ID: 969199528

View in Genome Browser
Species Human (GRCh38)
Location 4:5591509-5591531
Sequence CTGCAGAGGTGCAGAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 505}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969199520_969199528 -6 Left 969199520 4:5591492-5591514 CCATAAGACCCAGACCCCTGCAG 0: 1
1: 0
2: 2
3: 21
4: 319
Right 969199528 4:5591509-5591531 CTGCAGAGGTGCAGAGCAGAGGG 0: 1
1: 0
2: 5
3: 52
4: 505
969199519_969199528 -5 Left 969199519 4:5591491-5591513 CCCATAAGACCCAGACCCCTGCA 0: 1
1: 0
2: 1
3: 7
4: 113
Right 969199528 4:5591509-5591531 CTGCAGAGGTGCAGAGCAGAGGG 0: 1
1: 0
2: 5
3: 52
4: 505
969199518_969199528 3 Left 969199518 4:5591483-5591505 CCAAGTGTCCCATAAGACCCAGA 0: 1
1: 0
2: 1
3: 18
4: 144
Right 969199528 4:5591509-5591531 CTGCAGAGGTGCAGAGCAGAGGG 0: 1
1: 0
2: 5
3: 52
4: 505
969199516_969199528 27 Left 969199516 4:5591459-5591481 CCTCTTGGGTGGGTGGGTGGTGG 0: 1
1: 1
2: 6
3: 47
4: 331
Right 969199528 4:5591509-5591531 CTGCAGAGGTGCAGAGCAGAGGG 0: 1
1: 0
2: 5
3: 52
4: 505
969199515_969199528 28 Left 969199515 4:5591458-5591480 CCCTCTTGGGTGGGTGGGTGGTG 0: 1
1: 0
2: 2
3: 28
4: 318
Right 969199528 4:5591509-5591531 CTGCAGAGGTGCAGAGCAGAGGG 0: 1
1: 0
2: 5
3: 52
4: 505
969199514_969199528 29 Left 969199514 4:5591457-5591479 CCCCTCTTGGGTGGGTGGGTGGT 0: 1
1: 0
2: 2
3: 18
4: 246
Right 969199528 4:5591509-5591531 CTGCAGAGGTGCAGAGCAGAGGG 0: 1
1: 0
2: 5
3: 52
4: 505

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969199528 Original CRISPR CTGCAGAGGTGCAGAGCAGA GGG Intronic
900347185 1:2215389-2215411 ATGCAGAGGCGGAGAGCAGGAGG + Intergenic
900426884 1:2585016-2585038 CTCCAGTGATGCAGAGCAGAAGG - Intergenic
901006400 1:6173714-6173736 CGGCAGTGGTGAAGGGCAGAGGG + Intronic
901162722 1:7192378-7192400 CTGCGGAGGGGCAGAGCGGAGGG + Intronic
901436606 1:9250605-9250627 CTGCAGGGGTGGAGAGCAGCTGG - Intronic
901479963 1:9518453-9518475 CTGCGAAGGTGCAGAGGAGGGGG + Intergenic
901510824 1:9717315-9717337 CTGCAGAGGGGAAGGGCAGCCGG - Intronic
902595942 1:17509549-17509571 CTTCAGAGGGGCAGGGGAGAGGG + Intergenic
903832330 1:26182744-26182766 CTGGGGAGGTGCAGAGCAACGGG - Intronic
904376369 1:30084935-30084957 CTGCTCAGCTGCAGAGAAGAGGG - Intergenic
904480247 1:30788835-30788857 GTGCTGCTGTGCAGAGCAGAAGG + Intergenic
904556028 1:31365057-31365079 CAGCAGAGGTACAGAGCCAAAGG + Intergenic
905222981 1:36461655-36461677 CTGCATAGGAGCTGAGCAGAGGG + Intronic
905231011 1:36514958-36514980 CTGGAGAGGGGCACAGCAGTTGG + Intergenic
905629415 1:39510548-39510570 AGGCAGAGGGCCAGAGCAGAGGG - Intronic
905668343 1:39775645-39775667 AGGCAGAGGGCCAGAGCAGAGGG + Intronic
906056638 1:42923259-42923281 CTTCAGAGGCCCAGAGGAGAAGG + Intergenic
906940753 1:50253099-50253121 ATGCAGAGGTGCAGAGGTGCAGG - Intergenic
907029929 1:51160986-51161008 CTGCTGAGGTACAGAGAAAAGGG + Intergenic
907528640 1:55070549-55070571 CTGCTGAGTTGGAGAGAAGAGGG + Intronic
909482229 1:76138519-76138541 CTGCAGCGATGCAGAGTACAAGG - Intronic
911115084 1:94237992-94238014 GGGCAGAGGGGCAGAGTAGATGG - Intronic
912411416 1:109483320-109483342 CTGCCCTGATGCAGAGCAGAGGG - Intergenic
913047424 1:115086384-115086406 CAGCAGAGGAGCAGAGCAAGGGG - Intronic
913193024 1:116429688-116429710 CTCCAGAGGTGCAGAGAGGAAGG - Intergenic
913313227 1:117524993-117525015 ATGCAGAGCAGCAGTGCAGATGG + Exonic
913528538 1:119715907-119715929 CTGCAGAGGATGTGAGCAGATGG + Intronic
914352093 1:146849181-146849203 CCTCAGAGATGCAGAGCACAGGG - Intergenic
915669060 1:157472123-157472145 CTGCAGAGAGGCAGAGAGGAAGG + Intergenic
916156662 1:161856493-161856515 CTTCAGATGTGGAAAGCAGAAGG - Intronic
916213934 1:162380264-162380286 CTGCAGTGGTGCAGGCCACAGGG + Intronic
916455984 1:164971422-164971444 CAGCAGAGCTGCAGGGCAGAAGG + Intergenic
916627786 1:166577607-166577629 CTTCAGAGGTCCAGAGCTGTTGG + Intergenic
916805020 1:168250767-168250789 ATGCAGAGGAGCAGAACTGAAGG - Exonic
918470247 1:184865116-184865138 CTGGTGAGGTGCAGAGAAAAGGG + Intronic
918579968 1:186114636-186114658 ATGCAAAGGTGCATAACAGATGG - Intronic
919370347 1:196716615-196716637 TAGGGGAGGTGCAGAGCAGAAGG + Intronic
919468453 1:197950095-197950117 CTTCACATGGGCAGAGCAGAAGG + Intergenic
920340137 1:205270487-205270509 CTGCAGAGGCACAGAGCCAAGGG - Intronic
920912026 1:210227825-210227847 CTGGAAAGCTGCAGGGCAGATGG + Intergenic
920969945 1:210734646-210734668 GTGCAGAGGGGCAGAAGAGAAGG - Intronic
921189811 1:212699556-212699578 CTGCGGAGGTGCAGAGGTGGCGG - Intronic
922260276 1:223935745-223935767 ATGAAGAAGTGCAGAGCAAAGGG + Intergenic
922669906 1:227501762-227501784 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
922703929 1:227779043-227779065 CTGCAGAGGGGCTGGGCAGCTGG + Intronic
922763099 1:228144553-228144575 CTGCACAGCCGCAGAGCAGGTGG + Intronic
922966494 1:229695166-229695188 CTGCAGCAGTGCATGGCAGAAGG - Intergenic
923024243 1:230191901-230191923 CTGAAGAGGTGCTGAGCATGGGG - Intronic
923098199 1:230792329-230792351 CTGCAGAGGGGGAGGGCCGATGG - Intronic
923512879 1:234667820-234667842 CTGCAGTGGTGCAAAGGAGGTGG - Intergenic
923685881 1:236153310-236153332 CTGCAGAGATAGAAAGCAGATGG - Intronic
