654710 1:32035863-32035885 TTGAGAAAAGAGGAGTTGTAGGG + Intronic
905069914 1:35216579-35216601 AAGAGAAAAGAGAAAGAGGCGGG - Intergenic
905536000 1:38722332-38722354 TAGGGAGAAGAGGAAGTGGAAGG + Intergenic
905781853 1:40718411-40718433 TATGGAAAAGAGAAGGTAGGAGG - Intronic
905908574 1:41638441-41638463 AAGAGAAAAGAAGAGATGGATGG + Intronic
906232250 1:44173753-44173775 AAGAGAAAATAGAGGGAGGAAGG + Intergenic
906281766 1:44559503-44559525 TATAGAGATGAGAAGGAGGAAGG + Intronic
906580037 1:46928642-46928664 TAGAGAAGAGGGAAGATAGAGGG + Intergenic
906581499 1:46938986-46939008 TAGAGAAAAGAGCAAGTGCCAGG - Intronic
906602219 1:47139909-47139931 TAGAGAAAAGAGCAAGTGCCAGG + Intronic
907664079 1:56418719-56418741 TACAGAAGAGAGATGGTGGATGG - Intergenic
907696529 1:56735703-56735725 GAGAGAGAAGAGAAAGTGAAGGG - Intronic
908295972 1:62713443-62713465 AAGAAGAAAGAGAAGGTGGAAGG - Intergenic
908852042 1:68386489-68386511 TAGAGCAAAGAGCAGGAGGATGG - Intergenic
909539645 1:76776760-76776782 TAGAGATAAAAGAAGGTGGAGGG + Intergenic
909831472 1:80196680-80196702 GTGGGAAAAGGGAAGGTGGATGG + Intergenic
909835385 1:80248224-80248246 AAAGGAAAAGAGAAAGTGGAAGG + Intergenic
909905195 1:81185798-81185820 TGGAGAGAAGTGAAGGTAGAAGG + Intergenic
910024790 1:82637239-82637261 AGGAGAGAAGAGAAGGTGAAAGG + Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910292617 1:85614190-85614212 GAGTGAAAAGGCAAGGTGGAGGG - Intergenic
910668994 1:89754132-89754154 TAGAGGACAGAGAAGGAGAATGG - Intronic
910704237 1:90109869-90109891 AAGAGAAAAGGGCAAGTGGAGGG - Intergenic
911062075 1:93757333-93757355 CAGAGAAAAGAGAAAATGGGGGG - Intronic
911110418 1:94178233-94178255 TATGGAATAGAGAGGGTGGAGGG + Intronic
911798039 1:102098817-102098839 TAAAAAAAAAAAAAGGTGGAAGG + Intergenic
912111199 1:106345298-106345320 GAGAGAATAGAGAAGGAGAAAGG + Intergenic
912323053 1:108732715-108732737 AAGAGAAAAGAGAGGGAGGGAGG - Intronic
912355332 1:109050120-109050142 TCTGGAAAAAAGAAGGTGGAAGG + Intergenic
912761705 1:112373297-112373319 TGGAGACTACAGAAGGTGGAAGG + Intergenic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
913282217 1:117197312-117197334 GAGAGCAATGAGAAGGGGGAGGG - Intronic
913375668 1:118149074-118149096 AGAAGAAAAGAGAAGGTGGGTGG - Intronic
913404810 1:118477840-118477862 CAGAGGAAAGAGAAGATAGATGG - Intergenic
913453700 1:119009395-119009417 TAGAGAAAGGAGAAAGATGAAGG + Intergenic
914213016 1:145598967-145598989 ATGAGAAAAGAGAATTTGGAAGG + Intergenic
914464953 1:147919306-147919328 ATGAGAAAAGAGAATTTGGAAGG + Intergenic
914745333 1:150497286-150497308 AAGAGAAAAAAAAAGGTGGGGGG + Intronic
914803665 1:150977301-150977323 GAGACAAAAGAGAAGGTGGATGG + Intergenic
916206506 1:162320474-162320496 TTGAGAAAAGAGAAGAGGAAGGG + Intronic
916626808 1:166567111-166567133 GGGAAAAGAGAGAAGGTGGAAGG + Intergenic
916658580 1:166900104-166900126 TAGAGAGAAGAGAGGCTGGGAGG - Intergenic
916941083 1:169679225-169679247 TTTAGTAAAGAGAAGGTGGGTGG - Intronic
917304033 1:173608827-173608849 GAGAGAGAAGAGGAGGGGGAGGG + Intergenic
917355107 1:174119344-174119366 TTGGGAAAAGTGAAGGTGAAAGG + Intergenic
918014587 1:180620882-180620904 TAGTTAAAAGAGAAGGAGAATGG + Intergenic
918187211 1:182138670-182138692 TAGGGCACAGAGAAGGTGGCAGG + Intergenic
918346702 1:183613693-183613715 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
918371364 1:183864761-183864783 TAGAGAAAGGAGCAGGTGGATGG + Intronic
918523414 1:185439541-185439563 GAGAGGATAGAGAAGGTGGGGGG + Intergenic
918546210 1:185687452-185687474 GAGAGAAAAGAAAAGGAGGAAGG - Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
918716685 1:187797740-187797762 AAGAGAAAAAAGAGAGTGGAAGG - Intergenic
919140173 1:193560476-193560498 TGGAGAAGAGAGAAAGAGGAGGG - Intergenic
919153154 1:193725571-193725593 ATGAGAGAAGAGAAGGAGGAAGG - Intergenic
919263452 1:195229889-195229911 TTGGAAGAAGAGAAGGTGGAAGG + Intergenic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920097125 1:203493576-203493598 TAGTTCAAAGAGAAGGTGTATGG - Intergenic
920383940 1:205554009-205554031 AAGACAGATGAGAAGGTGGAGGG + Intergenic
920778984 1:208969608-208969630 GATAGCAAAGAGAAGGGGGAGGG + Intergenic
920806531 1:209239580-209239602 AAGAGCAAAGAGACGGTAGAAGG - Intergenic
920829067 1:209449308-209449330 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
920839794 1:209544980-209545002 TACAGGAAAGAGAATGTGGGAGG - Intergenic
920912181 1:210229348-210229370 TAGAGAAGAGACAAGGTGCAAGG + Intergenic
921079462 1:211726974-211726996 TAGAGAAGAATGAATGTGGAGGG + Intergenic
921179652 1:212621990-212622012 TAGAGGAAAGGGAAGGTGGGGGG + Intergenic
921285043 1:213601932-213601954 AAGAGAAAAGAAAAGAAGGAAGG - Intergenic
921480837 1:215662912-215662934 TATAGAAAAGAGATGGGGTAAGG + Intronic
921733404 1:218599561-218599583 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
921953250 1:220955654-220955676 AAGAGAAAAGGGGAGGTAGATGG + Intergenic
922006016 1:221531464-221531486 GAGAGAAGAGAGCAGGGGGAGGG - Intergenic
922031507 1:221804645-221804667 GAGAGAACAGAGAAGGCAGAGGG - Intergenic
922149949 1:222992051-222992073 GAGAGAAAAGAGAAGTTGACTGG + Exonic
922601242 1:226856127-226856149 AAGAGAAAATAGGAGGAGGAAGG - Intergenic
922742078 1:228019708-228019730 TAGAGAATGGAGAGGGTGGTGGG - Intronic
922841526 1:228646847-228646869 GAGAGCAAGGAGAAGATGGATGG + Intergenic
923182547 1:231533969-231533991 TAGAGAGAAAAAAAGCTGGAAGG - Intronic
923409297 1:233691276-233691298 TAAAGAAAAGAGATGGGGGTGGG + Intergenic
923727230 1:236517183-236517205 GAAAGAAAAGAGAAGGCTGAAGG + Intergenic
923771021 1:236937420-236937442 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
923842397 1:237687411-237687433 AAGAGAAAAGGGAAGGGGGAAGG - Intronic
924211748 1:241775890-241775912 TGGAGAAAAGAGAAAGTGAAAGG - Intronic
924264360 1:242266818-242266840 TAGAAAAGAGAGAAGCTGGCCGG + Intronic
924798460 1:247309872-247309894 TCCAGAAGAGAGAAGGCGGAGGG + Intronic
1063164813 10:3451676-3451698 TAGAGGAAAGAGGAGGAGGGAGG - Intergenic
1063202489 10:3797304-3797326 TCTAGAAAACAGAAGGTGGGTGG - Intergenic
1063373260 10:5535690-5535712 GAAAGAAAAGAGAATGTGGAAGG - Intergenic
1064895949 10:20236687-20236709 TTGAAAAAAGAGAAGGTTTATGG - Intronic
1064985172 10:21202759-21202781 AAGAAAAATTAGAAGGTGGAAGG - Intergenic
1064988925 10:21238733-21238755 AAAAAAAAAGAGAAGGTTGAGGG + Intergenic
1065584061 10:27200429-27200451 GAGAGAAAAAAGAAAGTAGAGGG - Intronic
1065667680 10:28080129-28080151 AAGAGAAAAGAAAAGAAGGAAGG + Intronic
1065881126 10:30038743-30038765 GAGAGAAGAGAGAAGCAGGATGG + Intronic
1065952375 10:30663922-30663944 CAGAGAAAAGAGATGAGGGAAGG - Intergenic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066334512 10:34462865-34462887 AAGAGGAAAGAGAAGGGGAAGGG + Intronic
1066720445 10:38331668-38331690 TAGAAAAAAGAGAAGCTGGCTGG - Intergenic
1067176297 10:43950358-43950380 GAGAGAAAAGGGAAGAGGGAAGG - Intergenic
1067204880 10:44204068-44204090 TAAAGAATAGAGATGGTGGCTGG + Intergenic
1067512349 10:46906497-46906519 GAGAGCAAAGAGAAAGAGGATGG + Intergenic
1067649894 10:48145325-48145347 GAGAGCAAAGAGAAAGAGGATGG - Intergenic
1067786665 10:49255204-49255226 TAGAGAAAAGAGAGCAGGGAAGG - Intergenic
1067825763 10:49571777-49571799 TAAAGAAAAATGAAGGTGTAGGG + Intergenic
1068023531 10:51615430-51615452 GAGAGAAAAGAGAAAATGAAAGG - Intronic
1068124135 10:52817258-52817280 TAAAGAAAAGCGAAGTTGTATGG + Intergenic
1068836816 10:61564454-61564476 AAGAAAAAAAAGAAGGGGGACGG + Intergenic
1069612532 10:69784269-69784291 TAAAGAACAGAGAAGTTGGGTGG + Intergenic
1069854375 10:71431739-71431761 GAGAGAATAGAGCAGGGGGAAGG - Intronic
1070141499 10:73741432-73741454 TAGAAAAAAAAAAAGGTGGGGGG + Intergenic
1070219948 10:74430934-74430956 TATAGAAAATAGATGGTGGTTGG + Intronic
1070574435 10:77666878-77666900 AAAAGAAAAGAGATGGTGGGTGG - Intergenic
1070627521 10:78061851-78061873 TAGAGATCTCAGAAGGTGGAGGG - Intergenic
1070727014 10:78799345-78799367 CAGAGGAAAGAAAAGGTAGAAGG - Intergenic
1071372140 10:84963009-84963031 TAGAAAAAACAAAAGGGGGAAGG - Intergenic
1071388925 10:85150379-85150401 TAGGAAAAAGAGGAGGAGGAAGG - Intergenic
1071521387 10:86333203-86333225 GAGAGATAAGAGATGGTGGTGGG - Intronic
1071778094 10:88811577-88811599 TAGAGAATAGAGAAGGATGAAGG - Intronic
1072372900 10:94783395-94783417 GATGGAAAAGAGTAGGTGGATGG + Intronic
1072845398 10:98824933-98824955 TGAATAAAAGAGAAGGAGGAAGG - Intronic
1073108201 10:101045237-101045259 AAGAGACAAGAGAAGAGGGAGGG - Intergenic
1073509804 10:104035667-104035689 GAAAGAAAAGAGATGGTGGCAGG + Intronic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073809010 10:107132150-107132172 GAGAGAAAAGAGAAAGAAGAGGG - Intronic
1073891620 10:108109351-108109373 GAGAGAAAAGAGAAACTGCAGGG - Intergenic
1074284049 10:112081148-112081170 AAGAGAAAAGGAAAGGAGGAAGG + Intergenic
1075334832 10:121601069-121601091 AAGAGAAAGGAGAAGGGGGTGGG + Intergenic
1075338017 10:121622738-121622760 TAGAGAAAGGGGAAGAAGGAGGG - Intergenic
1075877165 10:125817410-125817432 TAGAGAAGGGAGAAGGTAAAAGG - Intronic
1076114608 10:127886585-127886607 GAGAGAAAAGGGCAGGAGGAGGG + Intronic
1076165655 10:128280514-128280536 CAGAGAAGTGAGAAGGTGGGAGG - Intergenic
1076346992 10:129785872-129785894 TTCAGAGAAGAGAAGGCGGAGGG - Intergenic
1077056118 11:594108-594130 AAAAGAAAAAAAAAGGTGGAGGG + Intronic
1077087056 11:758516-758538 AAGAGAAAAAAAAAGATGGAGGG + Intronic
1077279582 11:1736469-1736491 GAGAGAAAAAAGAAGATAGAGGG + Intronic
1077332535 11:1989779-1989801 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1077534685 11:3117972-3117994 AAGAGAAAATAGTAGGAGGAAGG - Intronic
1077838151 11:5943184-5943206 TAGAGAAAATAGAAGGAAAAAGG + Intergenic
1078255626 11:9656101-9656123 AAGAAAAAGGAAAAGGTGGAGGG + Intergenic
1078316153 11:10294473-10294495 AACAGAATAGAGAAGGCGGAAGG - Intergenic
1078468745 11:11570256-11570278 TGGAGAACAGAGCGGGTGGAGGG - Intronic
1078526773 11:12107436-12107458 GAGAGAAAAAAGAAGAAGGAAGG - Intronic
1078688111 11:13551532-13551554 TAGATAAAAGAGGAGGTTGGGGG + Intergenic
1078724694 11:13919510-13919532 TTGAGAAAAGACAGGGTGGAGGG + Intergenic
1079494504 11:21026487-21026509 TATATAAGAGAGAAGGGGGATGG - Intronic
1079526187 11:21391425-21391447 TAAAGAACAGAGAAGATGTAGGG - Intronic
1079639399 11:22785277-22785299 TGGAAAAAAGAGGAGGTGGTAGG - Intronic
1079672874 11:23189219-23189241 TGGAGCAAAGAGCAGGCGGATGG + Intergenic
1079697081 11:23495355-23495377 AAGAAAGAAGAGAAGGAGGAAGG + Intergenic
1079772872 11:24486010-24486032 TAAAGAAAATAGAAGATGAATGG - Intergenic
1079792081 11:24750695-24750717 TAGAGAGAAGAGAAAGTTGAGGG - Intronic
1079940602 11:26675540-26675562 GTGAGAAAAGAGAAGGTCAAAGG + Intronic
1080159778 11:29159912-29159934 AAGAGAAAAGAGGAGGAGGATGG + Intergenic
1080232922 11:30037868-30037890 AAGAGACAAGAGAAGGAGGGAGG + Intergenic
1080411889 11:32032947-32032969 AAAAAAAAAAAGAAGGTGGAGGG - Intronic
1080597975 11:33792486-33792508 CAGAGGAAAGAGAACGTGAAAGG + Intergenic
1080816557 11:35763351-35763373 GAGAGAAGAGAACAGGTGGAGGG + Intronic
1081492001 11:43576548-43576570 GGGAGGAAAGAGAAAGTGGATGG - Intronic
1081659487 11:44879267-44879289 TAGGGAAAGAAGAAGGAGGAAGG - Intronic
1082030634 11:47600881-47600903 AAAAAAAAAAAGAAGGTGGAGGG + Intergenic
1082199652 11:49349837-49349859 GAGAGAAAATAGGAGGGGGAGGG - Intergenic
1082271903 11:50181322-50181344 TAGAGAAAACTGAAGGAGAAGGG - Intergenic
1082739480 11:56894731-56894753 AAGAGAAAAGAGAAAGCAGAGGG + Intergenic
1083402450 11:62433304-62433326 AAGAGGAAAGAGAAAGGGGAGGG + Intergenic
1083659133 11:64244194-64244216 TCGGGAAAGGAGAAGGTGGTGGG - Intergenic
1084018770 11:66404378-66404400 GAAGGCAAAGAGAAGGTGGAGGG + Intergenic
1084299201 11:68235309-68235331 AAAAGAAAAATGAAGGTGGAAGG + Intergenic
1084347671 11:68566313-68566335 AGGAGGAAAGAGAAGGAGGAAGG - Intronic
1084365359 11:68694010-68694032 TAGAGCAAGTAGGAGGTGGACGG - Intergenic
1084467118 11:69330550-69330572 GAAAGAAAAAAGAAGGAGGAGGG - Intronic
1084583413 11:70038908-70038930 GAGAGAAAATAGAAGGGGGAAGG + Intergenic
1084915222 11:72423900-72423922 TAGAGGGAACAGCAGGTGGAAGG - Intronic
1085555319 11:77414178-77414200 TGGAGAAGAGAAAAAGTGGAGGG - Intronic
1085645389 11:78219164-78219186 CAGAGTAGAGAGGAGGTGGATGG + Exonic
1085937323 11:81163868-81163890 AAGAGAAAAGGGAAGATGGATGG + Intergenic
1086047293 11:82547878-82547900 AAGAGAAAAAAGAAAGAGGAGGG + Intergenic
1086105633 11:83144149-83144171 TAGGGAAATGAGAAAGTGAAAGG + Intergenic
1086116446 11:83256546-83256568 AAGAGAAAAGAGAGGGGGGTAGG - Intronic
1086125542 11:83345113-83345135 TGGAGCAAAGAGCAGGAGGATGG + Intergenic
1086219009 11:84419113-84419135 TACAGAAAAGAGAAGGCGAGAGG + Intronic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086656015 11:89356393-89356415 GAGAGAAAATAGGAGGGGGAGGG + Intronic
1087019044 11:93584173-93584195 TGCAGAAATGAGAAGGTAGAGGG + Intergenic
1087028369 11:93675009-93675031 TACAGGAAAGGGAAGGGGGAAGG + Intronic
1087655874 11:100922329-100922351 TACAGAAAAGAACAGGTGGCTGG + Intronic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1087815875 11:102658147-102658169 TAGGGAAGAAAGGAGGTGGAGGG + Intergenic
1087940669 11:104093231-104093253 TAGAGAAAAGTGATGGGGGGAGG + Intronic
1088620558 11:111678065-111678087 TAAAGAACAGGGAAGGAGGAAGG - Intronic
1088713596 11:112529398-112529420 TAGAGAAAAAAGAAGGGGAAAGG + Intergenic
1088838700 11:113603746-113603768 GAAAGAAAGGAGAAGCTGGAAGG + Intergenic
1089303299 11:117511652-117511674 CAGAGAGGAGAGAGGGTGGAGGG - Intronic
1089445068 11:118545433-118545455 GAGGGAAAAGAGCAGATGGAGGG + Exonic
1090341675 11:126027732-126027754 GAAAGAAAAGATAAGGAGGATGG - Intronic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1090858065 11:130628740-130628762 AAGAGCAAAGAGAAGCTTGAGGG + Intergenic
1090936076 11:131343748-131343770 CTGAGTAAAGAGAAGTTGGAAGG + Intergenic
1091038602 11:132256020-132256042 GATAGAGAAGAGAAGGTGGGAGG - Intronic
1091117845 11:133031356-133031378 TAGATGAATGAGTAGGTGGATGG + Intronic
1091142592 11:133248638-133248660 TGGAGAAAGGACAAGGTGGTAGG + Intronic
1091345974 11:134854398-134854420 CACAGAAAAGAGGAGGTGGCTGG + Intergenic
1202815516 11_KI270721v1_random:44955-44977 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1091662521 12:2395185-2395207 TAGAGAAAAGAAAAGAAGGCTGG - Intronic
1091760865 12:3086387-3086409 GAGAGAAAACAGAGGGCGGAAGG - Intronic
1091954319 12:4625741-4625763 GAGAGAGAAGAGAAGGTTGTAGG + Intronic
1092071668 12:5636554-5636576 GAGAGAAAACAGCAGGTGGAAGG + Intronic
1092097220 12:5852910-5852932 GAGAGAGAAGAGGGGGTGGAGGG + Intronic
1092315224 12:7405280-7405302 GAGAGATGAGAGAAGGGGGAAGG - Intronic
1092322095 12:7487082-7487104 GAGAGAGAGGGGAAGGTGGATGG + Intronic
1092338030 12:7651317-7651339 TAGAGAAAAGAGTTGTTGGCTGG + Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1092520307 12:9265838-9265860 TAAAGAAAAGAGAATGTGGATGG - Intergenic
1092714368 12:11373293-11373315 AAGAGAAATGAGCAGGAGGAAGG + Intronic
1092830714 12:12441871-12441893 TTGAGAAATGTGAAGCTGGATGG + Intronic
1093139706 12:15494805-15494827 TACTGAAAAGAGAAGTTAGAAGG - Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093318288 12:17678938-17678960 AAAAGAAAAGAGAAGGAGGGAGG + Intergenic
1093573397 12:20695624-20695646 TAGGGAAAAGAAAAGATGAAGGG - Intronic
1093578437 12:20763410-20763432 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1093667133 12:21827994-21828016 AACAGAAAAGAGAAGGAAGATGG - Intronic
1093841254 12:23904234-23904256 TAGAGAAAAGAGAAGAAAAATGG - Intronic
1093894921 12:24563916-24563938 TCCAGAAAAGAGCAGGGGGAAGG + Intergenic
1094269026 12:28590783-28590805 TAGAGAAAATACAAGGGTGAGGG - Intergenic
1094329422 12:29275004-29275026 TGGAGCAAAGAGCAGGAGGACGG - Intronic
1094383174 12:29865755-29865777 CAGAGAAAAGAGCAGATGCAAGG + Intergenic
1095240744 12:39856190-39856212 TATTGATAAGAGAAGGTAGATGG - Intronic
1095383335 12:41620430-41620452 TAGAAAACAGGGAAGGTGAAAGG + Intergenic
1095617603 12:44210600-44210622 TAAGTAAAAGAGAAGGTAGAAGG + Intronic
1095921617 12:47537376-47537398 TAGAGAAAAGAGTAGACAGAAGG + Intergenic
1096847719 12:54417347-54417369 TAGAAAAGAGGGAAGGAGGAAGG - Intronic
1097156366 12:57015132-57015154 GGGAGAAAAGAGAAGAAGGAAGG + Intronic
1097204005 12:57304555-57304577 TGGAGAACTGGGAAGGTGGATGG + Intronic
1097245618 12:57606089-57606111 CAGAGAAGAGAGGAGATGGAAGG + Intronic
1098028374 12:66230006-66230028 GAAAGAAAAGAGAAGGTGTTGGG + Intronic
1098364517 12:69688730-69688752 CAGAAGAAAGAGAAGCTGGAGGG + Intronic
1098504854 12:71237612-71237634 TAGAAAAAAGAGGAGGAGGAGGG - Intronic
1099580705 12:84443833-84443855 TAGAAAAAGGAGCAGGTGAAAGG - Intergenic
1099675833 12:85759490-85759512 AAGAGAAAAGAAAAGGAAGAGGG + Intergenic
1100490341 12:95072840-95072862 GAGAGAAAAGTGAAAGTGGGGGG + Intronic
1100556145 12:95695918-95695940 AAGAGAAAAGAAAAGAGGGAGGG - Intronic
1101300443 12:103474228-103474250 TAAAGAGAAGAGAAAGTGAAGGG + Intronic
1101385441 12:104253213-104253235 TAAAGAAAAAGGAAGGTGGGCGG + Intronic
1101472067 12:105007104-105007126 TAGAGCAAAGGGAAAGTGAAGGG - Intronic
1101696904 12:107135266-107135288 GAGAGAAATGAGAAGGTTTATGG + Intergenic
1101699387 12:107157733-107157755 GAGAGAGAAGAGAAAGTGTAGGG - Intergenic
1101730363 12:107422052-107422074 TAGAGAAAAGAAAGGCTGGGAGG + Intronic
1101765169 12:107691278-107691300 TGAAGCACAGAGAAGGTGGATGG + Intronic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102402351 12:112640450-112640472 TGGGGAAAAGAGAGGGTGAAAGG - Intronic
1102552507 12:113702094-113702116 GAGAGAAAAGGGAAGGAGAAAGG - Intergenic
1102739154 12:115190986-115191008 TAGAGAAAATATTAAGTGGAAGG - Intergenic
1102741063 12:115207926-115207948 GAGAGAAGAGGGGAGGTGGAGGG - Intergenic
1102748603 12:115272158-115272180 GAAAGAAAAGAGAAAGAGGAAGG + Intergenic
1102792799 12:115661380-115661402 TAGAGGAAAGAGTAGCTGGAAGG + Intergenic
1102988610 12:117298636-117298658 TAGAGAAAAGAGAAATTTGAAGG + Intronic
1103032945 12:117632520-117632542 TAGAAAAAGGAGTAGGTGGCAGG - Intronic
1103162840 12:118744492-118744514 GAGAGAAAAGAGAAAGAGGAAGG + Intergenic
1103480106 12:121245248-121245270 GGGAGAAAAGAGGAGGTGGCAGG + Intronic
1104520898 12:129474056-129474078 TACAGAAAGGAGCAGGTGAAAGG - Intronic
1105299841 13:19123302-19123324 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
1105446518 13:20462032-20462054 TGGAGAGAAGAGAGGGTGGGAGG + Intronic
1105896236 13:24719061-24719083 TGCTGAAAAGCGAAGGTGGAGGG - Intergenic
1106275825 13:28205364-28205386 TAGAGAGAAGAGGAGGTCCAGGG - Intronic
1106906538 13:34415426-34415448 CAGAGAAAAGAAAGGTTGGAGGG + Intergenic
1106925083 13:34605437-34605459 TTGAGAAAACAGAAGCAGGAAGG + Intergenic
1106943183 13:34799408-34799430 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1107345160 13:39452423-39452445 TAGAGAAGAGAAAGGGAGGAGGG + Intronic
1107378717 13:39832691-39832713 TAGTGAAAAGGCCAGGTGGATGG - Intergenic
1107584565 13:41830891-41830913 AAAAGAAAAGAGGAGGAGGAAGG + Intronic
1107831230 13:44374750-44374772 AAGAGAAAAAAGAGGCTGGAGGG - Intronic
1107895828 13:44961781-44961803 AAGAGAAAAGATAACGGGGAAGG - Intronic
1108041123 13:46340089-46340111 GAGAGAAGAGAGAAGATGCAGGG - Intergenic
1108118109 13:47152450-47152472 TAGAGAATAGAGAAAATTGAAGG - Intergenic
1108163943 13:47672308-47672330 TAGAGTAAAAACAAGGTGAAAGG + Intergenic
1108983640 13:56554499-56554521 AAGAAAAATAAGAAGGTGGAGGG + Intergenic
1109000004 13:56788142-56788164 TGGAGAAAAAAGACGGCGGAGGG - Intergenic
1109750189 13:66681788-66681810 AATAGAGAACAGAAGGTGGATGG - Intronic
1110076087 13:71244913-71244935 TAAGGAAAAGAAAAGGAGGAAGG - Intergenic
1110638841 13:77798256-77798278 TAGAGAATAGAGAAGCTACATGG - Intergenic
1111475030 13:88734775-88734797 TAGAGAATAGAAAAGGTACAGGG + Intergenic
1111793389 13:92887183-92887205 TAGATACATGAGAAGGTGCATGG - Intergenic
1112221784 13:97498424-97498446 AATAGAAAGGAGAAGGAGGATGG - Intergenic
1112355499 13:98671664-98671686 GAGAGAACAGAGGAAGTGGAAGG + Intergenic
1112542149 13:100325307-100325329 TAAAGCAAAAGGAAGGTGGAAGG + Intronic
1113323970 13:109265571-109265593 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1113436746 13:110298604-110298626 TAGAGATAAAAGACGGTTGAAGG - Intronic
1113904634 13:113813471-113813493 GAGAAAAAAGATAAGGTGGAGGG + Exonic
1114598547 14:23935006-23935028 AAGAGAAAGGAGAAGGTGCCAGG + Intergenic
1115240921 14:31250598-31250620 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1115661375 14:35497817-35497839 AAGACAAAAAACAAGGTGGAAGG + Intergenic
1115663546 14:35522451-35522473 TTAAGAAAAGAGAATTTGGAAGG + Intergenic
1115937355 14:38567993-38568015 TAGAGAGAAGAGGAGATTGATGG - Intergenic
1116319002 14:43435653-43435675 TAGGGAAAAGGGAAGGGTGAGGG + Intergenic