924350452 1:243109318-243109340 CTGAAGAAGGGCAGAGCAGTAGG + Intergenic
1063053415 10:2477294-2477316 CCTCAGGGGTGCAGGGCAGAGGG + Intergenic
1063133441 10:3197208-3197230 ATGCAGAGCTGCCGAGGAGAAGG + Intergenic
1063161721 10:3423445-3423467 CTGCAGCTCTGCAGAGCTGAGGG - Intergenic
1063659253 10:8022285-8022307 GTACCGAGGTGAAGAGCAGAGGG + Intergenic
1064026057 10:11849721-11849743 CGGCAGAAGTGTAGAGAAGAGGG + Intronic
1065176448 10:23080905-23080927 AATCAGAGTTGCAGAGCAGATGG - Intergenic
1067543921 10:47178257-47178279 CTGCTGAGGTTCAGGGCAGAGGG + Intergenic
1068159031 10:53239822-53239844 CTGCAGAGTTTCAGAGAGGAAGG - Intergenic
1068869039 10:61924092-61924114 CTGCAAGGATGCAGAGCACAGGG + Intronic
1069481431 10:68785760-68785782 CTGAAGAGGTTCAGGGAAGATGG - Intronic
1069746027 10:70715575-70715597 CTGCTGAGGTGGAGAGCTGAAGG + Intronic
1070407342 10:76108712-76108734 TTGGATAGGTGCTGAGCAGAGGG - Intronic
1070664012 10:78331070-78331092 CAGCAAAGGTGCAGAGCCCAGGG + Intergenic
1070838114 10:79464120-79464142 GTGCTGAGGTCCAGGGCAGAGGG + Intergenic
1071672133 10:87618672-87618694 CTCCCGGGGCGCAGAGCAGAGGG + Intergenic
1071801403 10:89066125-89066147 CTGCAGAGGCTCAGTGAAGAGGG - Intergenic
1072014049 10:91328308-91328330 CTGCTGTGGTGCTAAGCAGAAGG - Intergenic
1072582760 10:96753926-96753948 CTATAGAGGTGCAGAGGGGATGG + Intergenic
1074008980 10:109457211-109457233 CGGCAGCGGTGCAGAGCGGTGGG - Intergenic
1074147026 10:110725962-110725984 AGGCAGTGGTGCTGAGCAGATGG + Intronic
1074493810 10:113961027-113961049 GGGCAAAGGTGGAGAGCAGAGGG - Intergenic
1074538884 10:114348545-114348567 GTGCAGAAGTGCCCAGCAGAGGG - Intronic
1075122143 10:119672164-119672186 CTGAGGAGGTGCACAGCAGAAGG + Intronic
1075265854 10:120999179-120999201 CTGCAGCGGTGCAGAGCAAAGGG + Intergenic
1075296045 10:121276302-121276324 CAGGAGAGGTGCAGAGCCCATGG - Intergenic
1075803670 10:125169840-125169862 CTGCAGAGCTGAAGAGCACAGGG - Intergenic
1075999888 10:126905846-126905868 CGGCAGAGGTCCAGAGGAGCGGG - Intronic
1076128113 10:127992128-127992150 CAGGAGGGGTGCAGATCAGAGGG + Intronic
1076464056 10:130666382-130666404 CTGCAGAGTTGGGGTGCAGAGGG + Intergenic
1076512347 10:131021737-131021759 CTGCAGAGGCTCTCAGCAGATGG - Intergenic
1077303173 11:1856414-1856436 CTGCAGAGGAGCAGGGCGGTTGG - Intronic
1077503157 11:2918263-2918285 CTGCAGGTGTGCAGTGTAGAGGG - Intronic
1078965184 11:16331122-16331144 CTGCAGAGGAGGAGAGCATGAGG - Intronic
1079147031 11:17862094-17862116 CTGGAGGGGAGCAGAGCAGTGGG - Intronic
1079345944 11:19652365-19652387 CTGCAGAGGTGCTGAGGATGTGG + Intronic
1080745315 11:35103516-35103538 CTGCAGGGCCACAGAGCAGATGG - Intergenic
1080943726 11:36948129-36948151 AAGGAGAGGTGCAGAGCAAAAGG + Intergenic
1081690246 11:45073196-45073218 CAGCAGATGTGAAGTGCAGAGGG - Intergenic
1083560761 11:63671361-63671383 CAGCAGGGGTGCAGAGGAGAGGG + Exonic
1083610433 11:64001693-64001715 CTGCAGAGGAGAGGAGCAGGTGG - Intronic
1084209897 11:67616051-67616073 CAGCTGGGGTGCAGAGCGGACGG + Intergenic
1084315275 11:68342223-68342245 CAGCAGAGTAGCAGAGTAGAAGG - Intronic
1085568663 11:77539797-77539819 CAGCAGAGGTCCAGAGTAGTGGG - Intronic
1086192897 11:84101477-84101499 CTGCAGAGGTTAAGGCCAGATGG + Intronic
1086299003 11:85404036-85404058 CTACAGATTTGCAGAGTAGAGGG + Intronic
1086410205 11:86537600-86537622 CTGCAGAAATGCAGAGCTCAAGG + Intronic
1087522546 11:99259768-99259790 TTTCAGAAGTGCAGAGCAAAAGG - Intronic
1088447694 11:109949975-109949997 CTGCAGAGGTGGAGACCTCATGG - Intergenic
1089012840 11:115144669-115144691 CAGCAGAGGGGCTGGGCAGACGG + Intergenic
1089258215 11:117205356-117205378 CGGCAGGACTGCAGAGCAGATGG - Exonic
1089283824 11:117392989-117393011 CTGCTGAGCTGCAGGGGAGATGG - Exonic
1089777203 11:120846620-120846642 CAGCAAACGTGCATAGCAGAAGG - Intronic
1089972342 11:122704305-122704327 CAACAGAGGTAAAGAGCAGAAGG - Intronic
1090025248 11:123162030-123162052 ATGCAGAGATGCAGAGAACATGG + Intronic
1090080239 11:123607639-123607661 CTGCACAAGTGCAGCGCAGCGGG - Intronic
1090248446 11:125234641-125234663 ATGCAGGGGAACAGAGCAGAAGG - Intronic
1090694479 11:129224560-129224582 CTGTGGAGCTGCAGATCAGAGGG - Intronic
1091639308 12:2222893-2222915 CTGCAAAGGAGTTGAGCAGAGGG + Intronic
1091844022 12:3641448-3641470 CTGCAGAGCAGCAGAGGAGAGGG - Intronic
1092488998 12:8927603-8927625 CTGAAGAGGTGAAGAGTAGGAGG + Intronic
1092798624 12:12140231-12140253 CTTCAGAGGGGCAGAGCATTTGG + Intronic
1094814740 12:34171658-34171680 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
1095102192 12:38196924-38196946 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
1095309897 12:40686607-40686629 ATACAGAGGTGCAAAGGAGAAGG - Intergenic
1095440537 12:42235204-42235226 CTGGATAGCTGCAGAGCAGAAGG - Intronic
1096808073 12:54152457-54152479 GTGCTGAGGAGCTGAGCAGAGGG + Intergenic
1099037087 12:77602082-77602104 CTGCAGTGTTGCAGAGAGGAAGG + Intergenic
1099487777 12:83249485-83249507 CTGCAGGGGTGGAGAGCTCATGG + Intergenic
1101242017 12:102848351-102848373 CTGAAGAGGTGGAGGGTAGACGG + Intronic
1101356673 12:103985361-103985383 CTGCAGAGTGCCAGAGCAGAGGG + Intronic