1116374968 14:44187421-44187443 TAGAGGAAAGAAATGGGGGAGGG - Intergenic
1116952614 14:50893662-50893684 TGGAGCAAAGAGCAGGAGGATGG - Intronic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117557498 14:56901026-56901048 AAGAAAAAAGAGAAGCTGAAGGG + Intergenic
1117923532 14:60751087-60751109 AAAAAAAAAAAGAAGGTGGAGGG - Intronic
1118089908 14:62462521-62462543 TACAGAGAAAAGAAGGTCGATGG - Intergenic
1118139261 14:63062293-63062315 TAGACAAAAGAGAATGCAGAGGG - Intronic
1118238525 14:64034779-64034801 TATAGAAAGGAGGAGATGGAAGG - Intronic
1118687835 14:68309483-68309505 TAGAGAAAAGTGAAGGGCAAAGG + Intronic
1118779270 14:68995791-68995813 TAGAGGAAAGAGAATTGGGAGGG - Intergenic
1119147200 14:72328129-72328151 TAGAACAAAAAGAAGGAGGAGGG - Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119476773 14:74934977-74934999 CAGAGAAGAGAGAAGGAGAAGGG + Intergenic
1119535564 14:75400168-75400190 TAGAGGCAAAAGAAGGGGGAAGG - Intergenic
1119935150 14:78585506-78585528 TAGGGACAAGGGAGGGTGGAGGG + Intronic
1119938591 14:78616452-78616474 AAGAGGAAAGAGAAAGTAGAAGG - Intronic
1119956238 14:78801466-78801488 GAGAGAAAAGAGCATGTGAAGGG + Intronic
1120763329 14:88305753-88305775 TAGAGAAAAGAGAAAGGGCTGGG + Intronic
1120867533 14:89308755-89308777 TAGAGAAAGGAGAAGCTGCTAGG + Intronic
1120871383 14:89340082-89340104 GAGAGGAAAGAGAAGAAGGAAGG + Intronic
1120897629 14:89547990-89548012 GAGAGAAAGTAGGAGGTGGAAGG + Intronic
1121057629 14:90873036-90873058 TTGAGAAAGGAGAAGGTATAGGG - Intronic
1121186821 14:91979980-91980002 TAAAAAAAAAAAAAGGTGGAGGG + Intronic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121517840 14:94565111-94565133 TAGAGGAAAGAAGAGTTGGAAGG + Intronic
1121706684 14:96001704-96001726 GAGAGCAAAGAGAAGCAGGATGG + Intergenic
1121760006 14:96436772-96436794 CAGAGAGAAGGGAAGGAGGAGGG - Intronic
1121811434 14:96894537-96894559 CACAGAACAGAGAAGCTGGAGGG - Intronic
1121950043 14:98163687-98163709 TAGAGAAGAAAGTAGGAGGATGG - Intergenic
1122198768 14:100109209-100109231 GAAGGACAAGAGAAGGTGGATGG - Intronic
1122362252 14:101174407-101174429 TGGAAAAAAGTGAAGTTGGAGGG - Intergenic
1122392789 14:101401803-101401825 AAGAGGAAAGAGAAGGAGAAGGG - Intergenic
1122441788 14:101737033-101737055 CAGAGAAAATAGAAGGCAGAAGG - Intergenic
1124085076 15:26542003-26542025 TACAGCAAACAGAAGGTGGGAGG + Intergenic
1124090753 15:26597899-26597921 TAGGGAAAAGAGAAAGTAGAAGG + Intronic
1124477801 15:30050417-30050439 TGGATAGGAGAGAAGGTGGAAGG + Intergenic
1124695381 15:31860079-31860101 GATAGAAAAGAGAAAATGGAAGG - Intronic
1125371747 15:38985137-38985159 TATAGAAAAATGAAGGTGGGAGG - Intergenic
1125872597 15:43115587-43115609 GAGAGAAAATAGAAAGGGGAAGG + Intronic
1125891060 15:43267605-43267627 GGGAGAAAAGCGCAGGTGGAAGG + Intergenic
1126357577 15:47812613-47812635 AAGAGAACTGAGAAGGGGGATGG + Intergenic
1126406211 15:48325311-48325333 AGGGGAAAAGAGTAGGTGGAGGG - Intergenic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127052391 15:55098246-55098268 TAGAGAAAAGCAGAAGTGGAGGG - Intergenic
1127166403 15:56248139-56248161 TAGAGAGAAGAGGATGTGGGAGG + Intronic
1127399492 15:58572313-58572335 GGGAGAAAAGAAAAGGAGGAAGG - Intergenic
1127425058 15:58847924-58847946 TAGAGGAGAGAGAATCTGGAAGG + Intronic
1127543919 15:59971761-59971783 GAGATAACAGAGAAGATGGAGGG + Intergenic
1127623739 15:60759756-60759778 TTGGGAAAAGAGTAGGTAGAAGG - Intronic
1127852137 15:62923163-62923185 TAGAGAATAAACAAAGTGGAAGG - Intergenic
1127976790 15:64003587-64003609 TAAAGAAAAGAAAAGAAGGAAGG - Intronic
1128398483 15:67253448-67253470 GAGAGAAAAGAGAAAGTGAAGGG + Intronic
1128609128 15:69059846-69059868 AAGAGAAGAGAGAAGGAGCAAGG + Intronic
1129153120 15:73701567-73701589 TAGAGGAAACAGCAGGTGGAAGG - Intronic
1129167831 15:73788772-73788794 TGGAGTATAGAGAAGGTGGCAGG + Intergenic
1129281486 15:74488582-74488604 GAAAGAAAAGAAAAGGTGTAGGG + Intergenic
1130141969 15:81235166-81235188 CAGAGAAAAGATAAGGTTGGGGG + Intronic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1130271294 15:82450304-82450326 TAGAGAAGGAAGAAAGTGGAGGG + Intergenic
1130303932 15:82700258-82700280 TAGAGATAAGAGAAGGTTGATGG - Intronic
1130424969 15:83787826-83787848 TTGAGAAAGGAGAAAGAGGAGGG - Intronic
1130489040 15:84417143-84417165 TAGAGAAGGAAGAAAGTGGAGGG - Intergenic
1131004960 15:88970355-88970377 TATAGAAAAGAGAAAGAGAATGG - Intergenic
1131418776 15:92285787-92285809 TAGATGGGAGAGAAGGTGGATGG - Intergenic
1131534631 15:93225770-93225792 TACTGAAAAGAGAAGAAGGAGGG - Intergenic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1131951218 15:97683701-97683723 AAAAAAAAAGAGAAGGGGGAGGG + Intergenic
1132007280 15:98239757-98239779 CAGAGAACAGAGAATGTTGAGGG + Intergenic
1132647310 16:1004997-1005019 GAGGGAGAAGAGAAGGGGGAGGG + Intergenic
1133080315 16:3313684-3313706 TATAGAAAACAGACTGTGGAAGG - Intronic
1133702364 16:8320836-8320858 TAGAACAAAAAGATGGTGGAAGG + Intergenic
1134095182 16:11414294-11414316 CAGAGAGAACAGAATGTGGAGGG + Intronic
1134488943 16:14681180-14681202 AAAAGAAAAGAAAAGGGGGAGGG + Intronic
1134766880 16:16767023-16767045 TAGATAGATGAGTAGGTGGATGG - Intergenic
1135282591 16:21165557-21165579 GAGAGGGAAGAGAAGGGGGAGGG - Intronic
1135770301 16:25213156-25213178 TGGGAAAAAGAGAATGTGGAGGG - Intergenic
1135794842 16:25431966-25431988 TAGAGAAAAGGAAAGAAGGAAGG - Intergenic
1135816918 16:25643116-25643138 TAGAGAGATGATAAGGTGCAAGG - Intergenic
1136004904 16:27322729-27322751 ATTAGAAGAGAGAAGGTGGATGG - Intronic
1137348262 16:47685097-47685119 TAGGGAAAGGAAAAGATGGATGG - Intronic
1137507376 16:49065878-49065900 TAGAAAAAAGAGCAGGTGGAAGG - Intergenic
1137922564 16:52505218-52505240 TAGTGAAATGAGAAGGTTCAGGG - Intronic
1138617143 16:58177768-58177790 TAGAGAGAAGAAAAAGTGGTGGG + Intronic
1139003524 16:62542779-62542801 CAGAGAAAGGTGAAGGTGAAAGG + Intergenic
1139018301 16:62716888-62716910 AAGAGAAAAGAAAAGATGGAAGG - Intergenic
1139191880 16:64873671-64873693 TAGAGTCAAGAGAATGAGGATGG + Intergenic
1139320419 16:66109730-66109752 AAGGGAAGAGGGAAGGTGGAAGG + Intergenic
1139752137 16:69115324-69115346 AAGAGAAAAGACAGGGTGGGAGG + Exonic
1139776437 16:69319704-69319726 CAAAGACAAGTGAAGGTGGAAGG + Intronic
1140235908 16:73158449-73158471 AAGAGAAAAGAGAAGGGAGGGGG - Intergenic
1140462802 16:75154626-75154648 GAAAGAAAAGAGAAGGCAGAAGG + Intronic
1140567658 16:76063281-76063303 TTGAGAAAAGAAAAGATGTATGG + Intergenic
1140584874 16:76277480-76277502 GAGAGAGAAGAGAGGGAGGAGGG + Intronic
1140718686 16:77750657-77750679 TATAGAAGAGAGATGGTGCAGGG - Intergenic
1140879572 16:79185713-79185735 TTGAGAGCAGAGAAGGTGGCAGG + Intronic
1140904452 16:79398487-79398509 AAGAGGAATGAGAAGATGGAGGG + Intergenic
1141024916 16:80537445-80537467 TAGAGAAAAGATGAGAAGGAGGG + Intergenic
1141065878 16:80913266-80913288 GATGGAAAAGAGCAGGTGGATGG + Intergenic
1141156478 16:81600907-81600929 AGGAGAAACGAGAAGTTGGATGG - Intronic
1141236750 16:82225491-82225513 TAGAAAGATGATAAGGTGGATGG + Intergenic
1141237648 16:82233568-82233590 TAGAGAAGACAGAAAGTGGAAGG - Intergenic
1141308092 16:82885599-82885621 TAGATAGAAGAAAAGGTAGAAGG - Intronic
1141355193 16:83339000-83339022 TATAGAAAACAGATGGTGGCAGG + Intronic
1141736823 16:85859673-85859695 GAAGCAAAAGAGAAGGTGGATGG - Intergenic
1141992425 16:87618218-87618240 TAAAGAAAACAGAAAGTGGGAGG + Intronic
1142062980 16:88042565-88042587 GAGAGGGAAGAGAAGGTGAAGGG + Intronic
1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG + Exonic
1142740857 17:1931243-1931265 TAGAGGAAAGTGAAGTTAGAGGG + Intergenic
1143240512 17:5439430-5439452 TAGAGGAAAGTGACCGTGGAAGG - Intronic
1143614744 17:8043023-8043045 GAGACAAAAGAGAATATGGACGG + Intronic
1144104331 17:11972239-11972261 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1144104401 17:11972676-11972698 TAGAGACAAGAGAAGGGGTTGGG - Intergenic
1145262420 17:21362432-21362454 CAGATAAAGGAGAAGATGGATGG + Intergenic
1145956787 17:28860271-28860293 TAAAAAAAAGAGAGGGTGGCCGG - Intronic
1145990371 17:29075713-29075735 GAAAGAAAAGAGAAGGTGAATGG - Exonic
1146049983 17:29542219-29542241 TAGAGACTACAGAAGGTGGGAGG + Intronic
1146078582 17:29756486-29756508 TAGATAAGAGAGAGGATGGATGG - Intronic
1146202875 17:30875426-30875448 TAAAGAAAGAAGAGGGTGGAGGG - Intronic
1146320553 17:31843286-31843308 TGGAGGGAAGAGAAGTTGGAGGG - Intergenic
1146493867 17:33303204-33303226 AAGAGAAAAGACAAAGTGGGTGG + Intronic
1146803660 17:35847866-35847888 TAGGGAAAGGCGAATGTGGAGGG + Intronic
1146947232 17:36882155-36882177 GAGACAAAAGAGCAGGTGGAGGG - Intergenic
1147387477 17:40090829-40090851 TAGAGAAAAGAAGAGGGGAAGGG - Intronic
1147508852 17:41047902-41047924 TAGAGAAAAGAAAACATGCAAGG - Intergenic
1147976128 17:44249156-44249178 TAGAAAAGAGAGGAGGTGGCTGG - Exonic
1148041995 17:44715114-44715136 AAGAGAAAAGAGAAAATAGAAGG - Intronic
1148118443 17:45192425-45192447 AAGAAAAAAGAAAAGGAGGAAGG - Intergenic
1148282641 17:46361155-46361177 AAGAGGAAAGAGAAGGGAGAGGG - Intronic
1148304859 17:46579080-46579102 AAGAGGAAAGAGAAGGGAGAGGG - Intronic
1148837070 17:50470917-50470939 AAAAGAAAAGGGAAAGTGGAGGG - Intronic
1149370424 17:55988693-55988715 TAGAGGAAAGAGTATGTGCAGGG + Intergenic
1149381461 17:56098183-56098205 TAGAGCCTAGAGAAGGAGGATGG + Intergenic
1149928764 17:60728200-60728222 TAGAGAACAGAGGATGTGTAGGG - Intronic
1150235957 17:63592902-63592924 AAGAGAAAAGAGAAAAAGGAGGG - Exonic
1150342984 17:64383786-64383808 TAGAAAAACAAGATGGTGGACGG - Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150707082 17:67496756-67496778 AATAGAAATGAGAAGGTTGAGGG + Intronic
1151006960 17:70448959-70448981 AAGAGAAGAGAGATGGTGCAGGG + Intergenic
1151416413 17:73968875-73968897 TACAGAGAAGAGAGGCTGGAGGG - Intergenic
1151455688 17:74224529-74224551 TAGGGAAAACTCAAGGTGGAAGG + Intronic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1151772790 17:76176372-76176394 GAGATAACAGAGAAGATGGAGGG + Intronic
1151872296 17:76844592-76844614 TGGGGAAGAGAGAAGGGGGACGG + Intergenic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1152316812 17:79585808-79585830 GAGAGACAAGAGAAAGTGAAAGG + Intergenic
1152336731 17:79703140-79703162 TAGAGGGAGGAGAAGGGGGAGGG - Intergenic
1152928375 17:83098228-83098250 GAGGGAAAAGGGCAGGTGGAGGG - Intergenic
1153268338 18:3294477-3294499 GAGAGAGAATAAAAGGTGGAGGG + Intergenic
1153394148 18:4598814-4598836 TAGAGAACAGAAATGGAGGATGG + Intergenic