1101444952 12:104730982-104731004 CTGCAGCAGTCCAGGGCAGAAGG - Intronic
1104114791 12:125738838-125738860 GTGCATAGTTGCAAAGCAGATGG + Intergenic
1104534170 12:129602901-129602923 ATGGAGAGGTGCTGAGCAAAAGG + Intronic
1105788301 13:23770918-23770940 ATGCAGAGGTACAGAGGAAAGGG - Intronic
1105964622 13:25372713-25372735 CTGCAGAGCTCAAAAGCAGAGGG + Intronic
1107002554 13:35566412-35566434 CTGCAGATGTGCAGGTCAGTGGG + Intronic
1107290076 13:38842026-38842048 TGGAAGATGTGCAGAGCAGAAGG + Intronic
1107959524 13:45545780-45545802 CTGCAGGAGAGCTGAGCAGAAGG + Intronic
1108454129 13:50596390-50596412 CTGCAGAGGTAAAGTGCAGCTGG + Intronic
1108716302 13:53081445-53081467 CTGCAATGGTGCTGAGCACATGG - Intergenic
1108735680 13:53281363-53281385 CTGCAAAGCTCTAGAGCAGAGGG - Intergenic
1112162320 13:96881168-96881190 GAGCTGAGATGCAGAGCAGAGGG - Intergenic
1113608059 13:111624299-111624321 GAGCAGGGGCGCAGAGCAGACGG - Intronic
1113901749 13:113801722-113801744 CTGCAGAGGCCCAGAGCAGGCGG - Exonic
1114424848 14:22612794-22612816 CCACAGAGATGCAGAACAGAGGG - Exonic
1114563997 14:23614716-23614738 CAACAGAGGGGCAGAGCAGTAGG - Intergenic
1118859815 14:69654044-69654066 CGGGACAGGTGCAGAACAGACGG - Intronic
1118906577 14:70027888-70027910 CTGCCGCCCTGCAGAGCAGAGGG - Intronic
1119145402 14:72309191-72309213 CTGGGGAGGTGCAGAGCAAAGGG - Intronic
1119418132 14:74488913-74488935 CTGCAGAAGTGCAGTGAAAATGG - Intronic
1119503149 14:75148019-75148041 CTACAGAGGAACAGAACAGAAGG + Intronic
1119745273 14:77039384-77039406 CTGCAGAGTTGTAAAGCAAAGGG - Intergenic
1120732291 14:88017301-88017323 CTGAAGAGCTGCAGTGGAGAAGG + Intergenic
1120748703 14:88177398-88177420 CTGCAGAGAGTCGGAGCAGAAGG - Intergenic
1121471314 14:94156497-94156519 ATGGAGAAGTGCAGAGCAAAGGG - Intronic
1121495361 14:94388428-94388450 CTGCTGAGGTGCAGGGCAGATGG - Intronic
1121560581 14:94872403-94872425 CTGGAAAGGTGCAGAGAAGAGGG - Intergenic
1121610352 14:95274486-95274508 CTGCAGCTGTGCTGGGCAGAGGG - Intronic
1121663854 14:95656935-95656957 CTGCAGAGGCCCTGATCAGAGGG - Intergenic
1122010892 14:98746042-98746064 AAGCAGAGGTGCAGGGCACAGGG - Intergenic
1122689780 14:103526691-103526713 CTGCAGAGGAGCAGACTACAAGG - Intergenic
1122825589 14:104368987-104369009 CTCCAGAGGAGGGGAGCAGATGG - Intergenic
1122837215 14:104436183-104436205 CTGCAGATGGGCGGAGCTGAGGG + Intergenic
1123452602 15:20379990-20380012 TTCCAGAGGTGCAAAGCATAAGG - Intergenic
1123500668 15:20878247-20878269 CAGGAGAGGTGCAGAGCAGGCGG + Intergenic
1123557913 15:21451940-21451962 CAGGAGAGGTGCAGAGCAGGCGG + Intergenic
1123594142 15:21889221-21889243 CAGGAGAGGTGCAGAGCAGGCGG + Intergenic
1123721323 15:23064236-23064258 CCGCAGGGGTGGAGAGCAGCAGG - Intergenic
1124118303 15:26867513-26867535 GAGGAGAGGTGCAGAGCAGGCGG + Intronic
1124200639 15:27676000-27676022 CTCCAGTGGTGCAGAGCAGCAGG - Intergenic
1124624001 15:31297789-31297811 CTGCACAGGTGTGGAGCAGGTGG - Intergenic
1125726618 15:41871510-41871532 GTGCAGAGGTGCTGAGAAGAGGG + Exonic
1126225157 15:46261821-46261843 CAGCTGATGTGCAGATCAGAGGG - Intergenic
1127572742 15:60260268-60260290 CAGAAGAGGTGAAGAGGAGAAGG - Intergenic
1127969325 15:63946232-63946254 CTGCTGTGGTGCCGACCAGAAGG + Intronic
1128161378 15:65424864-65424886 CTGGAGAGGTGGTGAGCACAGGG - Intergenic
1128539653 15:68517737-68517759 CTGGAGAGGTGAGGAGCAAATGG + Intergenic
1128756113 15:70185185-70185207 CTGCAGAGGTGAGAAGCAGAGGG + Intergenic
1128786459 15:70401029-70401051 CTGCAGGGAGGCAGAGCTGAGGG - Intergenic
1129392623 15:75228097-75228119 CTGCACTGGGGCAGAGCTGAGGG + Intergenic
1129458151 15:75686679-75686701 CTCCAGACATGCAGACCAGAAGG + Intronic
1129695669 15:77739459-77739481 CTGCAGAGGGGCACAGAAGTAGG - Intronic
1129725635 15:77900203-77900225 CTCCAGACATGCAGACCAGAAGG - Intergenic
1129779904 15:78263753-78263775 CTGATGATGTGCAGAGGAGAGGG + Intergenic
1130071365 15:80649129-80649151 CTGGAGCGATGCAGAGAAGATGG + Intergenic
1130277802 15:82491504-82491526 CTTCAGAAGTCCAGAGGAGAGGG - Intergenic
1130470131 15:84218689-84218711 CTTCAGAAGTCCAGAGGAGAGGG - Intergenic
1130477619 15:84333256-84333278 CTTCAGAAGTCCAGAGGAGAGGG - Intergenic
1130494146 15:84454874-84454896 CTTCAGAAGTCCAGAGGAGAGGG + Intergenic
1130592420 15:85223317-85223339 CTTCAGAAGTCCAGAGGAGAGGG - Intergenic
1130884314 15:88080771-88080793 CATCAGAGGTGGAGAGCAGCAGG + Intronic
1131016729 15:89063899-89063921 CTGCACAGCTGCACAGCAGAAGG - Intergenic
1131395600 15:92083292-92083314 CAGCAGAAGGGCAGAGCTGAGGG - Intronic
1131651971 15:94409932-94409954 CTGGAGAGAGGCAGAGTAGAGGG - Intronic
1131909165 15:97177543-97177565 CTGCCCAGGTGCTGAGCGGAGGG - Intergenic
1132117269 15:99146580-99146602 CTGGAGAGGTGCAGAACTGTGGG - Intronic
1132301653 15:100779789-100779811 CTGCAGAGGTGGAGAGTGCAAGG - Intergenic
1202966264 15_KI270727v1_random:179112-179134 CAGGAGAGGTGCAGAGCAGGCGG + Intergenic
1132645793 16:998726-998748 CTGGGTAGGTGCAGGGCAGAAGG + Intergenic
1132895634 16:2228169-2228191 CTGCAGACCTGCAGAGGATAGGG + Intronic
1132946632 16:2535253-2535275 CTGCAGGTGTGCACACCAGAAGG - Intergenic
1132969072 16:2676358-2676380 CTGCAGGTGTGCACACCAGAAGG + Intergenic
1133421822 16:5652978-5653000 CTGCTGAGCTGCTGTGCAGAAGG + Intergenic
1133561664 16:6956215-6956237 GTGCAGAGAGGCAGAGGAGAAGG + Intronic
1133619707 16:7514542-7514564 CTGCAGTGGAGCAGAGGGGATGG + Intronic
1134486362 16:14661869-14661891 CTGCAGAGGAGAAGAGTACAGGG - Intronic
1136009778 16:27355970-27355992 CTGCAAAGGGGCAGACTAGAGGG - Intronic
1136617540 16:31407812-31407834 CTGCGGAGGCGCTGAGCTGATGG - Exonic
1136704214 16:32172760-32172782 CTGGCGAGCTCCAGAGCAGAGGG - Intergenic
1136763695 16:32756646-32756668 CTGGCGAGCTCCAGAGCAGAGGG + Intergenic
1136804404 16:33113740-33113762 CTGGCGAGCTCCAGAGCAGAGGG - Intergenic
1137664184 16:50239264-50239286 CTGCAGAGGTGCTGGGGAGGTGG + Intergenic
1137725144 16:50651866-50651888 CAGGAGATGTGCAGAGAAGAGGG - Intergenic
1138347216 16:56327399-56327421 CTGAAGAGGCGCAGGGCAAAGGG + Intronic
1138412151 16:56849253-56849275 TTGCAGAGCTGCACAGCAGCAGG + Intronic
1139082456 16:63539640-63539662 TTGAACAGATGCAGAGCAGAGGG + Intergenic
1139344762 16:66295862-66295884 CTGCAGCCTTGCAGAGAAGAGGG + Intergenic
1139956934 16:70697659-70697681 CTGCAGAGGTGGGGAGGAGATGG - Intronic
1139981937 16:70866351-70866373 CCTCAGAGATGCAGAGCACAGGG + Intronic
1140962268 16:79927696-79927718 CTGCAGAGGTGTAGGCAAGAGGG - Intergenic
1141502100 16:84451420-84451442 CTGCGCAGGTGCACAACAGATGG - Intronic
1141656107 16:85417440-85417462 CTGGAGAGGGTCAGAGCACACGG + Intergenic
1141662014 16:85446570-85446592 CAGCAGGAGTGGAGAGCAGAGGG + Intergenic
1141848385 16:86626811-86626833 CTGCAGATGTGGGGAGAAGAGGG - Intergenic
1141994413 16:87627625-87627647 CTGCAAAGGAGCACAGCAAAGGG - Intronic
1203065845 16_KI270728v1_random:1016967-1016989 CTGGCGAGCTCCAGAGCAGAGGG + Intergenic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142510547 17:389921-389943 CTGGAGAGGATCAAAGCAGAAGG + Intergenic
1142956562 17:3526973-3526995 CAGCAGGGGAGCTGAGCAGAGGG + Intronic
1143693106 17:8587625-8587647 GTGATGAGGTGCAGAGCACAGGG - Intronic
1144433017 17:15212514-15212536 CTGCAGGGGTGAAGGGGAGATGG + Intergenic
1144968567 17:19093115-19093137 ATGTAGAAGTGCAGAGGAGAAGG + Exonic
1146186504 17:30727810-30727832 CTGCAGAATAGCAGCGCAGAGGG + Intergenic
1146285470 17:31571605-31571627 CTACAGAGGTGCAAGTCAGAGGG - Intronic
1146748581 17:35354524-35354546 CTCCATAGTTGCAGAGGAGAGGG + Intronic
1147137912 17:38444682-38444704 CTGAGGAGGTGCAGTGGAGAAGG + Intronic
1148334114 17:46830207-46830229 CTGCTGATGTGCATAGCAAAAGG - Intronic
1148848960 17:50545241-50545263 ATGCAGAGGAGCAGAGAAGAGGG - Intronic
1150178999 17:63095044-63095066 CTGCAAAGTTGCATAGCATAAGG - Intronic
1150714075 17:67556655-67556677 CAGCAGAGATTCAGACCAGATGG - Intronic
1151180582 17:72324771-72324793 CTGCAGAGTCACAGAGCAGGTGG + Intergenic
1151320964 17:73352206-73352228 CTGGGTAGGGGCAGAGCAGAGGG - Intronic
1151430839 17:74061632-74061654 CTGCAGAGGTGCTGAGTGCACGG + Intergenic
1151666034 17:75545578-75545600 CTGGGGAGGGGCAGGGCAGACGG - Intronic
1151976031 17:77483928-77483950 CTGCAGAGGTGCAGGCAAGGTGG + Intronic
1152015490 17:77747803-77747825 CTGCAGACGTGCCTGGCAGACGG - Intergenic
1152054657 17:78014867-78014889 CTGCTGATGAGCACAGCAGATGG + Intronic
1152614001 17:81329669-81329691 GGGCAGGGGTGCAGGGCAGATGG - Intronic
1152927407 17:83093646-83093668 CTGCAGAGCCGCAGAGCCGCCGG - Intronic
1153264155 18:3252299-3252321 CTTCAGAGTTGCAGGGAAGATGG - Intronic
1153368480 18:4286510-4286532 CTCCAGAATTTCAGAGCAGAAGG + Intronic
1153738473 18:8097877-8097899 ATGCAGTTGTGCAGAGCATAAGG + Intronic
1155940920 18:31801235-31801257 CTCCAGAACTGCACAGCAGAGGG - Intergenic
1156033658 18:32742659-32742681 GTGCACAGGGGGAGAGCAGAGGG - Intronic
1157274065 18:46297819-46297841 CTGCACAGTTGCAGACCACAAGG + Intergenic
1157473608 18:48008010-48008032 CTGGAGAGGGGAAGAGCACAGGG - Intergenic
1157598050 18:48875684-48875706 CTGCAGAGATGGAGACTAGATGG - Intergenic
1158300434 18:56046284-56046306 GTGCAGAGGTGGTGAGAAGAAGG - Intergenic
1158422251 18:57305380-57305402 CTACAAATGAGCAGAGCAGATGG - Intergenic
1158652853 18:59303170-59303192 CAGCAGTGGGGCACAGCAGAAGG - Intronic
1160879013 19:1311146-1311168 CCCCAGAGGTCCAGGGCAGAGGG + Intergenic
1161470793 19:4455998-4456020 CTGCAGTGGTGGACAGGAGAAGG - Intronic
1161727707 19:5939849-5939871 CTGCAGAGGTGCAGGGACAAGGG - Intronic
1162438957 19:10680922-10680944 CTGAGGAGGGGCAGAGCTGAAGG - Intronic
1162972338 19:14188247-14188269 CTGCAGAATAGCAGCGCAGAGGG - Intronic
1163153483 19:15428106-15428128 CTACAGAGGTTGAGAGGAGACGG + Intronic
1164990555 19:32679492-32679514 GGGCAGAGGTGGATAGCAGAAGG + Intergenic
1164998668 19:32742983-32743005 CTGTAGAAGTGCTGAGCAGGAGG + Intronic
1165757735 19:38304195-38304217 CTGCAGAGGAGCGGAGCAGGGGG - Exonic
1165915512 19:39256644-39256666 CCTCAGAGGTGCAGATCAGGAGG - Intergenic
1166568127 19:43777558-43777580 CTGCAGGGGGGCAGAACCGAGGG - Intronic
1167329042 19:48842948-48842970 CTGCCAAGGTCCAGAGCACAGGG - Intronic
1168304718 19:55429296-55429318 CCGCGGAGGTGTTGAGCAGAGGG + Exonic
925279785 2:2675549-2675571 CTTTAGAGGTACAGAGGAGATGG - Intergenic