1153752664 18:8249203-8249225 TAGAGAAAAGAGAAGCAGAGGGG - Intronic
1154172926 18:12063780-12063802 TAGAGAAGGGAGCAGGTGGCCGG + Intergenic
1154989182 18:21583997-21584019 GAGAAAAAGGAGATGGTGGAAGG + Intronic
1155326163 18:24666963-24666985 GAGAGGAAAGAGAAAGGGGAAGG - Intergenic
1155377427 18:25175576-25175598 TTGAGAATAGAAAACGTGGATGG + Intronic
1155697326 18:28698377-28698399 TGGAGTAAAGAGCAGGAGGACGG + Intergenic
1156472271 18:37384661-37384683 CAGAGCAAAGTGAAGGTGGTAGG + Intronic
1156967555 18:43113666-43113688 TGGAGAAAAGAGATTTTGGACGG - Intronic
1157052784 18:44187754-44187776 AAGAGAAAACAGAAGGTTTAGGG + Intergenic
1157945314 18:51972859-51972881 CAGAGAAAAGAGTAGGTATAAGG + Intergenic
1158425771 18:57338578-57338600 GAGAGAGAAGGGAAGGTGGAGGG - Intergenic
1158610152 18:58932456-58932478 TAGATAAAAGAGAAGCAGCAGGG + Intronic
1158684162 18:59598017-59598039 GACAGAAAAGAGAAAGTGTAGGG + Intronic
1159162697 18:64663679-64663701 TAGAGAAAAGGGAAAATTGAAGG + Intergenic
1159177455 18:64856442-64856464 GAAAGAAAAGAGAAGGCAGAAGG + Intergenic
1159200331 18:65175160-65175182 AGGAGAAAAGAGAAAGTGCAGGG - Intergenic
1159201260 18:65188067-65188089 TAAATAAAAGAGAAAGTAGAGGG - Intergenic
1159544966 18:69828911-69828933 TAGAGAAAGGAGAGAGTGAAGGG + Intronic
1159616476 18:70585788-70585810 CAGAGAAGAGAGAAAGTGAAAGG + Intergenic
1159686487 18:71427682-71427704 CACAGAAGAGAGAAGCTGGAAGG + Intergenic
1159940383 18:74402489-74402511 AAGAGAAGAAAGAAGGGGGAAGG + Intergenic
1160001878 18:75032496-75032518 GAGAGAAGAGAGAAGGTTGGTGG - Intronic
1160616336 18:80132583-80132605 AAGAGAAAAGAGAGGAAGGAAGG - Intronic
1161171609 19:2815085-2815107 TTCAGAAAAGAAAAGCTGGAAGG + Exonic
1161377518 19:3947525-3947547 GAGAGAAAAGAGAGGAAGGAAGG - Intergenic
1161861495 19:6801616-6801638 TAGAAAAAAGGGTGGGTGGAGGG - Intronic
1162159840 19:8703630-8703652 TAGACAAAACAGTAGCTGGAAGG - Intergenic
1162232895 19:9282385-9282407 TAGGGAAAAGAGATGATTGAGGG - Intergenic
1162522056 19:11186963-11186985 TAGAGAAGAGGGTAGGTGGGTGG + Intronic
1163041862 19:14608595-14608617 GAGAAAAAAGGGAGGGTGGAAGG + Intronic
1163043098 19:14617214-14617236 AAGAGAAAAGAAAAGAAGGAAGG - Intergenic
1163345779 19:16741159-16741181 TCAAGAAAAGAAAAGGGGGAGGG + Intronic
1164211940 19:23106207-23106229 AAGAAAAAAGAGGAGGAGGAAGG + Intronic
1164441704 19:28284492-28284514 AAGGGGAAAGAGGAGGTGGAGGG + Intergenic
1164441740 19:28284638-28284660 TAGAGGGAAAAGAGGGTGGAGGG + Intergenic
1164533366 19:29064860-29064882 TAGAAAAATGGGAAGGTTGAGGG + Intergenic
1164840860 19:31391192-31391214 TAGAGAAAAGCCAGGGTGGGAGG + Intergenic
1164937041 19:32223150-32223172 AAGAGAAAAGAGGAGGAGAAAGG + Intergenic
1164937051 19:32223225-32223247 GAGAGAAAAGAGGGGGAGGAAGG + Intergenic
1165844277 19:38808296-38808318 GAGAGAACAGAGAAAGAGGAAGG + Intronic
1166048711 19:40245236-40245258 AAGAGAAAAAGGAAGGTGCAGGG + Intronic
1166091410 19:40511825-40511847 TTAAGAAAAGAGAAGTTGGCCGG + Intronic
1166121937 19:40691512-40691534 CAGAGAAAAGAGCTGGGGGAAGG + Exonic
1166391260 19:42410163-42410185 TACAGAAAGGAGAAGTTGGCTGG - Intronic
1166501644 19:43345752-43345774 GAGAAAAAAGAGGCGGTGGAGGG + Intergenic
1166553924 19:43685563-43685585 TAAAGATCAGAGAAGCTGGATGG + Intergenic
1166921059 19:46229534-46229556 CATAGCACAGAGAAGGTGGAGGG + Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167161995 19:47774077-47774099 GAGAGAAAAGGGGAGGGGGATGG + Intergenic
1167212015 19:48139384-48139406 TAGAGAAGAGAGAAGAGGGCAGG - Intronic
1167390966 19:49194696-49194718 GAAAGAAAAGAGAGGGAGGAAGG - Intronic
1167696108 19:51016373-51016395 AAGAGAAAAGAAAATGTGGAAGG - Intronic
1167839848 19:52106778-52106800 AAGAGAAAATAGCAGGAGGAAGG - Intergenic
1168138665 19:54369517-54369539 TAGAGGAATGCAAAGGTGGAGGG - Intronic
1168159411 19:54499266-54499288 TAGAGGAATGCAAAGGTGGAGGG + Intronic
1168268263 19:55235299-55235321 TAGAGAAGAGAGAAGCTGCCTGG + Intronic
1168433809 19:56302326-56302348 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
1168592897 19:57651782-57651804 GAGAGAAAAGGGAAAGTGGTAGG - Intergenic
925055428 2:853525-853547 GAGAGAGAAGAGAAGGGTGAAGG - Intergenic
925056865 2:863070-863092 GGAAGGAAAGAGAAGGTGGAGGG - Intergenic
925383747 2:3447464-3447486 GAGAGAGAAGAGGAGGAGGAGGG + Intronic
925748202 2:7062877-7062899 TAGAGAAAGGAGAGGATTGATGG - Intronic
926053373 2:9758671-9758693 AAGAGCAAAGAGAAGGTTGTAGG + Intergenic
926055303 2:9770853-9770875 GAGAGAACAGGGAAGGCGGAGGG - Intergenic
926773951 2:16403862-16403884 GGGTGGAAAGAGAAGGTGGATGG - Intergenic
926800787 2:16658716-16658738 AAGAGAAAAGGAAGGGTGGAAGG - Intronic
926965231 2:18402343-18402365 TGGAGAAAAGAGAAAGGAGAGGG - Intergenic
927073110 2:19550076-19550098 TAGAGGAGGGACAAGGTGGAAGG - Intergenic
927476421 2:23417702-23417724 CAGAGAAAAGTGAGGCTGGAGGG - Intronic
927956238 2:27209207-27209229 TGGAGAACAGACAGGGTGGATGG - Intronic
928136598 2:28692650-28692672 AAGAGAATAGAGACAGTGGAAGG - Intergenic
928220358 2:29398190-29398212 GAGAGAAATGAGAAGATGGGAGG - Intronic
928252891 2:29697344-29697366 GAGAGAAAAGAGAGGCAGGAAGG + Intronic
928309167 2:30195416-30195438 TGGAGAACAGAGAAGATGGCTGG + Intergenic
928320688 2:30280833-30280855 AAGAGAAAACAGCACGTGGATGG - Intronic
928323028 2:30298449-30298471 TAAAGAAAGGGGAAGGAGGATGG + Intronic
928997935 2:37315597-37315619 CAGAGAAAACAGGAGGTAGAGGG - Intronic
929098227 2:38284337-38284359 TAGGAGAAAGAGAAGGTAGAAGG + Intergenic
929732843 2:44514135-44514157 TAGAGAAATCAGAGGGTGAATGG + Intronic
929778175 2:44941426-44941448 TAGAGAAAAGAGGAGAGAGAGGG + Intergenic
930052495 2:47227624-47227646 TACAGATAAGAGAAGCTTGAAGG + Intergenic
930063266 2:47308579-47308601 AAAAAAAAAGAGAAGGTGGCAGG - Intergenic
930084017 2:47480110-47480132 AAGAGAAGAGGGAAGGGGGAAGG - Intronic
930084071 2:47480240-47480262 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
930284578 2:49411858-49411880 TGGAGACTAGAAAAGGTGGAAGG - Intergenic
930309881 2:49726776-49726798 GAGAGAGAAGAGAAAGTGAAGGG - Intergenic
930317563 2:49816327-49816349 TAGGGAAAAGATTAGGGGGATGG - Intergenic
930499298 2:52191787-52191809 TAGAGAAAAGAGAACATACATGG - Intergenic
930828072 2:55714465-55714487 TAAAGAAAAGAATAAGTGGAGGG - Intergenic
930837816 2:55813286-55813308 TAGAGAAAAGAGTAGATGGGGGG - Intergenic
931077998 2:58737883-58737905 GACACAAAAGAGAAGGTGGGAGG + Intergenic
931174075 2:59835325-59835347 AAGAAAAAAGAGAAGGGGGAAGG - Intergenic
931604182 2:64035169-64035191 GAGAGAAGAGAGAAGGGGAAAGG + Intergenic
931644680 2:64411279-64411301 TTGAGAAAAGAGAAGAAGGCAGG - Intergenic
931826937 2:66010224-66010246 TAGAGAAAAGAAGAGAGGGAAGG - Intergenic
931884377 2:66599769-66599791 AAGAGCAAGGAGAGGGTGGAAGG - Intergenic
932164514 2:69493893-69493915 TGGAGGAAAGACAAGATGGAGGG + Intronic
932359161 2:71090473-71090495 TGGAGCAAAGAGCAGGAGGATGG + Intergenic
933483852 2:82893639-82893661 TAGAGAAATAAGTAGGTGGCAGG - Intergenic
933650156 2:84843964-84843986 TTGAGAGAAGAGAGGATGGAGGG - Intronic
933808558 2:86017849-86017871 GGGAAAAAAGAGAAGGAGGAGGG - Intergenic
934105966 2:88694678-88694700 GAGAGAAAGGAGCAAGTGGAAGG - Intronic
935159113 2:100513792-100513814 TAAAGAAAGCAGAAGTTGGAAGG - Intergenic
935272091 2:101443639-101443661 TAGAGAAATGACAATGTGGTGGG + Intronic
935819170 2:106876982-106877004 TAGAGGAAAAAAAAGGTGGTAGG + Intronic
936086233 2:109471372-109471394 GAGAGAGAAGAGAAAGTGAAGGG + Intronic
936459060 2:112698077-112698099 CAGAGGACAGAGAAGGTGGTAGG - Intergenic
936492443 2:112983841-112983863 TAGAGAATAGAGTAGGTTCAAGG + Intronic
936870350 2:117129181-117129203 GAGAGAAGAGAGAAGGAAGAAGG - Intergenic
936981090 2:118266123-118266145 TGGAGAAAAGAAAAGGAGGCAGG + Intergenic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937392326 2:121500425-121500447 AAGAGAAAAGAAAAGAGGGAAGG + Intronic
937681210 2:124646809-124646831 TTCAGAAAAGAGAAGGGGGCTGG + Intronic
937993994 2:127679608-127679630 TAGGGAAGGGAGAAGGTGGGGGG - Intronic
938137165 2:128769048-128769070 TAGGAAGAAGAGAAGGGGGAGGG + Intergenic
938206274 2:129426983-129427005 TTGAGAGAGGAAAAGGTGGAGGG - Intergenic
938236406 2:129709945-129709967 TTGAAAAAGGAGAAGGTGAAAGG - Intergenic
938287984 2:130134574-130134596 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
938310516 2:130285883-130285905 TAGAGAAGGGAGCAGGTGGTCGG - Intergenic
938427604 2:131204303-131204325 CAGAGAGAAGAGAAAGAGGAAGG + Intronic
938444411 2:131366484-131366506 TAGAGAAGGGAGCAGGTGGTCGG + Intergenic
938468541 2:131538325-131538347 CAGAGAGAAGAGAAAGAGGAAGG + Intergenic
938555674 2:132421827-132421849 GAGAGAGAAGAGAGGGTAGAGGG + Intronic
938579788 2:132635622-132635644 TAAAGAAAAGAGATGGGGGAGGG + Intronic
938901521 2:135802267-135802289 TAGATAAAAGGGAAACTGGATGG + Intronic
938935254 2:136121903-136121925 TAGAGAAAGGAGGAGGTGCCAGG + Intergenic
939059825 2:137408315-137408337 AAGATAAAGGAGAAGGGGGAAGG - Intronic
939078061 2:137626666-137626688 TAGAGAAAAGGGAAGCTGAGTGG - Intronic
939101417 2:137898630-137898652 TACAGAAAAGAGAACATGGAAGG - Intergenic
939417429 2:141917724-141917746 TAGAGACGAGTGAATGTGGATGG - Intronic
939510486 2:143098670-143098692 TATAGAGAAGAGGAGGTGGGCGG + Intronic
939542906 2:143515189-143515211 TAAAGAAAAGGGAGGGTGGGGGG - Intronic
939816428 2:146902512-146902534 TAATGAAATGAGAAGGTGAAGGG - Intergenic
939931011 2:148232879-148232901 TTGAGAAAAGAGAAGGAGACTGG - Intronic
939938203 2:148317613-148317635 TAGAGACAACAAAAGGTGGGAGG - Intronic
940907094 2:159179396-159179418 TGGATAAAAGAGAAGCTGGGTGG + Intronic
941340105 2:164296310-164296332 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
941404026 2:165066689-165066711 TAGAGAAAACAGAAAAAGGAAGG + Intergenic
941509190 2:166384851-166384873 TAGCCAAAAATGAAGGTGGAAGG - Intergenic
941664037 2:168226004-168226026 GAAAGAAGAGAGAAGCTGGATGG + Intronic
941726350 2:168864852-168864874 ACGAGAAAAAAGAAGGAGGATGG + Exonic
941760650 2:169238925-169238947 AAGGGGAAAGAGAAAGTGGAGGG - Intronic
942238547 2:173936871-173936893 TAGAGAAGAGAGAAGTTTAATGG - Intronic
942249899 2:174038683-174038705 AAGAGAAAAGAGAAACGGGAAGG - Intergenic
942877614 2:180820351-180820373 TGAGGAACAGAGAAGGTGGATGG + Intergenic
943173526 2:184435570-184435592 AAGAGTAAAGAGAATGTGGAAGG + Intergenic
943325551 2:186493391-186493413 AAGAGAAAAGAGCAGGTAGAAGG - Intronic