926218770 2:10921599-10921621 CTGCAGAGGTGCATCCCAGCTGG - Intergenic
926660870 2:15464628-15464650 GTGAAGAGGGGCAGAGAAGATGG - Intronic
927405164 2:22758169-22758191 CTGAAGAGGTGCTGAGCAGAAGG - Intergenic
927441483 2:23121574-23121596 CTGCAGCACTGAAGAGCAGAGGG - Intergenic
927506689 2:23619591-23619613 CTGCTGGGGTGCAGAACACAGGG + Intronic
927684957 2:25164082-25164104 CTGTAGAGGAACACAGCAGAAGG + Intronic
927721699 2:25387379-25387401 CTGAGGAGAGGCAGAGCAGATGG + Intronic
928084786 2:28339218-28339240 CTGCAGAGGCCCAGAGGGGATGG - Intergenic
932586375 2:73032296-73032318 CAGCAGAGGCACAGAGGAGATGG - Intronic
932813779 2:74845385-74845407 CTGCGGAGCAGCAGAGCAAAGGG - Intronic
933184598 2:79264966-79264988 CTGTACAGAAGCAGAGCAGATGG - Intronic
933355311 2:81202340-81202362 CAGCAGAGCTCCAGAGTAGATGG + Intergenic
933900541 2:86846591-86846613 CTCTAGGGGAGCAGAGCAGATGG - Intronic
935341004 2:102059890-102059912 CTGCGGAGGTGGACTGCAGATGG + Intergenic
935368518 2:102320273-102320295 CTGCAGAGGTGGTGAGCATCTGG - Intronic
935400197 2:102652362-102652384 CTGCAGGGGAGCAGAGGGGAGGG - Intronic
935656649 2:105429053-105429075 CTGCAGAGGAGAAGGGCAGAAGG + Intronic
935780006 2:106502634-106502656 CTCTAGGGGAGCAGAGCAGATGG + Intergenic
935815579 2:106843462-106843484 CTGCACAGGTCCAGAGGAGGCGG - Exonic
936038997 2:109135023-109135045 CAACAGAGGAGCAGAGCAGAAGG - Intronic
936251835 2:110873615-110873637 CTGCTCAGCTTCAGAGCAGATGG + Intronic
936832807 2:116669584-116669606 ATGCATATGTGCAGAGCTGAGGG - Intergenic
937268292 2:120631027-120631049 CTTCAGAAGAGCAGAGCAGGGGG - Intergenic
937376470 2:121339270-121339292 ATGCAGAGGGTCAGGGCAGAGGG + Exonic
938292948 2:130160006-130160028 CAGGAGGGGTGCAGAGCTGAGGG - Intronic
938386368 2:130870096-130870118 CTGCAGGGGTTGACAGCAGAGGG - Intronic
938463605 2:131512958-131512980 CAGGAGGGGTGCAGAGCTGAGGG + Intergenic
938764044 2:134448742-134448764 CTGCACAGCTGAAGAGCAGGAGG - Exonic
939004002 2:136765439-136765461 GCGCAGAGGTGTACAGCAGATGG + Intergenic
939146529 2:138422034-138422056 CTGCAGAAGCACAGTGCAGAGGG + Intergenic
940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG + Intergenic
941250594 2:163156863-163156885 CTTCACAGGGCCAGAGCAGAAGG - Intergenic
941469309 2:165864602-165864624 TAGCAGAGCTGCAGAGCTGATGG - Intronic
943449649 2:188032389-188032411 GGGCAGAGTTGCAGAGCATAAGG - Intergenic
944352622 2:198746530-198746552 CAGGAGAGGAACAGAGCAGAGGG - Intergenic
945777085 2:214118564-214118586 CGGCAGAAGTGCTGAGCAAAAGG + Intronic
946010611 2:216560725-216560747 CTGCCAAGGTGGAGAGCAAATGG + Intronic
946171327 2:217897730-217897752 ATGTAGAGGTGGTGAGCAGATGG + Intronic
946194397 2:218024475-218024497 CTGCAGAGGTGGGGAGCTGATGG + Intergenic
946569877 2:221012686-221012708 CTGCAAAGTTGCATGGCAGAAGG - Intergenic
947848182 2:233262528-233262550 CTGGAGAGGTGTACAGCAGGTGG - Intronic
948902613 2:240964056-240964078 GTGCAGAGCTGGGGAGCAGAGGG + Intronic
949058744 2:241944292-241944314 ATTCTGAGGTGCAGAGCAGATGG + Intergenic
1168773785 20:432415-432437 CTGCAGTGGTGCGGAGGAGCAGG + Intergenic
1169256868 20:4106307-4106329 CTGCAGTGGGGCAGAGGGGATGG + Intergenic
1169275174 20:4228877-4228899 CTGGAGACGTGGAGAGAAGAAGG - Intronic
1169491815 20:6077437-6077459 CTGCTGAGGTGGATAACAGATGG + Intronic
1171046111 20:21810273-21810295 CTGCTGGGGTGCAGCCCAGATGG - Intergenic
1171244506 20:23600738-23600760 CTGAGGAGCTGCAGTGCAGAGGG + Intergenic
1171304814 20:24096174-24096196 GTGGAGAGGGGCACAGCAGAAGG - Intergenic
1171776510 20:29373174-29373196 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
1171817785 20:29803680-29803702 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
1171900452 20:30851591-30851613 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
1173932363 20:46831356-46831378 CAGCACTGGAGCAGAGCAGAAGG + Intergenic
1174572043 20:51508869-51508891 CTGCAGAGGCCCAGGCCAGAGGG - Intronic
1175428173 20:58883672-58883694 CTGCTGAGTGGGAGAGCAGAGGG + Intronic
1175542192 20:59754871-59754893 CTGCAAAGGTGCACGGCAGTGGG + Intronic
1175787403 20:61720553-61720575 GTGCAGGGGTGCAGAGTACAGGG + Intronic
1176222534 20:63976821-63976843 CTGCGGAGATGAAGAACAGAGGG + Intronic
1176231661 20:64036163-64036185 CTGCAGAGGGGCAGGCCAGGCGG - Intronic
1176232956 20:64041382-64041404 CTGCAGAGGCCCAGGGCAGGTGG + Intronic
1178403298 21:32305515-32305537 CTGCAGAAGTTCAGAGGAGGAGG + Intronic
1178404489 21:32313028-32313050 CTCCAGAGATGCAGAAAAGAAGG + Exonic
1178906429 21:36640873-36640895 CTGCAGAGGGGAAGGGCAGATGG + Intergenic
1179484666 21:41702231-41702253 AAGGAGAGGTGCCGAGCAGAAGG + Intergenic
1179493190 21:41754947-41754969 GAGCAGAGGTGCAGAGTGGACGG - Intronic
1179545949 21:42112273-42112295 CTGGGGAGGTGCAGAACAGCTGG - Intronic
1179976618 21:44872005-44872027 CTTCAGCAGTGCAGAGCAGGAGG + Intronic
1179984706 21:44913950-44913972 CGGCAGAGCTGCAGGGCAGGAGG + Intronic
1180321233 22:11323169-11323191 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
1180333810 22:11557576-11557598 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