943356960 2:186867796-186867818 TAGAGGAAAGATAAAGAGGAAGG + Intergenic
943618335 2:190119224-190119246 GAAAGAAAAGAGAAGGCAGAAGG + Intronic
943659981 2:190549038-190549060 TAAGGAAAAGAGAAAGTGGAGGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944818918 2:203409137-203409159 CAGTGAAAAGAGAAGGTAGTTGG - Intronic
945018063 2:205540897-205540919 TAGATAAAAGATAATTTGGAAGG + Intronic
945477122 2:210296792-210296814 TAGAGACAGGAAAGGGTGGAAGG - Intronic
945730781 2:213530739-213530761 TAGAGAACAGAGAAAATAGAGGG - Intronic
946324683 2:218979121-218979143 TCGAGAAAAGAAAGGGAGGAAGG + Intergenic
946328039 2:218994756-218994778 TAGAGAAAAGGGGAGGTAGAGGG + Intergenic
946606554 2:221411492-221411514 AAGAGAAAAGGGAAGGAGAAAGG + Intergenic
946625225 2:221604428-221604450 AAGAGACAATATAAGGTGGAAGG - Intergenic
946679654 2:222200163-222200185 GAGAGGAACAAGAAGGTGGAAGG - Exonic
946753170 2:222914201-222914223 TAGAGAGAAGGAAGGGTGGAAGG + Intronic
946993871 2:225368487-225368509 TATTGAAAAGACAAGGTGTATGG - Intergenic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947255053 2:228154109-228154131 GTGAGAAAAGAGAAAGTAGATGG - Intronic
947351675 2:229252870-229252892 TAGAGAAAAGACAAGGAGGTGGG + Intronic
948056003 2:235009798-235009820 TGGAGAAAAAGGAAGGTAGAGGG - Intronic
948101527 2:235377981-235378003 GAGAGAAGAGAGAAGGACGAGGG - Intergenic
948241778 2:236443812-236443834 CAGAGAAAAGGGAATGTGGAAGG - Intronic
948695721 2:239732192-239732214 TGGAGGAAGGAGAGGGTGGAGGG - Intergenic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1169055374 20:2616585-2616607 AAGAAGGAAGAGAAGGTGGAAGG + Intronic
1169060785 20:2659124-2659146 TAGAGACAAGACCAGGTGGAAGG + Intronic
1169071978 20:2738381-2738403 TAGAGAAAAAGGAGGGAGGAGGG - Intronic
1169163779 20:3406097-3406119 TAAAGGATAGAGAAGGTGGGGGG - Intronic
1169181778 20:3575260-3575282 TCTAGAAAAGAGAAGCTGCATGG - Intronic
1169267241 20:4174214-4174236 CAGAGACAAGAGAAGGGGCAAGG + Intronic
1169778997 20:9288671-9288693 TAAAGGACAGAGGAGGTGGAGGG + Intronic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1170612643 20:17927300-17927322 TAGACAACAGAATAGGTGGAAGG + Intergenic
1171070482 20:22063279-22063301 GTGAAAAAAGTGAAGGTGGATGG - Intergenic
1171503352 20:25611920-25611942 GAGTGAAAAGATAAAGTGGAAGG + Intergenic
1172035752 20:32009974-32009996 GTGAGAAATGAAAAGGTGGATGG - Intergenic
1172114074 20:32563303-32563325 TAGAGAACAGGGAGGGTGAAGGG + Intronic
1172214289 20:33224079-33224101 TTGAAAGAAGAGAAGGTGGAAGG + Intronic
1172643356 20:36455083-36455105 TAGAGAGAAGAGAGGCAGGAGGG - Intronic
1173402977 20:42741058-42741080 TAGAGAGGACAGAAGGTGTAAGG + Intronic
1173603707 20:44314099-44314121 AAAAGAAAAGAGAAAATGGAAGG - Intergenic
1173912615 20:46681469-46681491 AAGAGAAGAGAGAAAGTGAAGGG + Intronic
1174008328 20:47428266-47428288 CAGAGGGAAGGGAAGGTGGACGG - Intergenic
1174291477 20:49512042-49512064 TAGATAAATGAGTGGGTGGATGG + Intronic
1174373364 20:50109355-50109377 AAGAGAAAAGAGAATGTGGTGGG + Intronic
1174405522 20:50300470-50300492 TAGAGAACAGAATGGGTGGATGG + Intergenic
1174405572 20:50300997-50301019 TAGATGAAAGAGTGGGTGGATGG + Intergenic
1174499577 20:50974857-50974879 AAGGGAAAAGAAAAAGTGGAAGG - Intergenic
1174577542 20:51547263-51547285 TAGAGATAAGAAAATGTGGAAGG + Intronic
1174798222 20:53540278-53540300 GAAAGAAAAGAGAAGACGGAAGG - Intergenic
1174804031 20:53591939-53591961 TATACAAAAGAGAAGGTAAAAGG + Intronic
1175128840 20:56774127-56774149 TAGAGATCAGAGAAGGAAGAAGG - Intergenic
1175469883 20:59220008-59220030 GAGAGAAAAGAGGAGAGGGAGGG + Intronic
1175614956 20:60390134-60390156 GACAGAGAAGGGAAGGTGGAGGG + Intergenic
1176605229 21:8824717-8824739 CAGGTAAAAGAGGAGGTGGATGG - Intergenic
1176952923 21:15066039-15066061 TGGTGAAACGAGAAAGTGGAAGG + Intergenic
1177197364 21:17917510-17917532 GAGAGTAACAAGAAGGTGGAAGG + Intronic
1177670210 21:24214739-24214761 AAGAAAAGAGAGAAGGGGGAGGG + Intergenic
1177809800 21:25914067-25914089 TAGAAAACAGGAAAGGTGGAAGG - Intronic
1178055670 21:28796009-28796031 CAGAGAAAACAGGAGGTAGAGGG - Intergenic
1178335631 21:31740178-31740200 TAGAAAATAGAGAAGGAGGTCGG - Intergenic
1178564929 21:33675216-33675238 TAGAGAAATGAGAAATGGGAGGG - Intronic
1178851935 21:36219856-36219878 GAGAGAACAGAGAAAATGGAGGG + Intronic
1179246072 21:39635272-39635294 TAGAGGAAATAGGAGGTTGAGGG + Intronic
1179714477 21:43280286-43280308 TAGAGGGAAGGGGAGGTGGAGGG + Intergenic
1180015445 21:45079771-45079793 TAGAGAAAGGTGAATATGGATGG + Intronic
1180661925 22:17475245-17475267 TAGAGAAAAGACACAGTGGTTGG + Intronic
1180868862 22:19134847-19134869 TGGAGGAAAGAGAAGATGGAGGG + Intronic
1180971198 22:19816732-19816754 TACAGACACGAGAAGGGGGAAGG - Intronic
1181426079 22:22840033-22840055 AATAGAAAAGATGAGGTGGAGGG + Intronic
1181794702 22:25297753-25297775 TAGAAAAAAGTCAAGGAGGAGGG + Intergenic
1181834687 22:25594308-25594330 TAGAAAAAAGTCAAGGAGGAGGG + Intronic
1181964905 22:26649612-26649634 AAGAGATAAAAGCAGGTGGAGGG + Intergenic
1182011145 22:27001712-27001734 GAGAGAAAAAAAAAGGTGGGAGG - Intergenic
1182050668 22:27310495-27310517 GAGAGAGAAGAGAAGGAGGGAGG + Intergenic
1182527543 22:30930709-30930731 TAGAGAAAAGACAATGGGAATGG - Intronic
1182915869 22:34029938-34029960 CACAGAAAAAAGAAGGTAGATGG - Intergenic
1183194419 22:36343671-36343693 TTGTGAAAAGAGCAGTTGGAGGG - Intronic
1183535009 22:38396287-38396309 TATACAAAAGAGAAGGTAAAAGG + Intronic
1183691707 22:39393563-39393585 TAAAGAAAAGAAAAGGAGGCTGG - Intergenic
1184596797 22:45518832-45518854 TAGAGAAAAGTGGGGGAGGAAGG + Intronic
1184618044 22:45651455-45651477 TATAAAAAAAAGAAGGAGGAAGG + Intergenic
949455597 3:4235140-4235162 TAGAGACAAAGGAAAGTGGATGG + Intronic
949567239 3:5256265-5256287 GAGAAAAAAGAGAAGGAGAAGGG - Intergenic
949619038 3:5789368-5789390 TAAAGAAAACAGAAGATGAAAGG + Intergenic
949665736 3:6337489-6337511 AAGATAAAAAAGAAGGAGGAGGG + Intergenic
949976974 3:9469968-9469990 TGGAGGAAGGAGAAGGTAGACGG - Intronic
950315156 3:11995562-11995584 TAAAAAAAAGAAAAGGAGGAAGG - Intergenic
950753877 3:15155952-15155974 GGGAGAAAAGAGAAGTAGGAAGG + Intergenic
951027674 3:17846785-17846807 GAGAGAAAAGAGATGATAGAAGG + Intronic
951184673 3:19699342-19699364 TAGATAAATGAGTGGGTGGATGG - Intergenic
951431946 3:22618394-22618416 AAGAGGAAAGAGAAGAAGGAAGG + Intergenic
951558556 3:23945012-23945034 GAGAGGAAAGAGGAGGAGGAGGG + Intronic
952474048 3:33686958-33686980 AAAAGAAGAGAGAGGGTGGAGGG - Intronic
952704290 3:36361678-36361700 AAGAGTAAAGAGAAAGTAGATGG - Intergenic
952991277 3:38833046-38833068 GAGAGAGAAGGGAAGATGGAAGG - Intergenic
953022866 3:39127081-39127103 TTGAGAAGGGAGAAGGTGAAAGG - Intronic
953175279 3:40545734-40545756 TGGAGAAAAAAAAAGGTGGGGGG + Intronic
953357873 3:42269655-42269677 TAGAGAAAAAGGAAGTTGTATGG + Intergenic
954568086 3:51616285-51616307 TAGAGATACCAGAAGTTGGAAGG - Intronic
954788836 3:53115537-53115559 GAGAGAAAGGAAAAGGTGGCGGG - Intronic
954812804 3:53258238-53258260 GAGAGAAAGGAGCAGGTGAAAGG - Intergenic
955401384 3:58594075-58594097 AAGAGCATAGAGAAGGTGAAAGG - Intronic
955806024 3:62735761-62735783 CAAAGAAAAGAAAAGGTGGTAGG - Intronic
956657573 3:71567162-71567184 AAGAAAAATGAGAAAGTGGACGG + Intronic
956734617 3:72228613-72228635 TAGAGAACAGGGAAGAAGGAAGG + Intergenic
956858668 3:73301163-73301185 AGGAGAAAAGAAAAGGAGGAAGG - Intergenic
957274102 3:78068163-78068185 GAAAGAAAAGAGAAGGCAGAAGG + Intergenic
957385498 3:79490936-79490958 GAGAGAGAAGGGAAGGGGGAGGG - Intronic
957587230 3:82147824-82147846 TAGAGAAAAGACAAGTAGCATGG + Intergenic
957588576 3:82164801-82164823 TAAAGAAAAGAGTAGGGAGAAGG - Intergenic
957593760 3:82233830-82233852 AAAAGAAAAGAGATGGAGGAAGG + Intergenic
957768280 3:84655453-84655475 CACAGAAAGGTGAAGGTGGAAGG + Intergenic
958031287 3:88114208-88114230 TAGAGAAAAATAAAGGAGGATGG + Intronic
958519874 3:95170913-95170935 GGGAGAAAAGAAAGGGTGGAAGG - Intergenic
958552449 3:95634662-95634684 TAGTGGAAAAAGAAGGTAGAAGG - Intergenic
958953629 3:100442938-100442960 AAGAGAAAATAGGAGGAGGAAGG + Intronic
958975248 3:100660170-100660192 TAAAGAAATGAGAAGGTTGTGGG + Intronic
958983404 3:100752045-100752067 TAGAGGAAAGAGAAGGTCAAAGG - Intronic
959512672 3:107232177-107232199 AGGAGAAAAGTGAAGTTGGAGGG - Intergenic
959903129 3:111682150-111682172 AACACAAGAGAGAAGGTGGAAGG - Intronic
959970245 3:112400923-112400945 AAGAGAAAATAGAGGGAGGAAGG + Intergenic
960016806 3:112900204-112900226 TAGAAAAAGGAGTATGTGGAGGG + Intergenic
960191081 3:114706938-114706960 TACAGCCAAGAGAAGGTGGGTGG + Intronic
960243295 3:115371142-115371164 GAGAGAAAGGAGAATGTGGAAGG - Intergenic
960372000 3:116852297-116852319 TAGAAAAAAGAGAATATTGATGG - Intronic
960406056 3:117261490-117261512 TTGGGAAAAGAGAAGTTGTAAGG - Intergenic
960602437 3:119471199-119471221 TAGAGAACACAGTAAGTGGAAGG - Intronic
961203790 3:125064978-125065000 TAGAGAATAGAGAAGCCAGAAGG - Intergenic
961231858 3:125320167-125320189 TTGAGAAAACAGAGGGAGGAAGG - Intronic
961495395 3:127287727-127287749 GAGAGAAAAAAGATGGAGGATGG + Intergenic
961581774 3:127888992-127889014 AAGGGAAAAGAGAACCTGGAGGG - Intergenic
961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG + Intronic
962055817 3:131870603-131870625 GGGAGAAAAGAAAAGGAGGAAGG - Intronic
962432616 3:135333858-135333880 GAGAGAACAGAGAAAATGGAAGG - Intergenic
962887059 3:139637597-139637619 TAAGGAATAGAGAAGGTGGGTGG - Intronic
962969059 3:140382080-140382102 TAGAGAGATGGGAGGGTGGAGGG - Intronic
963192321 3:142486616-142486638 GAGAGAGAAGAGAGGGAGGAAGG - Intronic
963219390 3:142790591-142790613 TAGAGAAAAGAAAAGGATCAGGG + Intronic
963806916 3:149732152-149732174 TGGAGACAAGAGAGGGTGTATGG + Intronic
963808925 3:149755720-149755742 TAGAGTCATGAGAAGGTGGCTGG - Intergenic
963817744 3:149851530-149851552 TATAGATAAGAAAAGATGGAAGG - Intronic
964669741 3:159211821-159211843 TAGACAGAAGAGAAGTTTGAGGG + Intronic
965426811 3:168535182-168535204 GAGAGAAAAGATGAGGGGGATGG + Intergenic
965567556 3:170136884-170136906 AAGAGAAAAGAAAAGAGGGAGGG + Intronic
966399333 3:179532250-179532272 TAGATAAAAGAATAGATGGATGG - Intergenic
966807328 3:183817685-183817707 AAGAGGAAAGAGACGATGGAAGG - Intronic
966958564 3:184910093-184910115 CAAAGAAAAGAGAAAGAGGAAGG - Intronic
967205105 3:187112484-187112506 AAGAGAAAAGAGAAAGAGAAAGG - Intergenic
967229642 3:187325264-187325286 CAGAGAAAAGAGGGGGTGGAAGG + Intergenic