1181074175 22:20364000-20364022 TTGCAGAGGTGCAAACCACATGG + Intronic
1181125403 22:20698935-20698957 CTGTAGAGGACCAAAGCAGAAGG + Intergenic
1181284071 22:21739566-21739588 CTGAAGAGTTGCAGAGCAGGTGG - Intergenic
1181635664 22:24173227-24173249 CTGCAGAAGTGCCCAGCAGAAGG + Intronic
1181928706 22:26381467-26381489 CTGAGGAGGTGCAGAGAACAGGG + Intronic
1182421139 22:30249091-30249113 CTCCAGAGGCCCAGAGCAGGTGG - Intergenic
1182697632 22:32207298-32207320 CTGCAGAGTGCCAGAGCAGTAGG + Intergenic
1182894527 22:33848435-33848457 CTGCAGGGGTGCAGGGCTGGGGG - Intronic
1183516823 22:38271813-38271835 GTTCAGAGGTGCAGAGCCTAGGG + Intronic
1183581736 22:38730534-38730556 GAGCAGAGGTGCTGAGCAGCGGG - Intronic
1184390608 22:44201162-44201184 CTGCAGAGGAGCTGAGAAGGTGG - Intronic
1184553167 22:45216414-45216436 ATGCAGGGCAGCAGAGCAGAGGG - Intronic
1185184953 22:49393460-49393482 CTTCAGAGGGGCTTAGCAGAGGG + Intergenic
1185199711 22:49494221-49494243 ATGCAGAGAGGCAGAGCCGAAGG + Intronic
949841151 3:8321419-8321441 CTGCAAAGCTGCAGAGAAAAGGG + Intergenic
950507840 3:13406765-13406787 CTGCTGAGGTGCAGAGAAGAAGG - Intronic
950570328 3:13795940-13795962 CTGAAGAGGAGCAGGGCAGGAGG + Intergenic
950613601 3:14141542-14141564 CTGGTGAGGTGTAGAGCAGGTGG + Intronic
951044442 3:18022601-18022623 CTTCTGAGGCCCAGAGCAGAAGG - Intronic
951159954 3:19407434-19407456 CTGCGTAGGTGTGGAGCAGAGGG - Intronic
951473050 3:23077084-23077106 ATGCAGAGGTGCAGAAAACAGGG + Intergenic
952144309 3:30515018-30515040 CTGCAGAGGTGCCAAGTAAAAGG - Intergenic
953231118 3:41065869-41065891 TGGCAGAGGGGCTGAGCAGAAGG - Intergenic
953749823 3:45600659-45600681 CTGCAGAGGTGGGGTGCAGAGGG + Intronic
954111017 3:48433083-48433105 CCGCACAGCTGCAGAGAAGAGGG + Exonic
954304381 3:49717739-49717761 CTGTGCAGGGGCAGAGCAGAAGG + Exonic
954541936 3:51399141-51399163 CTGCAAAGGGGCAGAGCTGACGG + Intronic
954542118 3:51400425-51400447 CTGCATAGCTGCTGGGCAGAAGG - Intronic
955407812 3:58636421-58636443 CTGCAGAGGACCAGAGAGGATGG + Intronic
955418056 3:58711123-58711145 ATGCTGAGCTGCAGAGCAGGTGG - Intergenic
955719743 3:61868101-61868123 ATGAAGAAGTGCAGAGGAGAAGG + Intronic
955779811 3:62472544-62472566 GTGAAGAGGTGCAGAGCAGAGGG + Intronic
955956431 3:64294464-64294486 CTCCAGAGGTGCACAGCTGATGG - Intronic
956657515 3:71566793-71566815 CTGAAGATGAGCAGAGCAGGTGG - Intronic
957083948 3:75663298-75663320 CAGCAGAGGGGGAGAGAAGAAGG + Intergenic
957088576 3:75706479-75706501 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
960246514 3:115405724-115405746 CTGCAGAGATGAAAACCAGAAGG + Intergenic
960812363 3:121637029-121637051 GGGCAGATGTGCAGAGCAGGGGG - Intronic
962051849 3:131824528-131824550 CTGCAGAGGTTAAGACCAGTCGG + Intronic
962215526 3:133517661-133517683 CTGCAGAGTTACACAGCAGAGGG - Intergenic
962346631 3:134623700-134623722 CTCCAGAGGGGCAGTGCACAGGG - Intronic
962583774 3:136820367-136820389 TGGCAAAGGTGCAGAGTAGAAGG - Intronic
962940605 3:140121535-140121557 TTGCAGAGATGCAGAGAAAAGGG + Intronic
962979007 3:140470973-140470995 CTGCTGCGGTGCGGGGCAGAGGG - Intronic
962981861 3:140497937-140497959 CTGGAGTGGTGCAGAGCCAAAGG - Intronic
963016085 3:140825341-140825363 CTGCAGAGGTACAAAGGATAAGG - Intergenic
963018404 3:140848106-140848128 CTGCACTGGTGCCCAGCAGAAGG - Intergenic
963234956 3:142947379-142947401 CTCCAGCGGCGCAGAGGAGAGGG - Intergenic
963606449 3:147415581-147415603 GTGTGGAGGTGCAGAGCAGGTGG + Exonic
963922994 3:150923941-150923963 CTGCAGAGGAGTAGGGCAAAGGG + Intronic
965466035 3:169031739-169031761 ATGCAGGGATGCAGAGCAGCAGG - Intergenic
965554969 3:170009302-170009324 CTCCAGAAGTGGAGAGCTGAGGG + Intergenic
965644413 3:170865023-170865045 CTGCAGCGGTGCACAGTAGTAGG + Exonic
966010345 3:175067599-175067621 CTGCAGGGCTGCAGAGAAAAAGG + Intronic
967073777 3:185984030-185984052 CTCCAGGAGTGCAGAGCACAGGG + Intergenic
967289834 3:187908629-187908651 CTGCAGGAGTGCAGAGAATATGG - Intergenic
968357315 3:198119602-198119624 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
968582687 4:1402331-1402353 CTGCAGGGGTGGGGAGCAGGAGG + Intergenic
968739879 4:2322106-2322128 CTGCAGAGCTGCTGAGCAGCAGG - Intronic
968762854 4:2451345-2451367 CTGCAGAGGTGAAGGGCGGCAGG + Exonic
968910874 4:3476392-3476414 TTGCAGAGGTGCAGGGTAGCCGG - Exonic
968982456 4:3857613-3857635 CTGCAGGGGTGCAGAGATGCAGG + Intergenic
969056890 4:4407838-4407860 CTGCGAAGGTGCAGAGCTGCAGG + Intronic
969199528 4:5591509-5591531 CTGCAGAGGTGCAGAGCAGAGGG + Intronic
969252048 4:5974372-5974394 CTGGAAAGGTGCAGAGCGGACGG - Intronic
969269599 4:6090254-6090276 CTGCAGACATGCAGGGGAGAAGG + Intronic
969926821 4:10593232-10593254 CTGCAGAGGCTCAGGGCAGGCGG + Intronic
970672211 4:18410044-18410066 CTACAGAGTTACAGAGCAAAGGG - Intergenic
972395560 4:38656413-38656435 CTCCAACAGTGCAGAGCAGAAGG - Intergenic
976351445 4:84064530-84064552 CTGGAGAGGTGGACAGCAGCAGG + Intergenic
977657297 4:99536686-99536708 ATGTAGAGGAGCAGGGCAGATGG + Intronic
978340740 4:107719710-107719732 CTGAAGATGTGCAGAGAAGGCGG - Intronic
979085397 4:116403523-116403545 GGGCAGAGGTGCAGAGAAGAGGG + Intergenic