967407883 3:189137758-189137780 CAGAGACACGAGAAGGGGGAAGG - Intronic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968358020 3:198123243-198123265 TGGAGGGAAGAGGAGGTGGAGGG + Intergenic
968501397 4:951829-951851 TAGAGAAGAGAGAAGGTTCTGGG + Intronic
969199308 4:5589971-5589993 TAGAGAAAAGAGAAGGTGGAGGG + Intronic
969202582 4:5617733-5617755 CAGAGAAAACAGAAGTTCGAAGG + Intronic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969724309 4:8910387-8910409 TAGAGACAAGAAAAGGGGCACGG + Intergenic
969727780 4:8934091-8934113 AAGAGAAAATAGGAGGAGGAAGG - Intergenic
969922849 4:10557257-10557279 TAGAGAAGGGTGAAGGTGGAGGG - Intronic
970305932 4:14732879-14732901 TGGAGAAAAGCAAAGCTGGAAGG + Intergenic
970538160 4:17051146-17051168 GAGAGAGAAGAGGAGGGGGAGGG + Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971055924 4:22912396-22912418 GAGAGAAAGGGGAAGGAGGAAGG - Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971582839 4:28364785-28364807 GAGAGAAAAGAAGAGGTGAAAGG + Intronic
971674424 4:29607205-29607227 TAGAGAGAAAAGAAGCTGCAGGG - Intergenic
972159608 4:36207092-36207114 TAAAGAAAAGAGAACATGGTTGG - Intronic
972322168 4:37982062-37982084 TAGAAGAAAGAGATGATGGAAGG - Intronic
972961529 4:44459059-44459081 TAGAGGAAAGAAAATGTGGCTGG + Intergenic
973245318 4:48004633-48004655 AAGAGAAAATAGGAGGAGGAAGG + Intronic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974512827 4:62866957-62866979 TAGAACAAAGAGAAGGAGCAAGG + Intergenic
974655866 4:64820954-64820976 TGGAGAAAAGAGAGAGAGGAAGG - Intergenic
974933746 4:68389432-68389454 GAAAGAAAAGAGAAGGCAGAAGG + Intergenic
975076179 4:70212086-70212108 TAGAGAAAAGATTAGATGAATGG - Intergenic
975099578 4:70497322-70497344 TAGATAAAAGGATAGGTGGATGG + Intergenic
975242087 4:72071858-72071880 AAGAGAAAAATGAAGGTGAAGGG - Intronic
975495904 4:75035631-75035653 GAGATAAAAGGGAAGGAGGAGGG - Intronic
975723284 4:77268732-77268754 TAGAGAAGTGAGATGGAGGAGGG + Intronic
975967592 4:79993352-79993374 GAGAGAATAAAGAAGGAGGAAGG + Intronic
976986250 4:91302690-91302712 CAGAGAAAAGGGAAAGTGGCTGG - Intronic
977870328 4:102082902-102082924 TAGAGAGAGGAGGAGATGGAGGG - Intergenic
977966443 4:103155188-103155210 TAGAGACAATAGAAGATGAAGGG - Intronic
978070339 4:104459760-104459782 TAAAGGAAAGAGAAGGAAGAGGG - Intergenic
978091844 4:104726741-104726763 TTGAGCAGAGAGAGGGTGGATGG + Intergenic
978193026 4:105938140-105938162 TAAAGAAAATAAAAGGGGGAAGG - Intronic
978331545 4:107618571-107618593 AAGAGGAAACAGAAGGTGGTGGG + Intronic
978719092 4:111884964-111884986 AAGAGAAGAGAGAAGGAAGAAGG - Intergenic
978725311 4:111962658-111962680 TAGAGGAATAACAAGGTGGAGGG - Intergenic
978996216 4:115156799-115156821 TAGAGCCAAGAGAGGGTCGAGGG + Intergenic
979338665 4:119493465-119493487 TAGAGAAAATAAAAGGTAGGGGG - Intergenic
979887305 4:126045316-126045338 TAGAGCAAAAAGATGGAGGAAGG + Intergenic
980002261 4:127503701-127503723 AACAGATAAAAGAAGGTGGAAGG - Intergenic
980079359 4:128327609-128327631 TAGAGAAGAGAAAAGATAGAAGG - Intergenic
980289230 4:130824359-130824381 TAGAGAAAAGAGAGGGAGGGAGG - Intergenic
980332683 4:131429863-131429885 TAAAGTAAAGAGAAGGGGTAGGG - Intergenic
980388620 4:132118642-132118664 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
981092131 4:140742846-140742868 GAGAGAAGAAAGAAGGTGCAGGG + Intronic
981166998 4:141572141-141572163 TAGACAAAAGAAAGGGAGGACGG - Intergenic
981858712 4:149328211-149328233 TAGAGAAAAGTGAATCTGGGTGG + Intergenic
981995645 4:150971463-150971485 TTGAGGAAAGAGAAGGTGGCTGG - Intronic
982096244 4:151926121-151926143 TGAGGAAAAGAGAAAGTGGAGGG + Intergenic
982130428 4:152224281-152224303 TAGAGAAGGCAAAAGGTGGAGGG + Intergenic
982183080 4:152766573-152766595 AAGAGGAAAGAGAGGGTTGAAGG - Intronic
982304326 4:153914045-153914067 TACAGAAATGAGAAAGGGGAAGG - Intergenic
982429405 4:155305558-155305580 GAAAGAAAAGAGAAGGCAGAAGG + Intergenic
982709333 4:158744474-158744496 GGGAGAAGAGAGAAGGAGGAAGG + Intergenic
983055200 4:163093654-163093676 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
983967736 4:173833519-173833541 TAGAGAAAAGAAAATGAGAAGGG - Intergenic
984700316 4:182814793-182814815 TGGAGTAAAGAGCAGGAGGACGG - Intergenic
986088785 5:4481094-4481116 GAGTGCAAAGAGGAGGTGGACGG - Intergenic
986129375 5:4912731-4912753 GAGAGAAAGGAGAAGGAAGAAGG + Intergenic
986160728 5:5226045-5226067 TAGAGAGATGCGAAGATGGAAGG - Intronic
986164114 5:5258654-5258676 TGGAGAGAACAGCAGGTGGATGG + Intronic
986491966 5:8302360-8302382 TAGAGCCAAGAGAAGATGGATGG - Intergenic
986502369 5:8414542-8414564 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
986865516 5:11981859-11981881 CAGAGAAAGTAGAATGTGGAAGG - Intergenic
986905490 5:12490372-12490394 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
987132092 5:14870010-14870032 TAGAAAGAAGGGAAGGTGGGCGG + Intronic
987380656 5:17282896-17282918 TAGAGGAAAGAGAATAAGGAAGG - Intergenic
987490768 5:18578047-18578069 GAGAGAAAAGAGAAGGTAGTAGG + Intergenic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988383718 5:30534153-30534175 TAGAGGAAGGAGAAGATAGAAGG - Intergenic
988731574 5:33977762-33977784 CAGAGCACAGAGAATGTGGAAGG + Intronic
989142325 5:38213879-38213901 TAGAGAAAAGAGAATGAGGAGGG + Intergenic
989149598 5:38285769-38285791 GAGAGAGAAGAGAAAGTGAAGGG + Intronic
989246667 5:39263118-39263140 GAGAGAAAAGAAAGGGCGGATGG + Intronic
989262948 5:39438867-39438889 TTGATAAAGGAGAAGGTAGAAGG + Intronic
989304468 5:39937006-39937028 TTTAGAAAACAGAAGATGGAGGG + Intergenic
989312448 5:40035911-40035933 TACAGGAAAGAAAAGGTAGAGGG + Intergenic
989470414 5:41810750-41810772 AAGAGAAAAGAGGAGCTGCAAGG + Intronic
989512697 5:42306533-42306555 CAGACAAAGGAGAAGTTGGAAGG + Intergenic
990626265 5:57614949-57614971 GAGAGAACAGAGCAGATGGATGG + Intergenic
991177163 5:63702584-63702606 TATAGAAAAGAGATAATGGAGGG + Intergenic
991260366 5:64661351-64661373 TAGAGTAAAGAGAAAATGGAAGG - Intergenic
992488829 5:77221267-77221289 TATAGAAAAGAGAGACTGGAAGG - Intronic
992525669 5:77608017-77608039 AAGAGAAAAGAGGTTGTGGATGG - Intronic
992549470 5:77847195-77847217 GGGAGAAAAGAGAATGAGGATGG - Intronic
992681414 5:79157057-79157079 TAGAGAAAAGACACAGTGGGAGG - Intronic
992861813 5:80918949-80918971 AAGAAAAAAGTGAAGGAGGAAGG + Intergenic
992984267 5:82211604-82211626 TGCAGGAAAGAGAAGGTGCAGGG - Intronic
993347491 5:86802825-86802847 AAGAGGCAAGAGGAGGTGGAAGG - Intergenic
993526652 5:88973639-88973661 AAGAGAAAAGGAAAGATGGAGGG + Intergenic
993836359 5:92824225-92824247 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
994084362 5:95742482-95742504 AAGAGAATAGAGAAAATGGATGG - Intronic
994284546 5:97948957-97948979 TAAGGAAAAGAGAACGGGGAGGG - Intergenic
994525291 5:100900004-100900026 TGGAGATATGAGAATGTGGATGG + Intronic
994532897 5:100989721-100989743 TGGAGCAAAGAGCAGGAGGAGGG + Intergenic
994669906 5:102753400-102753422 GAGAGAGAAGAAAATGTGGAGGG - Intergenic
995110149 5:108419913-108419935 TAGATAAATGAGAAGTTTGAAGG - Intergenic
995308315 5:110680971-110680993 GAGGGAAAAGAGAAGGGTGAGGG + Intronic
995492096 5:112704371-112704393 TAGAGGAAAGAGATGTTGGCAGG - Intergenic
995538722 5:113163478-113163500 AGGAGGAAAGAGAAAGTGGATGG - Intronic
995718666 5:115106013-115106035 AAAAGAAAAGAAAAGGTGGGAGG + Intergenic
996074528 5:119174781-119174803 TAGAGGAAAGAGAAAGAGAAAGG - Intronic
996354494 5:122580914-122580936 AAGAGAAAAGAAAAGAGGGAAGG - Intergenic
996393241 5:122986480-122986502 CAGAAAAAAGAGAAGTGGGAGGG + Intronic
996650240 5:125867001-125867023 TAGACAAAAGAAAAGGTGGTTGG + Intergenic
996702512 5:126464588-126464610 TTGGTAAAAGAGAAGGTGGAAGG - Intronic
997101516 5:130974414-130974436 TAGAGAGAAGAGAGAGTGGAAGG - Intergenic
997121483 5:131177809-131177831 GAGAGAAAAGAGAAAAGGGAGGG - Intronic
997339348 5:133130615-133130637 GAGAGAAGAGAGGAAGTGGAAGG - Intergenic
997506539 5:134422019-134422041 AAGAGAAAGGAGAAGAAGGAAGG - Intergenic
997516725 5:134495294-134495316 TATACAAAAGAGAAGACGGAGGG + Intergenic
997727743 5:136136091-136136113 TAGAGAAAAGAAAAGGCCCAAGG + Intronic
998064877 5:139149958-139149980 GAGAGATAAGAGAAGGGAGAAGG + Intronic
998177476 5:139910888-139910910 TGGAGAGAGCAGAAGGTGGAAGG + Intronic
998495822 5:142588469-142588491 GAGAGAAGAGAGAAGAGGGAGGG - Intergenic
998552668 5:143092547-143092569 TTGAGAAAAAAAAAGGTGGGGGG - Intronic
998701804 5:144711307-144711329 GTGAGAAAAGAGAAGTGGGAAGG - Intergenic
998706201 5:144764316-144764338 CAGACAAGAGAGAAGGTAGATGG - Intergenic
998888083 5:146715764-146715786 AAGAAATAATAGAAGGTGGAGGG - Intronic
998951301 5:147395516-147395538 AAAAGATAAGAGAAGGGGGAAGG - Intronic
999051583 5:148529456-148529478 TAGAGAAGAGAGATTGTGCAGGG - Intronic
999109016 5:149100140-149100162 TGGAGGAAAGAGAAAGTGAAAGG + Intergenic
999213982 5:149916159-149916181 AAGAAAAAAGAGAAGGTAGACGG - Intronic
999360503 5:150982219-150982241 TAGAGAAAAGCTGAGGAGGAGGG - Intergenic
999588316 5:153116086-153116108 GAGAGGAAAGTGAAGGTGAAAGG - Intergenic
999881179 5:155866213-155866235 TAGAGAAAAGAGATGGAGGGAGG - Intergenic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001475145 5:172045024-172045046 TAGGGAAGAGAGAGGATGGATGG + Intronic
1001725882 5:173899609-173899631 TAGAGAAAGGATAAGATGAAGGG - Intronic
1001798578 5:174523487-174523509 TAAAGAAAAGAGAAGAGGGAAGG + Intergenic
1001998489 5:176181325-176181347 TATGGAAAAGAGAGAGTGGAAGG - Intergenic
1002337627 5:178491170-178491192 GAGAGAGAAGAGAACGAGGAGGG + Intronic
1003462603 6:6344953-6344975 TACGGAAAAGAGAAAGTGCAAGG + Intergenic
1004208076 6:13611028-13611050 TAGAAAAAAGAGAAAGAGGAAGG - Intronic
1004582684 6:16969711-16969733 GAAAGAAAAGAGAGGGGGGAGGG + Intergenic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1005087624 6:22022963-22022985 TATGGAAAAGAGGAGGGGGAGGG - Intergenic
1005106433 6:22229114-22229136 AAGAGAAAAGAGAAGACAGAAGG + Intergenic
1005132042 6:22520500-22520522 GAGAGAAGGGAGAAGGGGGAAGG + Intergenic
1005467152 6:26126327-26126349 TAGGGAAAGGAGGGGGTGGAGGG - Intronic
1005826726 6:29636494-29636516 AAAAGAAAAGTGAGGGTGGAGGG - Intergenic
1005955539 6:30660886-30660908 AAGAAAAAAGAAAAAGTGGAAGG + Intronic
1006268335 6:32944243-32944265 TTGTCAAAAGAGAAAGTGGAAGG - Intronic
1006823378 6:36916085-36916107 GGGAGAAGAGAGAAGGAGGAAGG - Intronic
1007134499 6:39508015-39508037 AAGAAAAAAGAGAAGAGGGAGGG - Intronic
1007468863 6:42075129-42075151 TAGAGAAATGATAGGATGGACGG + Intronic
1007871263 6:45041682-45041704 AAGAAGAAAAAGAAGGTGGAAGG - Intronic
1008246787 6:49184867-49184889 TAGAGAAAAATGGAGATGGAAGG + Intergenic
1008247878 6:49201596-49201618 AAGAGTAAAGGGAAGGTGAAAGG - Intergenic
1008395530 6:51002474-51002496 TGGAGAAAACAGAAGGTCTAAGG - Intergenic
1008401757 6:51071337-51071359 GAGAGAAATGAGAAAGTGAATGG - Intergenic
1008561886 6:52732103-52732125 GAAAGAAAAGAGAAGGCAGAAGG - Intergenic
1008593626 6:53018777-53018799 GAGAGAAAAGAGAAAGTGGAAGG + Intronic
1008861420 6:56153863-56153885 AATAGAGAAGAGAAGGTGGCAGG - Intronic
1008894062 6:56531826-56531848 TAGGAAACAAAGAAGGTGGAAGG - Intronic
1008953395 6:57186212-57186234 TAGGGAAAAGAGACTGTGAAGGG + Exonic
1008967454 6:57327445-57327467 TAGGGAAAAGAGACTGTGAAGGG + Intronic
1009195930 6:60684371-60684393 AAGAGAAGAGAGAAGGAGGGAGG + Intergenic
1009484476 6:64202752-64202774 AAGAGGAAAGAGAAGGGGAAAGG + Intronic
1009514935 6:64603265-64603287 AAGAAAGAAGAGAAGGAGGATGG - Intronic
1009555170 6:65154312-65154334 AGGAGCAAAGAAAAGGTGGAAGG + Intronic
1009607577 6:65894286-65894308 TAGAGAACACTTAAGGTGGAAGG - Intergenic
1009773554 6:68176338-68176360 GAAAGAAAAGAAAAGGGGGAAGG - Intergenic
1010298681 6:74232175-74232197 AAGAAAAAAGAAAAGATGGATGG - Intergenic
1010521285 6:76841174-76841196 TAGAAAAAACACTAGGTGGATGG + Intergenic
1010663622 6:78600070-78600092 CAGAGAAAAGAGGACATGGAGGG + Intergenic
1010835498 6:80582880-80582902 TAGAGAAAAAAGAAAGAGCAGGG + Intergenic
1010869681 6:81021991-81022013 AAGAGAAAGGAGAAGGGGTAGGG - Intergenic
1011743336 6:90385367-90385389 TACAGAAAAGAGAAGGTGAGAGG - Intergenic
1011787617 6:90864511-90864533 TAGGGTGCAGAGAAGGTGGATGG + Intergenic
1012085164 6:94815732-94815754 TAGAGAACAAAGAAGATGTATGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012649103 6:101730690-101730712 AAGAGACAAGTGAAAGTGGAAGG + Intronic
1012961344 6:105625317-105625339 AAGAGAAAAGGGAAGGGGGGGGG + Intergenic
1013036771 6:106392538-106392560 CACAGGAAAGAGATGGTGGAGGG + Intergenic
1013307428 6:108862564-108862586 TAAAGAAGAAAAAAGGTGGAAGG - Intronic
1013338037 6:109185259-109185281 TTGAGAAAACACAATGTGGATGG + Intergenic
1013348236 6:109282957-109282979 AAGAGAAAAGAGAAGAGGGGAGG - Intergenic
1013672154 6:112416444-112416466 TATAGAATAGAGAAATTGGAAGG + Intergenic
1014036231 6:116769613-116769635 TATAGAAAAGAGACAGTGGCTGG - Intergenic
1014211067 6:118708771-118708793 TAGGGAAAAGGGAGGGAGGAAGG - Intronic
1014383750 6:120776701-120776723 GAGGGAAAAGAGGAGGTGAAGGG - Intergenic
1014459378 6:121677543-121677565 TGGGGAAAAGAGAAGGCGTATGG + Intergenic
1014545698 6:122733045-122733067 CAGGGAAAAAAGAAGGTGGTGGG - Intergenic
1014571215 6:123010481-123010503 TAAAGAAAAGGAAAGGTGGTAGG - Intronic
1015255425 6:131174108-131174130 TATAAAAAATAGAAGCTGGAGGG + Intronic
1015304058 6:131686656-131686678 TAGAGGGAAGAGGAGGTGTATGG - Intronic
1015385641 6:132619962-132619984 CAGAGAGAATACAAGGTGGAGGG + Intronic
1015879918 6:137861797-137861819 TAGAGAAAACAGTAAGTGCAGGG + Intergenic
1016137707 6:140566417-140566439 TAGAGAAAAGAGAATCAGGTAGG + Intergenic
1016239531 6:141913252-141913274 TAGAGATAAGAGAAAATAGATGG - Intergenic
1016633227 6:146256470-146256492 TGGAGAAAAAGGAAGATGGAAGG - Intronic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016844026 6:148553546-148553568 AGAAGAAAAGAGAAGGTGGTTGG + Intergenic
1016887391 6:148970816-148970838 TAGAGAAATGAGATGGTAGAAGG - Intronic
1017321131 6:153094476-153094498 TAGAGAAAAGCAAAGGTACAAGG - Intronic
1018613607 6:165664256-165664278 TAGAAAGAAGAAAACGTGGAGGG - Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020339755 7:7097122-7097144 AAGAAAAAAGAGAAGGTTGGAGG + Intergenic
1020668097 7:11072869-11072891 CAGAGAAAAGAGGAGGTGTCAGG + Intronic
1020728202 7:11843736-11843758 TAGAAAAGAGAGAAGGGGGCAGG - Intergenic
1020742187 7:12035019-12035041 GAGAAAACAGAGAAGGTGAAAGG + Intergenic
1020814479 7:12888476-12888498 AAAAGAAAAGAAAAGGTGGCTGG - Intergenic
1021092427 7:16499436-16499458 TAAAGAAAAGAGCATGTGGGTGG + Intronic
1021158857 7:17246846-17246868 GAGAAAAAGGAGAAGGTGAAAGG - Intergenic
1021296022 7:18906984-18907006 AAGAGAAAACACAAGATGGAAGG + Intronic
1021343453 7:19491660-19491682 TAGAAAAAAGGGAAAGTGGAAGG - Intergenic
1021584546 7:22193789-22193811 GAGAGAAAAGAGAGGGAGGGAGG + Intronic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1021867476 7:24972341-24972363 AAGAGAAAAGAGAATGTGGCTGG - Intronic
1022099953 7:27163516-27163538 GAGAGAAGGGAGAAGGCGGAAGG + Exonic
1022372596 7:29785441-29785463 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1022417677 7:30191948-30191970 TAGAGGAAAGACAAGGGGGCGGG + Intergenic
1022607254 7:31827809-31827831 TAAAGAAAAGAAAGGATGGAAGG + Intronic
1023245363 7:38197754-38197776 TAGAGAAGAGAGATGTGGGAAGG - Intronic
1023250314 7:38253275-38253297 TAGAAAAAAGAGGAATTGGATGG - Intergenic
1023251622 7:38269386-38269408 TAGAAAAAAGAGGAATTGGATGG - Intergenic
1024045015 7:45580131-45580153 TAGACAAAAGAGAGGGAGAATGG + Intronic
1024382568 7:48715246-48715268 GAGAGTAAAGAGAATGGGGAAGG - Intergenic
1024859893 7:53826275-53826297 AAGAGAAAAGAAAAGAAGGAGGG + Intergenic
1025035270 7:55589713-55589735 CACAGAAAAGAGAAGGGTGAGGG - Intergenic
1025104437 7:56159475-56159497 GGGAGAAAAGAGAAGATGCATGG + Intergenic
1025565844 7:62433127-62433149 TAGAGACAAGGAAAGGAGGAAGG + Intergenic
1025624138 7:63203442-63203464 TAGAGAAAAATGAAGGAGAAGGG - Intergenic
1025856601 7:65285808-65285830 GAAAGAGAAGAGAAGATGGAAGG + Intergenic
1026158951 7:67852217-67852239 AAGAGAAAGGAGAAAGAGGAGGG + Intergenic
1026159064 7:67852834-67852856 GAGAGAAAGGAGGAGGAGGAGGG + Intergenic
1026206234 7:68260278-68260300 GAGACAAAAGAGAAGGAGGAAGG - Intergenic
1026341263 7:69436175-69436197 AAGAAAAATAAGAAGGTGGATGG - Intergenic
1026474908 7:70726900-70726922 GAGAGGAAAGAGAATGAGGAAGG - Intronic
1026509170 7:71013754-71013776 AAGAGAAAAGGGAAGAAGGAAGG + Intergenic
1026738054 7:72961294-72961316 TACAGGAAAGTGAAGGTGGCCGG + Intronic
1026789091 7:73320091-73320113 TACAGGAAAGTGAAGGTGGCCGG + Intronic
1027105680 7:75403774-75403796 TACAGGAAAGTGAAGGTGGCCGG - Intronic
1027900598 7:84109328-84109350 TATAAAAAAGAGAAGAAGGAAGG + Intronic
1027966988 7:85024948-85024970 AAAAGAAAAGAGAAAGTGTAGGG + Intronic
1028042499 7:86072000-86072022 TAGGGAAAAAAAAAGGTAGAGGG - Intergenic
1028055824 7:86241322-86241344 GAGAGAAAAAAGAAGGAGAAGGG + Intergenic
1028157383 7:87446963-87446985 CAAAGAAAAGAGAAGGTAGATGG + Intronic
1028225375 7:88245584-88245606 TGGGGAAAGGAGAAAGTGGAGGG - Intergenic
1028492512 7:91427974-91427996 GAGAGAAAACATAAGGTGGCTGG + Intergenic
1028538198 7:91912924-91912946 GTGATAACAGAGAAGGTGGAGGG - Intergenic
1028826581 7:95280676-95280698 TAGCTAAAAAAGAAGGTGAAGGG + Intronic
1028854466 7:95575355-95575377 TAGAGAAAAGGAAAGATGAAAGG - Intergenic
1028944746 7:96564634-96564656 TAGAGGAACCAAAAGGTGGAAGG + Intronic
1030405593 7:109108212-109108234 GAGAGAAGAGAGAAAATGGATGG + Intergenic
1030674472 7:112370245-112370267 TGGAGAAAAGAGCAGCTGCAAGG - Intergenic
1030865652 7:114699057-114699079 TGGTGAAGGGAGAAGGTGGAAGG - Intergenic
1030954436 7:115834333-115834355 TAGAAATAAAAGAAGGTGGCAGG - Intergenic
1031036890 7:116797302-116797324 TAGAGCAAAGAAAGGGTGGATGG + Intronic
1031260090 7:119507306-119507328 TAGAGAAACAAGTAGGTTGATGG + Intergenic
1031584349 7:123516793-123516815 TAGGGAAAACACAAGGTGGCTGG + Intronic
1031694771 7:124836551-124836573 TAGAGAAAAGAGTTAGTGAATGG - Intronic
1031728221 7:125264117-125264139 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1031777029 7:125918022-125918044 TGGAGCAAAGAGCAGGAGGAAGG - Intergenic
1031785224 7:126021950-126021972 TTGAGAAAAGAGAAGTTTGCTGG - Intergenic
1031810417 7:126361007-126361029 TTGAGTCAAGATAAGGTGGAGGG + Intergenic
1031814112 7:126411238-126411260 AAGAGAGAAGAGAAGGTTCACGG + Intergenic
1031903390 7:127434590-127434612 GAGAGAAAAGAGACGAGGGAAGG + Intergenic
1032356924 7:131219916-131219938 TAGAGAAACTAGCAGGTGGCAGG - Intronic
1033124745 7:138697810-138697832 AAGAGAGAAGAGAAGGAAGAAGG + Intronic
1033136149 7:138786124-138786146 TGGAGAAGAGGGAAGCTGGAGGG - Intronic
1033465324 7:141583971-141583993 TGGAGCAAAGAGCAGGAGGACGG + Intronic
1034142692 7:148836977-148836999 TAGAGGGAAGAGCAGGTGAATGG + Intronic
1034207912 7:149333972-149333994 TAGGTAGGAGAGAAGGTGGATGG - Intergenic
1034261787 7:149761438-149761460 TGGAGATTAGAGAAGGAGGAGGG + Intergenic
1034464069 7:151215445-151215467 TAGAGTAAAGAAAAGGTAGTAGG + Intronic
1034732552 7:153400553-153400575 TAGAGGGGAGAGAAGGAGGAAGG + Intergenic
1035091379 7:156315530-156315552 AAGAGAAAAGGGGAGGGGGAGGG - Intergenic
1035287724 7:157816860-157816882 AAGAGAAAAGAGGAGGAGAAAGG - Intronic
1036611743 8:10356164-10356186 TAGAGAAAAGACAAGAAAGAAGG - Intronic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1037586722 8:20281903-20281925 GAGAGAAAAGAGTTGGTGGAAGG + Intronic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1037835218 8:22211567-22211589 CAGAGAAAAGAGATGGGGTAAGG - Intronic
1038234794 8:25742180-25742202 TAGAGAAGCGAGAAGGTGGATGG + Intergenic
1039010868 8:33091200-33091222 GAAAGAAAAAAGAAAGTGGAGGG + Intergenic
1039262585 8:35787987-35788009 AAGAAAAAAGAAAAGGAGGAAGG + Intronic
1039314491 8:36356490-36356512 GAGACAAAAGGGAAGGAGGAAGG + Intergenic
1039780877 8:40784039-40784061 TAGAGAAGAGAGGAAGTGGTTGG - Intronic
1040082182 8:43297729-43297751 TAGGGAAAAGAAAACCTGGAAGG - Intergenic
1040364022 8:46695569-46695591 TAGAGTAAAGAGGAAGGGGATGG + Intergenic
1040787273 8:51180464-51180486 TAGAGAGAAGATAAGGAGGAAGG - Intergenic
1041405909 8:57499027-57499049 TAGAAAAAAGACATTGTGGATGG + Intergenic
1041528555 8:58836642-58836664 TACAGAAAAGAGAGAATGGAGGG + Intronic
1041549454 8:59083173-59083195 AGGAAAAAAGAGAAAGTGGAAGG + Intronic
1041971035 8:63742872-63742894 TTGAGAAAGGAGAACGTGCAAGG - Intergenic
1042317573 8:67440148-67440170 TAGAGAATTCAGAAGGTGGATGG - Intronic
1042574061 8:70198707-70198729 GAGGTAAAAGAGAAGGTGGCTGG + Intronic
1042719517 8:71812276-71812298 GAGAGAAAGGAGAAGGCTGAAGG - Intergenic
1043035636 8:75194781-75194803 TAGAGAAAAGAAAAGATAAAGGG + Intergenic
1043137477 8:76546596-76546618 TAGAGAAAAGAGAAAATGGAAGG - Intergenic