979251487 4:118571239-118571261 CTGAAGAAGGGCAGAGCAGTAGG - Intergenic
979721472 4:123905295-123905317 CTGCAGGGGTGCAGACCTCACGG + Intergenic
979972541 4:127154806-127154828 CTGCACAGGAGGTGAGCAGAAGG + Intergenic
980405002 4:132344656-132344678 CAGCAGAGCAGCAGAGCAGCTGG - Intergenic
980961130 4:139477181-139477203 ATGCAGATGTGCAGAGAAGCTGG - Intergenic
981944342 4:150323806-150323828 CTGCAGATGAGCAGAGCAACTGG + Intronic
982069479 4:151682911-151682933 GTGCAGAGGAGGGGAGCAGAAGG - Intronic
982882725 4:160740728-160740750 CTGCAGAGGTGCAGAGTGTGTGG - Intergenic
983738607 4:171096448-171096470 CTGCAGAGTTACAGAGAAAAAGG + Intergenic
984814373 4:183822985-183823007 CTCAGGAGGTGCACAGCAGATGG - Intergenic
985017392 4:185650951-185650973 CTCCAGGGGTGCAGAACAGGAGG + Intronic
985164418 4:187077731-187077753 CTGCATAGGTGGAGAGAAGCTGG + Intergenic
985442071 4:189989244-189989266 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
985657961 5:1141991-1142013 CTGCAGGGCTGCAGGGAAGAGGG - Intergenic
985823592 5:2177546-2177568 CTGCAGATGGGCTGAGCAGGGGG - Intergenic
986074948 5:4326862-4326884 CAGCAGAGGTGGAGGGCAGCAGG - Intergenic
986220794 5:5767050-5767072 CTGCAGATGAGCAGAGGAGGAGG + Intergenic
986238735 5:5937710-5937732 CTGCTGAGGTGGAGAATAGAGGG + Intergenic
986292974 5:6415196-6415218 ATGCAGAGATGCAGAGGGGAAGG - Intergenic
986576106 5:9214379-9214401 CTGCAGAGGTGCAGAGGATCAGG + Intronic
986751763 5:10793995-10794017 CTGCATGTTTGCAGAGCAGATGG - Intergenic
986776754 5:11022439-11022461 CTGAAGAGGCACAGAGCAGAGGG + Intronic
988618953 5:32802869-32802891 CTGTAAATGTGCAGAGAAGATGG + Intergenic
989179463 5:38562136-38562158 ATGGAGAGGGGCAGAGCAGAGGG - Intronic
989240672 5:39200186-39200208 AGGCAGAACTGCAGAGCAGACGG - Intronic
990898172 5:60722167-60722189 GTGGAGAGGTGCAGAGTAAAGGG + Intergenic
992027168 5:72681613-72681635 CTGCTGAGATGAAGACCAGAAGG - Intergenic
996108975 5:119542673-119542695 CTGCAGAGGTGACCAGCAGCAGG + Intronic
997355141 5:133257679-133257701 TTGCTGAGGTGGAGAGCACAGGG + Intronic
997446396 5:133943408-133943430 CTGCAGAGGGCCAGGGCAGTCGG + Intergenic
998524446 5:142829516-142829538 CTAGAGATCTGCAGAGCAGAGGG + Intronic
1000681940 5:164196045-164196067 CTGAAGAGGTAGAGAGAAGATGG - Intergenic
1000777586 5:165439837-165439859 TTGCAGATGTGCAGAGCTGCTGG + Intergenic
1001113309 5:168917036-168917058 CTTCAGAGGTACAAAGGAGACGG + Intronic
1001267384 5:170283747-170283769 CGGCAGTGGGGCAGAGCAGCTGG - Intronic
1001305964 5:170573030-170573052 CTGCTAAGCAGCAGAGCAGAGGG + Intronic
1001701939 5:173713012-173713034 CTGCAGCGAGGCAGAGCATAGGG + Intergenic
1002529115 5:179833314-179833336 CTGCAGAGGTGCTGAGGATGAGG - Intronic
1002837450 6:876895-876917 CTGAAGTTCTGCAGAGCAGACGG + Intergenic
1003012609 6:2439787-2439809 CTGCAGAGGGGCTCAGCACAGGG + Intergenic
1003226198 6:4208103-4208125 CTGCAGAGGTGCTCAGGTGAAGG - Intergenic
1003402875 6:5805387-5805409 AAGCAGAAGTGCAGAGCAAAGGG - Intergenic
1003737335 6:8891303-8891325 TTGCAGAGGAGAAGAGGAGAGGG - Intergenic
1005308146 6:24533538-24533560 CTGGAGAGTGGCAGAGCAGCTGG + Exonic
1005597581 6:27394288-27394310 CTGGAGTGGTGCAGGGCAGTGGG - Intronic
1007284772 6:40739684-40739706 GAGCAGAGGCGCAGAGTAGAAGG - Intergenic
1008488939 6:52065334-52065356 GTGCAGAGCAGCAGAGCATAGGG + Intronic
1009317792 6:62243789-62243811 CTGCAGAGCTGCTGAGAGGATGG + Intronic
1010354714 6:74918663-74918685 GTGCTCAGATGCAGAGCAGAGGG + Intergenic
1011708789 6:90029970-90029992 TTGCAGAGATGCTGAGTAGAAGG + Intronic
1013176483 6:107681881-107681903 TTGCAGAGGTGCAGAAAAAAAGG + Intergenic
1013824811 6:114198564-114198586 CTGCCGATGTGTAGAACAGAAGG - Intronic
1014457253 6:121650193-121650215 CTGCAAGGAGGCAGAGCAGAGGG + Intergenic
1015573494 6:134646369-134646391 CTGCAGTGTAGCAGAGAAGAAGG - Intergenic
1015594245 6:134851085-134851107 CAACAGAGATGCAGAGCAGCAGG + Intergenic
1016117389 6:140303776-140303798 CTGCAGAGAAGGAGAGCAGAGGG - Intergenic
1017032786 6:150238687-150238709 GTGCTGAGATGCAGAGCAGAAGG - Intronic
1017989195 6:159471377-159471399 CTGCAGCAGTGCAGGGCAGTGGG + Intergenic
1018739511 6:166716587-166716609 ATGCAGCCGTGCAGTGCAGAGGG - Intronic
1019255451 7:46882-46904 CTGCAGAGGAGCAGAGGAAGTGG - Intergenic
1019435602 7:1020747-1020769 CTGCAGGGGTGGTCAGCAGACGG - Intronic
1019444444 7:1063978-1064000 CTGCAGAGGTGGGGGGCAGGGGG + Intronic
1020148918 7:5666643-5666665 CTTCAGAGGCGCAGCTCAGAAGG - Intronic
1020277544 7:6634078-6634100 CTGCTGAGGGGCTGAGGAGACGG - Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022125286 7:27350222-27350244 CAGCAGAGGGGCAGAGTAGCTGG - Intergenic
1022494697 7:30845590-30845612 CCCCAGAGCCGCAGAGCAGATGG - Intronic
1023368516 7:39489204-39489226 CTGCAGAGGAGCAGGGAAGGAGG - Intronic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1023881363 7:44323410-44323432 CTCCAGAGGTGGAGACCAGGTGG - Intronic
1024432109 7:49300993-49301015 CTGTAGAGGAGCAGACAAGATGG - Intergenic
1026675256 7:72423396-72423418 CAGCAGAGGGGCAGGGCAGGAGG + Intronic
1026846757 7:73703018-73703040 TTGCTGAGGGGCAGGGCAGAGGG + Intronic
1027302231 7:76851838-76851860 CTACAGCAGAGCAGAGCAGAGGG - Intergenic
1027865205 7:83637633-83637655 CAGAAGAAGTGCAGAGCAAAAGG - Intronic
1028514748 7:91664774-91664796 GTGCTCAGGTGCAGGGCAGATGG - Intergenic
1029477304 7:100792579-100792601 CAGCAGAGGTGGACGGCAGAGGG - Intronic
1029551891 7:101240907-101240929 CTGGGGAGGGGCAGAGAAGAGGG + Intronic
1029580837 7:101435816-101435838 TTCCAGATGTGCTGAGCAGAGGG + Intronic
1032285993 7:130538873-130538895 CTACAGAGGTGCAGTGAAGTAGG + Intronic
1033168102 7:139058728-139058750 CTGGAGAGGGGAAGAGCAAATGG + Intronic
1033601533 7:142892313-142892335 CTGCAGCTGGGCAGAGCAGGTGG - Intergenic
1034234751 7:149557885-149557907 CTGGTGAGCTGCAGAGCTGAGGG + Intergenic
1034298130 7:149992179-149992201 CAGCACAGGTCCAGAGCCGAAGG + Intergenic
1034873660 7:154705996-154706018 CTGCATAGGGGCCGAGTAGAGGG - Intronic
1034873868 7:154707533-154707555 CTGGCGAGGTGCTGAGCAGTTGG - Intronic
1035285855 7:157806894-157806916 CTGCTGAGGTGCAGGTCTGATGG - Intronic
1035415826 7:158684912-158684934 GTGCAGAGGAGCAGAGAGGATGG + Intronic
1035534685 8:382037-382059 CTGCAGAGGTTCAGGGCCAAGGG - Intergenic
1035691148 8:1560885-1560907 CCGCAGAGCTGCAGAGCTGTAGG - Intronic
1035902965 8:3477881-3477903 CTGCAGAGGGCCAGGGCAGGTGG + Intronic
1037581477 8:20248390-20248412 CTGCAGATGTGCGGAGCGGGAGG - Exonic
1037654109 8:20868193-20868215 TTGCAGTGGGGCAGAGCAGCTGG - Intergenic
1038665329 8:29532514-29532536 CTGCAGAGAGGCTGAGCTGAGGG - Intergenic
1040105934 8:43541983-43542005 GTGGAGAGGGGCAGAGGAGAAGG - Intergenic
1041750946 8:61260514-61260536 ATGGAGAGGTGGAGAGGAGATGG - Intronic
1041774929 8:61513550-61513572 CTGAAGAGTTGCTGAGCACAGGG - Intronic
1042787069 8:72559546-72559568 CTGGAGAGATCCAGGGCAGAAGG + Intronic
1044265513 8:90176905-90176927 TTTCAGAGTTGCAGAGCATAAGG - Intergenic
1046567234 8:115917507-115917529 CAGCAGAGCGGCAGAGCAGCAGG + Intergenic
1047766022 8:127990764-127990786 ATGCAGAGGTGAAGAGCATGAGG + Intergenic
1047771402 8:128032962-128032984 CTGCAGAGGTGCATGGTGGAGGG + Intergenic
1049198955 8:141330647-141330669 CTGCAGAGGCGCTGGGCAGAAGG - Intergenic
1049415657 8:142493728-142493750 CTGCCCAGTTCCAGAGCAGAAGG - Intronic
1049840329 8:144766939-144766961 CTGGAGAGGGGCAGGGGAGAGGG - Intergenic
1052917355 9:33933546-33933568 CGGCAGAAGTGCAGTGCAGGAGG + Exonic
1055402705 9:75941524-75941546 CTGCAGATGTGCTGATCAGGAGG + Intronic
1055501351 9:76905704-76905726 CAGACGAGGTGCAGAGCTGAAGG - Intronic
1057035706 9:91810521-91810543 CAGCTGAAGTGCAGAGCAGAGGG - Intronic
1057716819 9:97502052-97502074 GTGCGGAGGTCCAGAGCGGAGGG - Intronic
1057739118 9:97696860-97696882 CAGCCGAGGTGCAGCGAAGAAGG + Intronic
1057918318 9:99074771-99074793 CTGAGGAGGTGGAGAGCAGGTGG - Intergenic
1060010013 9:120035609-120035631 CTGCAAAGTTGCAGAGCACAGGG + Intergenic
1060732703 9:126048350-126048372 CTGCAGAGGCACAGAGGGGAGGG + Intergenic
1060927956 9:127468376-127468398 CAGGAGAGATGCACAGCAGAAGG + Intronic
1061650148 9:132041055-132041077 CAGCAGAGAAGAAGAGCAGAAGG + Intronic
1061754478 9:132803070-132803092 CAGGAGAGGTGCAGAGCGAAGGG + Intronic
1061759073 9:132837364-132837386 CAGCAGAAGGGCAGAGCAGAAGG - Intronic
1061787179 9:133036659-133036681 CTTCAGAGGTCCACAGAAGAGGG + Intronic
1061867311 9:133499479-133499501 CGGCAGAGCTGCAGAGGAGGGGG - Intergenic
1061868640 9:133508197-133508219 CTGGGGAGGTGCAGGGCACAGGG + Intergenic
1062066229 9:134527823-134527845 ATGCAGAGATGCATTGCAGAAGG + Intergenic
1062109995 9:134777118-134777140 CTTCAGACGTGCAAGGCAGAGGG - Intronic
1062562550 9:137148044-137148066 CTGCAGACGTGCCGAGGAGGTGG + Intronic
1203369445 Un_KI270442v1:288942-288964 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
1185431616 X:14682-14704 CTGCAAAGGGGCGGAGAAGACGG - Intergenic
1185432879 X:19697-19719 CTGCAAAGGGGCGGAGAAGACGG - Intergenic
1185440940 X:227401-227423 CTGCAAAGGGGCGGAGAAGACGG - Intergenic
1185442231 X:232519-232541 CTGCAAAGGGGCGGAGAAGACGG - Intergenic
1186188964 X:7050550-7050572 CTGCACAGTTGCAGAGCCAATGG - Intronic
1186503219 X:10068703-10068725 CTGCAGAGATGGAGATAAGATGG - Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1191070783 X:56397779-56397801 CAGCATAGGTGCAGAGGAGGGGG + Intergenic
1193102660 X:77633314-77633336 CTGCAGAGGTGGCAAGAAGATGG - Exonic
1193969339 X:88032503-88032525 CTGGTGAGGTGCAGAGAAAAGGG + Intergenic
1194511907 X:94807095-94807117 CTGGAAAGGTGCAGAGAAGAAGG - Intergenic
1195442866 X:104918520-104918542 TTGGAGAGGTGCAGGGCAAAGGG + Intronic
1195775815 X:108405104-108405126 CTGAGGAGGTGCAGAGGATAAGG - Intronic
1195791134 X:108587753-108587775 CTGCAAGGATGCAGAGAAGAGGG - Intronic
1196157176 X:112443111-112443133 CTGCAGAGATAGAGAGTAGAAGG - Intergenic
1197192194 X:123660122-123660144 TTGCAGAGATGAAGGGCAGAAGG - Intronic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199682599 X:150237359-150237381 CTGCACAGGTGCAGACATGATGG - Intergenic
1201068834 Y:10126018-10126040 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
1201759711 Y:17523413-17523435 CTGAAGGGGTGGAGAGCACAAGG + Intergenic
1201841843 Y:18382577-18382599 CTGAAGGGGTGGAGAGCACAAGG - Intergenic