1043748954 8:83911125-83911147 AAGAGACAAGAGTTGGTGGAAGG - Intergenic
1043920647 8:85979649-85979671 TAGAGAAAATTGATGGTTGAAGG + Intergenic
1044148786 8:88747350-88747372 TGGAGCAAAGAGCAGGAGGATGG + Intergenic
1044549837 8:93499443-93499465 CAGAGAAAACAGGAGGTGAAAGG + Intergenic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045769298 8:105716034-105716056 CAGAGAAAAGAGATGCTGGCAGG + Intronic
1045982426 8:108206343-108206365 AAGAAAAAAGAAAAAGTGGAAGG + Intronic
1045996786 8:108372263-108372285 TAGAGAGCAGAGCAGCTGGAAGG + Intronic
1046803208 8:118451593-118451615 TATAGAAAAGAGAGGGCTGATGG + Intronic
1046839300 8:118839787-118839809 TAGAAAAAAGAGAAAATGCAGGG + Intergenic
1047354887 8:124111179-124111201 AAGAGAAAAGAAAAGGGGGAAGG + Intronic
1047909486 8:129511990-129512012 AAGAGACAAGAGTTGGTGGAAGG - Intergenic
1047957638 8:129987527-129987549 AAAAGAAAAGAAAAGGTGGGAGG - Intronic
1048132935 8:131717601-131717623 TTGAAAAAAGAGAAAGTGCAGGG - Intergenic
1048520677 8:135151471-135151493 TAAAGGAAAGAGAAGGAGGGAGG + Intergenic
1048585748 8:135772508-135772530 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1048589135 8:135804777-135804799 GAGGGAAAAGAGAAAGTGAACGG - Intergenic
1049103404 8:140596284-140596306 TAAAGAAAACAGAAGCTGGCTGG + Intronic
1049335939 8:142085330-142085352 AAGAGAAAAGAGAAGAGAGAGGG + Intergenic
1050181649 9:2929180-2929202 TTGAAAAAAGAGAAGAAGGAAGG + Intergenic
1050747374 9:8892036-8892058 CAGAGAAAAGAAAAGCAGGAAGG - Intronic
1051032727 9:12701648-12701670 TAAAGAAGAGAGATGGTGGGAGG - Intronic
1051074227 9:13210953-13210975 TTGAGAGAAGAGAAGGAAGAAGG - Intronic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1051485821 9:17606697-17606719 GAAAGAAAACAGAAGGTGGCAGG - Intronic
1051813479 9:21076849-21076871 AAGAGAAAAGGAAAGCTGGAGGG - Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052218197 9:25991383-25991405 TAGAGAAAAGAGCTTGTGCAGGG + Intergenic
1052228967 9:26124012-26124034 TACAGATAAGTAAAGGTGGAGGG - Intergenic
1052273899 9:26656745-26656767 TGGAGAAAACAGCTGGTGGAGGG - Intergenic
1052379081 9:27750634-27750656 AGGATAAAAGAGAAGGGGGAGGG - Intergenic
1052411027 9:28121463-28121485 GAAAGAAAAAAGAATGTGGAAGG - Intronic
1052482114 9:29044254-29044276 TGGAGCAAATAGAAGTTGGAAGG + Intergenic
1052632803 9:31062218-31062240 AAGAGATAAGAAAAGGTGGGGGG - Intergenic
1053278556 9:36801476-36801498 AAGAGCAAAGAGAAGATGGAAGG + Intergenic
1053453739 9:38214713-38214735 TAGAGGAAGGAGAAGGGGAAAGG + Intergenic
1054704973 9:68452848-68452870 TTGAGAAAGGAGATGTTGGAAGG - Intronic
1054709995 9:68501647-68501669 TGCAGATTAGAGAAGGTGGAAGG - Intronic
1055030208 9:71766492-71766514 TCAAGAAAAGACAAGCTGGAGGG - Intronic
1055073442 9:72190421-72190443 TAGAGAAAAGAAAACATGGCGGG - Intronic
1055108151 9:72533775-72533797 GAGAGAAAAGAGAGAGAGGAAGG - Intronic
1055157357 9:73080456-73080478 TGTGGAAAAGAGAAGGTGGGAGG - Intergenic
1055159504 9:73108340-73108362 ATGAGAAAAGAGAAGGTGAACGG - Intergenic
1055505444 9:76943644-76943666 TAGAGGAATGAGAGGGTGAATGG - Intergenic
1055810610 9:80143678-80143700 TAGAAAAAAGAGAAGTTGGTCGG + Intergenic
1056040502 9:82660644-82660666 GAGAGAGAAGGGAAGGGGGAGGG + Intergenic
1056234208 9:84575361-84575383 TAGAGAGAAGAGGAAGGGGATGG + Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056825950 9:89876460-89876482 TGGAGAAGAGAGATGGTGGAGGG - Intergenic
1056959995 9:91114756-91114778 TAGAGAGAAGAAAAGGAGGCTGG - Intergenic
1056965185 9:91159452-91159474 GAGAGGAAAGAGAAAGAGGAGGG + Intergenic
1056984222 9:91346436-91346458 TAGAGCAAAGTTAGGGTGGAGGG - Intronic
1057021146 9:91698642-91698664 GAGAAAAAGGAGCAGGTGGAAGG - Intronic
1057377691 9:94540349-94540371 TGGAGCAAAGAGTAGGAGGACGG - Intergenic
1057450545 9:95155229-95155251 GAGAGAAAAGAGAGAGGGGAGGG + Intronic
1057490081 9:95513790-95513812 GGGAGGAAACAGAAGGTGGAAGG - Intronic
1057516607 9:95727274-95727296 AAGAGGAAAGAGAAGGGGGGTGG - Intergenic
1057602971 9:96474976-96474998 TAATGAAAGGAGAAGATGGAAGG - Intronic
1058070149 9:100593705-100593727 TGGAGAACAAAGAGGGTGGAAGG - Intergenic
1058181951 9:101809259-101809281 TAGAACAAAGAGCAGGAGGAAGG + Intergenic
1058227699 9:102385931-102385953 TAGAGAACAGAGAAAGTGATTGG + Intergenic
1058575863 9:106400413-106400435 TAGAGATAGGAGAAGGTAGCAGG + Intergenic
1058817533 9:108698927-108698949 AGAAGAGAAGAGAAGGTGGATGG + Intergenic
1058852426 9:109025787-109025809 TAGAGAACAGAGGAAGTGAAAGG + Intronic
1058944258 9:109841765-109841787 GAGAGAAAGGAGAGGGTGGGGGG + Intronic
1059268448 9:113057489-113057511 AAGAAAAAAGAAAAGGTGGGAGG + Intergenic
1059497043 9:114718583-114718605 TATAGAAAAGAGAAGAAAGAGGG - Intergenic
1059542479 9:115144251-115144273 AGGAGAGAGGAGAAGGTGGAAGG - Intronic
1059667884 9:116466345-116466367 CAGAGATAAGAGAAGGTGGCTGG - Intronic
1059937296 9:119323723-119323745 TGGAGAAGTGAGAAGGTAGAAGG - Intronic
1059938033 9:119331217-119331239 TAAAGGGAAGAGAAGCTGGAGGG + Intronic
1060714182 9:125906484-125906506 TAGAGAAAAGGGAAAGAAGATGG + Intronic
1060741729 9:126103201-126103223 CAGAGGAGAGAGCAGGTGGAAGG - Intergenic
1061399561 9:130360964-130360986 TAGACAAATGGGCAGGTGGATGG - Intronic
1061563920 9:131424694-131424716 AAAAGAAAAGAAAAGATGGAGGG + Intronic
1185545400 X:939789-939811 AAGAGAAAAGAGGAGGAGGGGGG - Intergenic
1185545834 X:943551-943573 TAGACAGAAGAGAGGGTAGAAGG + Intergenic
1185686720 X:1934884-1934906 AAAAGAAAAGAAAAGGAGGAGGG + Intergenic
1185814783 X:3144707-3144729 TAGAGAAAAGAGAGGGAAAAAGG - Intergenic
1185818128 X:3175397-3175419 AAGAAAAAAGAAAAGGGGGATGG + Intergenic
1186530074 X:10286490-10286512 TATAGAAAAGAGCAGGGGTATGG + Intergenic
1186816857 X:13246571-13246593 AAGAGAAGAGAGGAGATGGAAGG + Intergenic
1187271060 X:17780085-17780107 AAGGGAAGAGAAAAGGTGGAAGG + Intergenic
1187323011 X:18257952-18257974 GAGAGGAAAGGGAAGGGGGAAGG + Intronic
1187552957 X:20324205-20324227 GAGAGAGAAGAGAAGGAGGGAGG - Intergenic
1187572625 X:20520394-20520416 TTGAGAAAAATGAAGGGGGAAGG - Intergenic
1187580160 X:20598986-20599008 CAAAGAAAAGAGAAAATGGATGG - Intergenic
1187735359 X:22297738-22297760 TAGAAAGAAGAGCAGGTGCAGGG + Intergenic
1187761340 X:22589390-22589412 TAGAGAAGAGAAAAGGGGCAGGG + Intergenic
1187777853 X:22783948-22783970 AAGAGAAAAGAAAAGCTGGGAGG - Intergenic
1188310073 X:28605530-28605552 TTTAGAAAAGAGATGATGGAGGG - Intronic
1189512973 X:41682249-41682271 TAAAGCAAAAAGAAGGTGAAGGG + Intronic
1189726740 X:43975088-43975110 GGGAGAAATGAGAAGGTGGACGG - Intergenic
1190091317 X:47439791-47439813 TAGATAGGAGGGAAGGTGGATGG + Intergenic
1190123410 X:47682737-47682759 AGGAGAAGGGAGAAGGTGGATGG - Intergenic
1190681467 X:52830351-52830373 TGGAGGAAAGAGCAGGGGGAGGG - Intergenic
1191159071 X:57308254-57308276 CAGAGAAAAGGGAATGTTGATGG - Intronic
1192050553 X:67720335-67720357 TGGAGGAAAGAGAAGGGGAAAGG - Intronic
1192143953 X:68668206-68668228 AAGAGAAAGAAGAAGGAGGAGGG - Intronic
1192234177 X:69285608-69285630 AAGAGAATGGAGAAGGGGGAAGG + Intergenic
1192313563 X:70035302-70035324 GAGAGGAAAGAGAGGGTGGGGGG - Intronic
1192316242 X:70053936-70053958 TAGAGTGGAGAGATGGTGGAGGG - Intergenic
1192402834 X:70854306-70854328 TAGAGGTGACAGAAGGTGGAAGG + Intronic
1192479525 X:71472820-71472842 AAGAGAAAAGGGAAGGGGTAGGG - Intronic
1192778419 X:74269037-74269059 TGGAGAAAAAACAAAGTGGATGG + Intergenic
1192965260 X:76170473-76170495 TGGAGAAAACAGAAGGTGTCTGG + Intergenic
1193039144 X:76986564-76986586 GAGAGAAAAGAGGAAGAGGAGGG - Intergenic
1193236486 X:79113652-79113674 GAGAGAGAAGAGAAAGTGAATGG + Intergenic
1193398314 X:81012302-81012324 GAGAGAGAAGAGAAAGTGAAGGG - Intergenic
1193467015 X:81861817-81861839 TAGAGAAAAGAGAATGCTGATGG + Intergenic
1194792824 X:98172092-98172114 CAGACAAAAGAGAAGGTTCAAGG + Intergenic
1195038666 X:100993522-100993544 AATAGAGAAGAGAAAGTGGATGG + Intergenic
1195302302 X:103542634-103542656 TAGAGAAAAGAGGAGGTGCCTGG - Intergenic
1195328500 X:103777287-103777309 AAGGGAAAAGAGAAGATAGAGGG - Intronic
1195530563 X:105950481-105950503 TATAGAAAAGAGAAGTTTAATGG + Intronic
1196003540 X:110811597-110811619 TAGGGAAAAGATCAGGTAGATGG + Intergenic
1196032127 X:111102381-111102403 TGGAGACAGGAGAAGGTAGAGGG + Intronic
1196132997 X:112177765-112177787 TAGAGAAATAAGAAACTGGATGG - Intergenic
1196310097 X:114153803-114153825 CAGAGAAAAGAGAGGGAGAATGG + Intergenic
1196533833 X:116817702-116817724 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1196974487 X:121143138-121143160 GAAAGAGAAGAGAAGGTGGAGGG - Intergenic
1197521297 X:127500665-127500687 GAGAGAAAATAGAAGCCGGAAGG + Intergenic
1197734826 X:129843176-129843198 CAGGGAAACGAGAAGGTAGAAGG + Intronic
1198069585 X:133134846-133134868 AGGAGAAAAGAGAATGGGGAGGG + Intergenic
1198548256 X:137717268-137717290 TACACAAAAGAGAAGGAGAAAGG - Intergenic
1198596875 X:138245794-138245816 AAGAGAATAGAGAAAATGGAAGG - Intergenic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1198802217 X:140459567-140459589 TGGAGAATAGAGGAGGAGGAGGG + Intergenic
1199284580 X:146041958-146041980 GAGAGAAAAGAGAAAGGGAAGGG + Intergenic
1199297049 X:146171219-146171241 AGGAGAAAGGAGAAGGAGGAAGG - Intergenic
1199576160 X:149316084-149316106 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
1199680836 X:150223577-150223599 GAGAGAAAAGAGAAGGAACATGG + Intergenic
1199986379 X:152954950-152954972 TAGATTAAAAAAAAGGTGGAGGG + Intronic
1199990549 X:152985308-152985330 TAGAGAAAAGAGGACTTAGAGGG - Intergenic
1200033639 X:153314782-153314804 TAGAGAAAAGAGGACTTAGAGGG - Intergenic
1200683158 Y:6236420-6236442 AATAGAAAAGAGTAGATGGAAGG + Intergenic
1200808193 Y:7454320-7454342 AAGAGAAGAGAGGAGGTGAAGGG - Intergenic
1201049474 Y:9917966-9917988 AATAGAAAAGAGTAGATGGAAGG - Intergenic
1201254391 Y:12092614-12092636 AAGAGAAAAGAAAAGAAGGAAGG + Intergenic
1201514160 Y:14799179-14799201 TATGGAGAAGAGAAGATGGAAGG + Intronic
1201558591 Y:15290933-15290955 AAGAGAAAATAGAAGGTGCCAGG + Intergenic
1201896512 Y:18998025-18998047 GAGAGAAAAGAGACTGTGCATGG + Intergenic
1202273667 Y:23094715-23094737 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202292360 Y:23325966-23325988 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic
1202426663 Y:24728460-24728482 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202444126 Y:24941626-24941648 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic