ID: 969199614

View in Genome Browser
Species Human (GRCh38)
Location 4:5592435-5592457
Sequence GTAACTAGTCAGATGTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 19, 3: 103, 4: 304}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969199611_969199614 22 Left 969199611 4:5592390-5592412 CCAGTGGCAAAAGAGGCATTGAG 0: 1
1: 0
2: 2
3: 17
4: 143
Right 969199614 4:5592435-5592457 GTAACTAGTCAGATGTGAGCAGG 0: 1
1: 0
2: 19
3: 103
4: 304
969199610_969199614 25 Left 969199610 4:5592387-5592409 CCTCCAGTGGCAAAAGAGGCATT 0: 1
1: 0
2: 0
3: 15
4: 144
Right 969199614 4:5592435-5592457 GTAACTAGTCAGATGTGAGCAGG 0: 1
1: 0
2: 19
3: 103
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969199614 Original CRISPR GTAACTAGTCAGATGTGAGC AGG Intronic
900135222 1:1114279-1114301 GTAGCTAGTCAGACATGAGCAGG - Intronic
900943831 1:5818210-5818232 GTAGCTAGCCAGACATGAGCAGG + Intergenic
901248029 1:7748855-7748877 GTAACTAGTCAGATGGGAAAGGG + Intronic
904456263 1:30649958-30649980 TAGACTAGTCAGAGGTGAGCAGG - Intergenic
905610344 1:39345006-39345028 GTAGTTAGGCAGATATGAGCAGG - Intronic
906831431 1:49035771-49035793 GTAGCTAGTCAGGCATGAGCAGG - Intronic
907136696 1:52145492-52145514 GTATGGAGTCAGATGTGAGCAGG + Intronic
909875743 1:80800028-80800050 GTAGCTAGTCAGACATGAGTAGG - Intergenic
910024135 1:82628629-82628651 GTAGCTAGTCAGGCATGAGCGGG - Intergenic
910086824 1:83412929-83412951 GTCACTAGCCACATGTCAGCAGG + Intergenic
910748703 1:90603273-90603295 GTAGCTTCTCATATGTGAGCTGG + Intergenic
911746266 1:101445100-101445122 GTAGATAGTCAGATGTGAGCAGG + Intergenic
912573910 1:110646577-110646599 GTAACAACTCAGATGGGAGATGG + Intergenic
912940178 1:114037763-114037785 GTAGCTAGGCAGACATGAGCAGG - Intergenic
913366987 1:118049764-118049786 GTAGCTAGTCAGGCATGAGCAGG + Intronic
916816835 1:168362401-168362423 GTAGCTAGTCAGGTGTGAGCAGG + Intergenic
916896401 1:169167896-169167918 GTAGCTAGTCGGGTATGAGCAGG + Intronic
917411931 1:174768214-174768236 GTAACTAGGCAGACATGAACAGG + Intronic
917767025 1:178231257-178231279 GTATCTAGTCAGACATGAACAGG - Intronic
918001889 1:180505263-180505285 GTAGCTAGTCAGGAATGAGCAGG + Intergenic
919299102 1:195738442-195738464 GTAGCTAGTCAGACATAAGCAGG + Intergenic
921183487 1:212650674-212650696 GTAGCTAGTCAGGTATGAGCAGG - Intergenic
921344707 1:214170549-214170571 GTAGCTAGCCAGGTATGAGCAGG + Intergenic
921663491 1:217837098-217837120 GAAACTAGTCACATTTGAGTAGG - Intronic
921890456 1:220348156-220348178 GTAGCTAGTCAGGTATGAGCAGG - Intergenic
921901502 1:220456138-220456160 GTAGCTAGTCAGACATGAGCAGG - Intergenic
921974902 1:221191620-221191642 GTACCTAGTCAGGCATGAGCAGG - Intergenic
922877700 1:228953328-228953350 GTAGCTAGTCATACATGAGCAGG + Intergenic
922883458 1:229000306-229000328 GTAGCTAGTCAGGCATGAGCAGG + Intergenic
922934199 1:229411198-229411220 TTAACGAGTCAGATATGAGCAGG + Intergenic
923965478 1:239134204-239134226 GTAGCTAGTCAGACATGAGCAGG + Intergenic
924154458 1:241162039-241162061 GTAGCTAGGCAGACGTGAGCAGG + Intronic
1063308503 10:4930431-4930453 GTAGTTAGTCAGACATGAGCAGG + Intronic
1063318174 10:5027064-5027086 GTAGTTAGTCAGACATGAGCAGG - Intronic
1064775889 10:18777093-18777115 GTAGCTAGTCAGGCATGAGCAGG + Intergenic
1065506425 10:26434499-26434521 GTAGCTAGTCAGGCATGAGCAGG + Intergenic
1065506720 10:26437067-26437089 GTAGCTAGTCAGGCATGAGCAGG - Intergenic
1065725723 10:28666199-28666221 GTAATTATTCACTTGTGAGCAGG + Intergenic
1067399049 10:45954312-45954334 GTAGCCAGTCAGACATGAGCAGG + Intergenic
1067867370 10:49923528-49923550 GTAGCCAGTCAGACATGAGCAGG + Intronic
1067893872 10:50159289-50159311 GTAACTAGTCAGACATGAGCAGG + Intergenic
1067954972 10:50780978-50781000 GTAACTAGTCAGACATGAGCAGG - Intronic
1068518899 10:58057515-58057537 GTAGCTAGTCAGACATGAGCAGG - Intergenic
1070847379 10:79534329-79534351 GTAGCTAGTCAGGCATGAGCAGG - Intergenic
1070926418 10:80225963-80225985 GTAGCTAGTCAGGCATGAGCAGG + Intergenic
1072343309 10:94477579-94477601 ATAACTAGATAGATGTTAGCTGG - Intronic
1072531284 10:96321800-96321822 GTAGCTAGTCAGGCATGAGCAGG - Intronic
1073360096 10:102891321-102891343 ATAGCTAGTCAGGCGTGAGCAGG - Intronic
1073584358 10:104694354-104694376 GTAACTGGTCCAAGGTGAGCTGG - Intronic
1073931961 10:108586596-108586618 GTAACTAGTCAGGCTTGAGCGGG + Intergenic
1074025386 10:109628382-109628404 GTAACAAGTCTCATGTGACCAGG - Intergenic
1075502673 10:122990485-122990507 GTCACTTGTCAGATGTGATGTGG + Intronic
1076059411 10:127401799-127401821 GTAGCTAGTCAGGCATGAGCGGG - Intronic
1077402013 11:2363598-2363620 GTCACCGGTCAGATCTGAGCAGG + Intergenic
1078290376 11:10004963-10004985 GTAGCTAGCCAGACATGAGCAGG + Intronic
1079405978 11:20146060-20146082 GTAGCTAGTCAGACATGAGCAGG - Intergenic
1079575955 11:22003347-22003369 GTAGTTAGTCAGATATGAGCGGG + Intergenic
1080202868 11:29693746-29693768 GTCTCTAGTTAGATGTTAGCTGG - Intergenic
1080952305 11:37049284-37049306 GTAGCTAGTCAGCCATGAGCAGG + Intergenic
1080967908 11:37234907-37234929 GTAGATAGGCAGATGTGAGCAGG - Intergenic
1081029095 11:38055487-38055509 GTAGCTAGTCAGGCATGAGCAGG + Intergenic
1081305096 11:41502044-41502066 GTAAGTAGTCAGGCATGAGCAGG - Intergenic
1082059235 11:47846473-47846495 GTGACTAACCAGATGTGAGTGGG - Intronic
1083041236 11:59689263-59689285 GTAACTAGTCAGACATGAACAGG - Intergenic
1085652056 11:78277324-78277346 GTAGCTAGGCAGACATGAGCAGG + Intronic
1085831471 11:79905862-79905884 GTAGCTAGTAAGACATGAGCAGG + Intergenic
1085963965 11:81498322-81498344 GTAGCTAGTCAGAAATGAGCAGG + Intergenic
1086203617 11:84233127-84233149 GTAGCTAGTCAGACATGAGCAGG + Intronic
1086737037 11:90319824-90319846 GTAGGTAGTCAGACGTGAGCAGG + Intergenic
1086974418 11:93115803-93115825 GTAGCTAGTCAAACATGAGCAGG - Intergenic
1087066508 11:94032612-94032634 GTAGCTAGTCAGGCATGAGCAGG + Intronic
1087797440 11:102469530-102469552 GTAACTAGGCAGACATGAACAGG + Intronic
1087797970 11:102474090-102474112 GTAACTAGTCAGACATGAGCAGG - Intronic
1088253548 11:107882151-107882173 GTAATTAGTCAGGTATGAGCAGG + Intronic
1088520209 11:110689608-110689630 GTAGCTAGTCAGGTGTGAGCAGG + Intronic
1089055779 11:115583610-115583632 GTATGTAGTCAGGTGTGAACAGG - Intergenic
1090613599 11:128494420-128494442 GTATTTAGACAGAAGTGAGCAGG + Intronic
1093422018 12:18984399-18984421 GTAGTTAGGCAGATGTGAGCAGG - Intergenic
1093489586 12:19689511-19689533 GTAGCTAGTCAGGTATCAGCAGG - Intronic
1094062613 12:26331122-26331144 GTAGCTAGTCATGTATGAGCAGG + Intergenic
1094382403 12:29857049-29857071 TTGCCTAGTCAGATGTGAGATGG - Intergenic
1095552304 12:43457487-43457509 GTAAATAGTCATAAGTAAGCAGG - Intronic
1095595067 12:43949734-43949756 GTAGCTAGGCAGACATGAGCAGG - Intronic
1096683674 12:53273752-53273774 GAAAATATTCAGATGTGAGATGG - Intronic
1097133435 12:56831350-56831372 GTAGCTAATCAGACATGAGCAGG - Intergenic
1097134223 12:56837933-56837955 GTAGCTAGTCAGAGGTGAGCAGG - Intergenic
1097493700 12:60301266-60301288 GTAACTAGTCAGGCATGAGTTGG + Intergenic
1097931653 12:65193798-65193820 GTAGCTAGTCAGGTATAAGCAGG - Intronic
1098437740 12:70485970-70485992 GTAGCTAGTCATACATGAGCAGG + Intergenic
1098637940 12:72807483-72807505 ATTACTAGTCAGAGGTGATCTGG + Intergenic
1099920712 12:88953744-88953766 GTAGCTAGTCATACATGAGCAGG - Intergenic
1100135863 12:91552567-91552589 GTAGCTAGTCAGGCATGAGCAGG - Intergenic
1100462878 12:94818461-94818483 GTAGCTAGTTAGACCTGAGCAGG + Intergenic
1101193674 12:102360952-102360974 GAAGGTAGTCAGATGTGAGCTGG + Intergenic
1101296813 12:103432432-103432454 GTAGCTAGTCAGATATGCGCAGG - Intronic
1101388541 12:104279041-104279063 GTACATAGCCACATGTGAGCAGG - Intronic
1101406990 12:104437303-104437325 GTAGCTAGTCAGACATGAACAGG - Intergenic
1101407169 12:104438868-104438890 GTAGCTAGTCAGACATGAGCAGG + Intergenic
1103093701 12:118116277-118116299 GTAGTTAGTCAGAGCTGAGCAGG - Intronic
1103126793 12:118430240-118430262 GTAGCTGGTCAGGTATGAGCAGG - Intergenic
1104178950 12:126359432-126359454 GTGATTAGACAGATGTGAGATGG - Intergenic
1104284521 12:127412490-127412512 ATAACTTGTCAGACATGAGCAGG - Intergenic
1104432520 12:128728066-128728088 GTAGCTAGGCAGACATGAGCGGG - Intergenic
1107236734 13:38179267-38179289 GTATCTAGCCAGACATGAGCAGG - Intergenic
1109333801 13:60966565-60966587 GTAGCTAGTCAGGTATAAGCAGG + Intergenic
1109514523 13:63424648-63424670 GTAGGTAGTCAGACATGAGCAGG + Intergenic
1109661145 13:65462224-65462246 GTAGCTAGTCAGACATAAGCAGG - Intergenic
1109848184 13:68024722-68024744 GTAGCTCGTCAGACTTGAGCAGG - Intergenic
1110275306 13:73635602-73635624 GCAACTAGTCAGACATGAGCAGG + Intergenic
1111122201 13:83867839-83867861 GTAGCTAGTCAGAGAGGAGCAGG + Intergenic
1111127345 13:83928914-83928936 GTAGCTAGTCAGACATGAGCAGG + Intergenic
1111344242 13:86927297-86927319 GTAGCTAGTCAGGTGTGAGCAGG - Intergenic
1111476906 13:88761557-88761579 GTAGCTAGTTAGACATGAGCAGG - Intergenic
1111521758 13:89413797-89413819 GTAGCTAGGCAGACATGAGCAGG - Intergenic
1111763668 13:92498657-92498679 GTAGCTAGTCAGATATGAGCAGG - Intronic
1114790896 14:25657172-25657194 GTAGCTAGTTGGGTGTGAGCCGG + Intergenic
1114881829 14:26795948-26795970 GTAGCTAGTCAGGTATGAGCAGG + Intergenic
1115239420 14:31240163-31240185 GTAGCTAGTCAGACATGAGCAGG - Intergenic
1115433602 14:33348734-33348756 GTAACTGCACAGATGTGAACGGG - Intronic
1115527651 14:34297752-34297774 GTAGATAGGCAGATATGAGCAGG + Intronic
1115887836 14:37993722-37993744 GTAGCTAGTCAGACATGAGCGGG + Intronic
1116064870 14:39970179-39970201 GTAGCTAGTCAGACATTAGCAGG + Intergenic
1116229741 14:42201591-42201613 GTAGCTAGTCAGGCATGAGCAGG + Intergenic
1117099791 14:52334481-52334503 GTAGCTAGGCAGACATGAGCTGG - Intergenic
1117528118 14:56631982-56632004 GTAGCTAGTCAGGCATGAGCAGG - Intronic
1117990691 14:61430572-61430594 GTAGTTAGGCAGATATGAGCGGG + Intronic
1119597049 14:75944607-75944629 GTAGGTAGTCAGACATGAGCAGG + Intronic
1120296387 14:82647245-82647267 GTAGCTAGTCAGACATGAGCAGG + Intergenic
1120969867 14:90198333-90198355 GTAACTAGTCAAGCATGAGCAGG + Intergenic
1124588626 15:31034267-31034289 ATAACGAGTCATATGTGAGATGG + Intronic
1124821554 15:33051404-33051426 GTAGCTAGTCAGACATGAGCAGG + Intronic
1125041069 15:35188022-35188044 GTAGCTAGTCAGACATGAGCAGG + Intergenic
1126260415 15:46683077-46683099 GTAGCTAGTCAGACATGAACAGG + Intergenic
1129090859 15:73148927-73148949 GGAACTACTCAGATGGAAGCAGG + Intronic
1130740401 15:86592896-86592918 GTAGCTAGGCAGATATAAGCAGG - Intronic
1132166968 15:99602822-99602844 GTAGCTAGTCAGACATGAGCAGG - Intronic
1134256741 16:12618665-12618687 GTAGCTAGTCAGACATGAGCAGG + Intergenic
1135173920 16:20211176-20211198 GTAATTGTTCAGATGTAAGCAGG - Intergenic
1138522954 16:57582160-57582182 GTAGCTAGTTAGGTATGAGCAGG - Intronic
1138988677 16:62363046-62363068 GTAGGTAGTCAGACATGAGCAGG - Intergenic
1140127967 16:72133625-72133647 GTAGCTAGTCAGGTGTGAGCAGG + Intronic
1141251588 16:82363786-82363808 GTAGCTAGTCAGACACGAGCAGG - Intergenic
1141274559 16:82574990-82575012 ATAACTAGAAAGATGTGAGAAGG - Intergenic
1141786685 16:86205458-86205480 GTAGTTAGTCAGGTATGAGCGGG - Intergenic
1142307092 16:89291862-89291884 GTAACGGGTCAGATGAGTGCAGG - Intronic
1144017056 17:11206181-11206203 GTAGATAGGCAGATATGAGCAGG - Intergenic
1149258042 17:54849397-54849419 GTAGCTAGGCAGACATGAGCAGG + Intergenic
1149290704 17:55215295-55215317 GTAATTAGGCAGATATGAGCAGG + Intergenic
1149304275 17:55333260-55333282 GTAATTAGTGAGACATGAGCAGG - Intergenic
1149379825 17:56082117-56082139 GTAGCTAGTCAGACATGAACAGG - Intergenic
1150558705 17:66276558-66276580 GTGACCAGTGAGATATGAGCAGG - Intergenic
1151051185 17:70979985-70980007 GTAGCTTGTCAGATATGAGCAGG - Intergenic
1153015272 18:577343-577365 GTAGCTAGTCAGGCATGAGCGGG - Intergenic
1153538837 18:6133615-6133637 GTAGCTAGGCAGACATGAGCAGG + Intronic
1153675706 18:7454456-7454478 GAAACTATTAAGATGTGAACTGG - Intergenic
1154276060 18:12961461-12961483 GTAGGTAGTCAGACATGAGCAGG - Intronic
1155850399 18:30767245-30767267 GTAGCTAGTCAGACATGAGCAGG - Intergenic
1156679950 18:39576372-39576394 TTAGCTAGTCAGACATGAGCAGG + Intergenic
1157409637 18:47452976-47452998 GTAGCTAGTCAGGTATAAGCAGG + Intergenic
1157707563 18:49820301-49820323 GTACCTAGTCAGGCATGAGCAGG + Intronic
1158094571 18:53756159-53756181 GTAGCTAGGCAGACATGAGCAGG + Intergenic
1159892815 18:73968547-73968569 GTAGCTAGTCAGGCATGAGCAGG - Intergenic
1164180120 19:22811010-22811032 GTAGCTAGTCAGGTATGAACAGG - Intergenic
1164606614 19:29603566-29603588 GTAGGTAGTCAGGTATGAGCAGG - Intergenic
1166418433 19:42613563-42613585 GTATTTAGTCAGACATGAGCAGG + Intronic
1166498087 19:43319779-43319801 GTAGCTAGTCAGACATCAGCAGG + Intergenic
1167222830 19:48214219-48214241 GCAGCTCGTCAGATATGAGCAGG + Intronic
925502246 2:4518568-4518590 GTAGCTAGTCAGGTATGAGCAGG + Intergenic
925751536 2:7094252-7094274 GTAGCTAGTCAGGCATGAGCAGG + Intergenic
925914461 2:8595077-8595099 GAAAATATTCAGATGTGAACAGG - Intergenic
926637272 2:15195530-15195552 GTAGCTAGGCAGACATGAGCAGG + Intronic
927351451 2:22122398-22122420 GTAGCTAGTCAGGCATGAGCAGG + Intergenic
927765327 2:25802161-25802183 TTAACTTGTAAGATTTGAGCTGG - Intronic
929392898 2:41492273-41492295 GTTACTTATCAGATGTGAGTTGG + Intergenic
930898633 2:56476529-56476551 GTAGCTAGGCAGATATGAGCAGG + Intergenic
931272814 2:60717653-60717675 GTATTGAGTCAGACGTGAGCAGG - Intergenic
931884955 2:66607291-66607313 GTAGCTAGTCAGGCATGAGCAGG + Intergenic
933045156 2:77526140-77526162 GTAGCTAGTCAGACATGAACAGG - Intronic
933064627 2:77778424-77778446 GTAGCTAGTCAGGCATGAGCAGG - Intergenic
933563070 2:83913362-83913384 GTAACTAGTCAAACATGAGCAGG + Intergenic
933936451 2:87207749-87207771 GTAGCTGGTCAGGTCTGAGCAGG - Intergenic
934104047 2:88679974-88679996 GTAGCTAGTCAGGCATGAGCGGG + Intergenic
934665590 2:96167764-96167786 GTAGTTAGACAGACGTGAGCCGG + Intergenic
934887663 2:98039096-98039118 GTAACTAGTCAGACATGAGCAGG + Intergenic
935261522 2:101359658-101359680 GTAGCTAGTCAGACATGAGCAGG - Intronic
935286505 2:101568273-101568295 GTAGCTAGTCAGACATGAGCAGG - Intergenic
935292113 2:101619736-101619758 GTAGCTAGTCAGACATGAGCAGG - Intergenic
935761077 2:106321355-106321377 GCAATTAGTCAGATGTGGGGGGG + Intergenic
936356698 2:111758080-111758102 GTAGCTGGTCAGGTCTGAGCAGG + Intergenic
937714571 2:125016752-125016774 GTAGCTAGTCAGGTATGAGCAGG + Intergenic
937721229 2:125099483-125099505 GTAGCTAGTCAGACATGAGCAGG + Intergenic
938593953 2:132767630-132767652 GTAACTACACAGATGTGAGTTGG + Intronic
939858425 2:147389174-147389196 GTAGCTAGTTAGATATGAGCAGG + Intergenic
940566288 2:155364862-155364884 GTAGCTAGGCAGACATGAGCAGG - Intergenic
940868384 2:158839002-158839024 GTAGCTAGTCAGGTATGAGCAGG + Intronic
941685112 2:168440201-168440223 GTACCTAGTCAGGCATGAGCAGG - Intergenic
941717838 2:168782431-168782453 GTAGCTAGTCAGTCATGAGCAGG + Intergenic
942110094 2:172673597-172673619 GTAGCTAGTCAGTCATGAGCAGG - Intergenic
942599871 2:177629878-177629900 GTAAGTAGGCATATGTGAGCTGG - Intronic
942899876 2:181102525-181102547 TTCACTAATCAGAAGTGAGCAGG - Intergenic
943633502 2:190280343-190280365 GTAGCTAGGCAGACATGAGCAGG + Intronic
943706098 2:191036345-191036367 GTAGCTAGTGAGGTGTGAGCAGG + Intronic
943905083 2:193489493-193489515 GTAGCTAGTCAGGCATGAGCAGG + Intergenic
945838204 2:214857480-214857502 GTAGATAGTCAGATATGTGCAGG + Intergenic
947002030 2:225467467-225467489 GTAGCTAATCAGACGTGAACAGG - Intronic
947156973 2:227172330-227172352 GTAGCTAGTCAGGCATGAGCAGG - Intronic
947219764 2:227781113-227781135 GTAGCTAGTCAGACATGAACAGG + Intergenic
947599788 2:231439670-231439692 GTAGCTAGTCAGGTATGAGCAGG + Intergenic
1169708776 20:8537586-8537608 GTAGCTAGTCAGGCATGAGCGGG - Intronic
1169713719 20:8592650-8592672 GTGACTCGTCACATGTGATCAGG + Intronic
1170500263 20:16968372-16968394 ATAGATAGTCAGATATGAGCAGG - Intergenic
1172255889 20:33517239-33517261 GTAACTAGACAGAGCTGTGCTGG + Intronic
1172566006 20:35931000-35931022 GGAACTGGCCAGAGGTGAGCTGG - Intronic
1173924915 20:46773562-46773584 GTAGCTGGTCAGGTATGAGCAGG + Intergenic
1175631156 20:60537415-60537437 GTAGCTAGTCTGGTCTGAGCAGG - Intergenic
1177013969 21:15761284-15761306 GTAGCTAGTCAGACATGAGCAGG + Intronic
1177609120 21:23423158-23423180 GAAGATAGGCAGATGTGAGCAGG + Intergenic
1177730579 21:25023458-25023480 GTAGCTAGTCAGATGCCAACAGG - Intergenic
1178445737 21:32639952-32639974 GTAAATAGTCAGAAGTAAACAGG - Intronic
1178450989 21:32699600-32699622 GTAGACAGTCAGATATGAGCAGG - Intronic
1179010036 21:37549371-37549393 TTAGCTAGTCAGACATGAGCGGG - Intergenic
1179054660 21:37920032-37920054 GTAGCTAGTCAGACATGAGCAGG + Intergenic
1182224374 22:28784664-28784686 GTAAATAGCCAGAAGTAAGCTGG + Intronic
1183980202 22:41534987-41535009 GTAAGTAGGCAGATATGAGCAGG - Intronic
1184500598 22:44869264-44869286 GTAGCTAGTCAGACGGGAGCGGG - Intergenic
949496895 3:4640874-4640896 GCACCTAGACAGATGTGTGCAGG + Intronic
950628151 3:14263582-14263604 GTAGCTAGTCAGACATGAGCAGG - Intergenic
950869582 3:16217052-16217074 GTAGCTAGTCAGACATAAGCAGG - Intronic
953259211 3:41321478-41321500 GTAGGTAGTCAGACATGAGCAGG + Intronic
953716140 3:45318600-45318622 GTAGCTAATCAGACATGAGCAGG - Intergenic
953790004 3:45940159-45940181 GTAGCTAGGCAGACATGAGCAGG + Intronic
953798015 3:46000361-46000383 GTAGCTAGGCAGACATGAGCAGG + Intergenic
955683791 3:61529377-61529399 CTAAAGAGTCAAATGTGAGCAGG + Intergenic
957275003 3:78080159-78080181 GTAGCTAGTCAGGCATGAGCAGG + Intergenic
957279947 3:78137494-78137516 GTAGCTAGTCAGGCATGAGCAGG - Intergenic
957315903 3:78576000-78576022 GTAGCTAGGCAGACATGAGCAGG - Intergenic
957738222 3:84228669-84228691 GTAGCTAGTCAGACATGAGCAGG - Intergenic
959194796 3:103166602-103166624 GTAGCTAGTCGGACATGAGCAGG + Intergenic
959401240 3:105904672-105904694 GTAGGTAGTCAGACATGAGCAGG + Intergenic
961353291 3:126317255-126317277 GTAGCTAGTCAGACATGAGCAGG + Intergenic
961480922 3:127180213-127180235 GTAGCTAGGCAGACATGAGCAGG + Intergenic
961698715 3:128725319-128725341 GTAAGTAGTCAGACCTGAGCAGG - Intergenic
962345486 3:134615913-134615935 GTCACCAATCAGATGTCAGCTGG - Intronic
962647054 3:137450698-137450720 GTATCTGGAAAGATGTGAGCTGG + Intergenic
965089167 3:164141542-164141564 GTAGCTAGTCAGACTTGAGCAGG + Intergenic
965933835 3:174080982-174081004 GTAGCTAGTCAGGTATGAGCAGG - Intronic
966566105 3:181383184-181383206 GTAGCTAGTCAGACATGAGCAGG - Intergenic
967120800 3:186381124-186381146 GTAGCTAGTCAGACATGAGCAGG + Intergenic
967461894 3:189757692-189757714 GTAGCTAGTCAGACATGAGCAGG + Intronic
967961471 3:194928684-194928706 GTAGGTAGTCAGACATGAGCAGG + Intergenic
967994140 3:195154087-195154109 GTAGCTAGTCAGACATGAGCAGG + Intronic
968798878 4:2728996-2729018 GTAGCTAGTCAGGTGTGAGCAGG + Intronic
969199614 4:5592435-5592457 GTAACTAGTCAGATGTGAGCAGG + Intronic
969946928 4:10793175-10793197 GTAGCTAGTCAGACATGAGCAGG + Intergenic
969947482 4:10799324-10799346 GTAGCTAGTCAGTCATGAGCAGG - Intergenic
970470815 4:16378030-16378052 GTAGCTAGTCAGACGTGAGCAGG + Intergenic
971878090 4:32330139-32330161 GTAGCTAGTCAGGCATGAGCAGG + Intergenic
971990399 4:33885752-33885774 GTAGCTAGTCAGGCATGAGCAGG + Intergenic
972025005 4:34364647-34364669 GTAAGTAGTCAGACATGAACAGG - Intergenic
972126776 4:35777809-35777831 GTAGCTAGTCAGACATGAACAGG + Intergenic
972441039 4:39091824-39091846 AAAACTAGTCAGATGTGTGATGG - Intronic
972987072 4:44777766-44777788 GCAGCTAGTCAGACATGAGCAGG + Intergenic
974098568 4:57392355-57392377 GTAGCTAGTCAGGCATGAGCCGG + Intergenic
974156982 4:58086085-58086107 GTAGCTAGTCAGTCATGAGCAGG - Intergenic
974278884 4:59763806-59763828 GTAAGCTATCAGATGTGAGCAGG - Intergenic
974326620 4:60422772-60422794 GTAGCTAGTCAGACATGAGCAGG + Intergenic
974612483 4:64233639-64233661 GTAGCTAGTCAACTATGAGCAGG - Intergenic
975322816 4:73027512-73027534 TTAAAAAGTCAGATGTGAGATGG - Intergenic
975397566 4:73894925-73894947 GTAGCTAGTCAGACATGAACAGG + Intergenic
975916359 4:79330565-79330587 GTAGCTAGGCAGACGTGAGCAGG + Intergenic
978111334 4:104967357-104967379 GGAACTAGTCTGCAGTGAGCAGG - Intergenic
978153806 4:105467164-105467186 GTAGCTAGTCAGGCATGAGCAGG - Intronic
978561047 4:110033656-110033678 TTAACTAGTTAGGTGTAAGCAGG - Intergenic
978763869 4:112384469-112384491 GTAAATAGTCACATGTGGCCAGG + Intronic
979056189 4:115997895-115997917 GTAGCTAGTCATGTATGAGCAGG - Intergenic
979940218 4:126752816-126752838 GTAACTAGTCAGACATGAGCAGG - Intergenic
980072113 4:128254431-128254453 GTAGCAAGTCAGACATGAGCAGG + Intergenic
980390962 4:132145853-132145875 ATAGCTAGTCAGACATGAGCAGG - Intergenic
980571709 4:134627957-134627979 GTAGCTAGTCAGGCATGAGCAGG - Intergenic
980621814 4:135316935-135316957 GTAGCTAGTAAGACATGAGCAGG - Intergenic
981450006 4:144885983-144886005 GTAGCTAGTCAGGCATGAGCAGG + Intergenic
981542169 4:145857185-145857207 TTAAGTAGACAGAGGTGAGCAGG + Intronic
981928716 4:150167598-150167620 GTAGCTAGTCAGGCATGAGCAGG + Intronic
982103828 4:151994204-151994226 ATAGCTAGTCAGACATGAGCAGG - Intergenic
983028226 4:162764471-162764493 GTAATAAGTAAGATGTGAGAGGG + Intergenic
983067344 4:163226874-163226896 GTAAGTAGTCAGACATGAGCAGG + Intergenic
983262337 4:165470690-165470712 GTAGGTAGTCAGACATGAGCAGG - Intronic
983263008 4:165476714-165476736 GTAGCTAGTCAGACATGAGCAGG - Intronic
983615728 4:169702250-169702272 GTAGCTAGTCAGGCATGAGCAGG - Intronic
983713110 4:170744109-170744131 GTAGTTAGTCAGACATGAGCAGG - Intergenic
983781528 4:171675200-171675222 GTAGCTAGTCAGACATGAACAGG - Intergenic
983847957 4:172542594-172542616 GTAGCTAGTCAGGCATGAGCAGG - Intronic
985915794 5:2918153-2918175 GTAGCTAGTCAGACATGAGCAGG - Intergenic
986066481 5:4239701-4239723 GTAGCTAGTCAGGCATGAGCAGG + Intergenic
986326116 5:6675977-6675999 GTAATTAGGCAGATATGAGCAGG + Intergenic
986685074 5:10269294-10269316 GTAGCTAGTCAGGCATGAGCAGG - Intergenic
986977747 5:13412160-13412182 ATAGCTAGTCAGGTATGAGCAGG + Intergenic
987620171 5:20330313-20330335 GTAGCTAGTTAGACATGAGCAGG + Intronic
987839006 5:23198512-23198534 GTAGCCAGTCAGACATGAGCAGG - Intergenic
987878474 5:23711225-23711247 GTATCTAGTCAGGGGTGAGCAGG - Intergenic
988629593 5:32914703-32914725 GTAGCTAGGCAGAGATGAGCAGG + Intergenic
988737644 5:34038817-34038839 GTAGCTACTCAGACATGAGCAGG + Intronic
989411354 5:41122861-41122883 GTAGATAGGCAGATATGAGCCGG - Intergenic
989476798 5:41883475-41883497 GTAGCTAGTCTGACATGAGCAGG - Intergenic
989820892 5:45794890-45794912 ATAGCTAGTCAGAAATGAGCAGG - Intergenic
990213207 5:53502679-53502701 GTAGCTAGTCAGACATGAGCAGG - Intergenic
990318109 5:54602973-54602995 GTAGCTTGTCAGGTATGAGCAGG - Intergenic
990489154 5:56287258-56287280 GTAGCTAGTCAGATATGAGCAGG + Intergenic
990594125 5:57296047-57296069 GTAGCTAGGCAGACATGAGCAGG + Intergenic
990896166 5:60701884-60701906 GTAGCTAGTCAGGCATGAGCAGG - Intergenic
991929902 5:71744103-71744125 GTAGCTTGTCAGACATGAGCAGG + Intergenic
992399046 5:76394943-76394965 GTAGTTAGTCAGACATGAGCAGG + Intergenic
993478700 5:88396614-88396636 GTGACCAGTCAGATGCTAGCAGG + Intergenic
994223884 5:97229377-97229399 GTAGCTAGTCAGGTATGAGCAGG - Intergenic
995477180 5:112560125-112560147 GTAGCTAGTTAGACATGAGCAGG - Intergenic
996151081 5:120035799-120035821 GTAGCTAGTCAGGTATAAGCAGG + Intergenic
996281871 5:121739639-121739661 GTAGCTAGTCAGGTATGAGTGGG - Intergenic
996289415 5:121834542-121834564 GTAGCTAGTCAGGCATGAGCAGG + Intergenic
997808103 5:136939817-136939839 GTAGCTAGTCAGGTATAAGCAGG + Intergenic
998796159 5:145821387-145821409 GTAGCTAGTCAGGTATGAGCAGG - Intronic
999629330 5:153553919-153553941 GTAGCTAGTCAGACACGAGCAGG - Intronic
1000233258 5:159334994-159335016 ATAGCTAGTCAGACATGAGCAGG + Intergenic
1003949302 6:11103416-11103438 GTAGCTAGTCAGACATGAGCAGG - Exonic
1004467737 6:15901573-15901595 GTAGATAGGCAGATATGAGCAGG - Intergenic
1005158242 6:22833314-22833336 GTAGCTAGGCAGACATGAGCAGG + Intergenic
1005980070 6:30829861-30829883 GTAGCTAGTCAGGGATGAGCAGG - Intergenic
1006733116 6:36251472-36251494 TTAACCAGTAAGATGTGAGCAGG + Intronic
1006790098 6:36694619-36694641 GAAACTAGTCAGATTTGGGCTGG - Intergenic
1009683953 6:66932556-66932578 GTAGCTAGTTAGGTATGAGCTGG + Intergenic
1011815366 6:91183868-91183890 GTAGCTAGTCAGGTACGAGCAGG + Intergenic
1013629302 6:111970235-111970257 GTAGCTAGTCAGATACGAGTAGG + Intergenic
1015330884 6:131977797-131977819 GTAATTAGTCTGATGGGATCAGG - Intergenic
1015825178 6:137303547-137303569 GTAACTATTCAGAAGAGAGAAGG - Intergenic
1016363302 6:143290781-143290803 GTAGCTAGTCAGACGTGAAAGGG - Intronic
1017426843 6:154330913-154330935 GTAGCTAGGCAGACATGAGCAGG + Intronic
1017444119 6:154492069-154492091 GTATCTAGTTAGCTGTGTGCAGG - Intronic
1018109118 6:160518366-160518388 GTAGCTAGTAAGGTATGAGCAGG - Intergenic
1019409361 7:899881-899903 GAAGCTGGTCAGACGTGAGCGGG + Intronic
1021458697 7:20860199-20860221 ACAGCTAGTCAGAGGTGAGCTGG + Intergenic
1021508578 7:21411179-21411201 GTAGCTAGTCAGACATGAGCAGG - Intergenic
1021512669 7:21451409-21451431 GTAGGTAGTCAGATGTGAGCAGG - Intronic
1021598138 7:22338817-22338839 GTAGCTAGTCAGACATGAGCAGG + Intronic
1021991101 7:26142416-26142438 GTAGCTAGTCAGACATGAACAGG - Intergenic
1022436380 7:30389887-30389909 GGAACAAGTCAGGGGTGAGCAGG - Intronic
1022965279 7:35466398-35466420 TTAATTAGAAAGATGTGAGCAGG - Intergenic
1023052224 7:36262977-36262999 GTAGCTAGTCAGACATGAGCAGG - Intronic
1023085476 7:36566510-36566532 GTAGCTAGTCAGACATGAGTGGG + Intronic
1024423435 7:49197393-49197415 GTAGCTAGTCAGGCATGAGCGGG - Intergenic
1026221847 7:68405245-68405267 GTAGCTAGTCAGGCATGAGCAGG - Intergenic
1026853511 7:73738787-73738809 GTACCTTGTGAGATGCGAGCCGG - Exonic
1027303703 7:76869410-76869432 GTCACTAGCCACATGTCAGCAGG + Intergenic
1027596864 7:80184769-80184791 GTAGCTAGTCAGGCATGAGCAGG - Intronic
1028077883 7:86536908-86536930 GTAGCTAGGCAGACATGAGCAGG - Intergenic
1028694551 7:93693532-93693554 GTAGCTAGTCAGACATGAGCAGG - Intronic
1028794236 7:94886013-94886035 GTAGCTAGTCAGGCATGAGCAGG - Intergenic
1029907122 7:104103306-104103328 GTAGCTAGTCAGGTATGAGCAGG + Intergenic
1030183612 7:106737060-106737082 GTAACTAGACAGGCATGAGCAGG - Intergenic
1030414873 7:109230387-109230409 GTAACTAGGCAGACATGAGCAGG - Intergenic
1030429523 7:109425822-109425844 GTAGGTAGTCAGACATGAGCAGG + Intergenic
1031639588 7:124145294-124145316 GTAACTAGTCCAGTATGAGCAGG - Intergenic
1032371336 7:131356403-131356425 GTAGCTAGTCAGGTATGAGCAGG - Intronic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1034924622 7:155111185-155111207 GTAGCTAGTCGGGTGGGAGCGGG + Intergenic
1036095006 8:5714076-5714098 GTAGCTAGTCAGATATAAGCAGG - Intergenic
1037132826 8:15427275-15427297 GTAGCTGGTCAGGTATGAGCAGG + Intronic
1037673071 8:21031881-21031903 TCAACTAGTCAGGTGTGATCTGG - Intergenic
1037958607 8:23078567-23078589 GTAGCTAGTCAGGTATGAGCTGG - Intergenic
1037968925 8:23157810-23157832 GCAGCTAGTCAGGTATGAGCAGG + Intronic
1038959597 8:32504309-32504331 GTAGCTAGTCAGACATGAGCAGG - Intronic
1039729186 8:40256025-40256047 GTAGCTAGTCAGATATGAGCAGG - Intergenic
1040673057 8:49715761-49715783 GTAGCTAGTCAGTCATGAGCAGG + Intergenic
1041329337 8:56707481-56707503 GTAGCTAGTCAGGTATGAGCAGG + Intergenic
1041385712 8:57299630-57299652 GTAGCTAGTCAGGCATGAGCAGG - Intergenic
1041385817 8:57300676-57300698 GTACCTAGTCAGATATGAGCAGG - Intergenic
1041386131 8:57305186-57305208 GTAGCTAGTCAGACATTAGCAGG - Intergenic
1041386221 8:57306424-57306446 TTAGCTAGTCAGATATGATCAGG - Intergenic
1041409814 8:57541070-57541092 GTAGCTCTGCAGATGTGAGCAGG - Intergenic
1041670129 8:60483354-60483376 GTAGCTAGGCAGAGATGAGCAGG + Intergenic
1042396379 8:68295979-68296001 GTAGCTAGTCAGACATGAGCAGG + Intergenic
1043091137 8:75906202-75906224 GTATCTAGCCAGACATGAGCGGG + Intergenic
1043598624 8:81914228-81914250 GTAACTAGTCATAAATAAGCAGG + Intergenic
1044085446 8:87937188-87937210 GTAGCTAGTCAGGCATGAGCAGG + Intergenic
1044119213 8:88374197-88374219 GCAGCTAGTCAGACATGAGCAGG + Intergenic
1044199397 8:89415230-89415252 GCAGCTAGTCAGACATGAGCAGG - Intergenic
1044362986 8:91310197-91310219 GTAGCTAGTCAGACATGAGCAGG - Intronic
1044634652 8:94310356-94310378 GTAGCTAATCAGGTATGAGCAGG - Intergenic
1045434904 8:102152689-102152711 GTGACTTGTCGCATGTGAGCTGG + Intergenic
1046337698 8:112812018-112812040 GTAAGTAGTCAGACATGAGCAGG + Intronic
1046387890 8:113526846-113526868 GTAGGTAGTCAGAGGTGAGCAGG + Intergenic
1048161434 8:132025186-132025208 GTAGATAGGCAGATATGAGCAGG + Intronic
1048431865 8:134378104-134378126 GTAGCGAGTCAGACATGAGCAGG + Intergenic
1050018808 9:1262695-1262717 AAAACTACTCAGATGGGAGCTGG - Intergenic
1050306932 9:4314218-4314240 GTAAGCACTCAAATGTGAGCTGG + Intronic
1050914585 9:11115977-11115999 GTAGTTAGGCAGATATGAGCAGG + Intergenic
1052160663 9:25255070-25255092 GTTACTAGGCAGACATGAGCAGG + Intergenic
1052517683 9:29503872-29503894 GTAGCTACTCAGACATGAGCAGG - Intergenic
1052664038 9:31471771-31471793 GTAGCTAGTTAGATATGAGCAGG + Intergenic
1055199909 9:73647058-73647080 GTAACTAGTCAGACATGAGCAGG - Intergenic
1055306004 9:74929722-74929744 GCAACTAGACAGAATTGAGCAGG + Intergenic
1055464160 9:76547234-76547256 GTAGCTAGTCAGACATGAGCTGG - Intergenic
1056094519 9:83239007-83239029 GTAGCTAGTCAGACATGAACAGG + Intergenic
1056303587 9:85267817-85267839 GTAGCTAGTCAGGCATGAGCAGG - Intergenic
1057191849 9:93092794-93092816 GGAACCAGTGAGATGTGAGAAGG + Intergenic
1057333081 9:94134317-94134339 GTAGCCAGTCAGACATGAGCAGG + Intergenic
1060142602 9:121223326-121223348 GTAGTTAGTCAGACATGAGCAGG - Intronic
1187036509 X:15545805-15545827 GTAGCTAGGCAGACATGAGCAGG - Intronic
1187509984 X:19908970-19908992 GTAGCTAGTCTGGTATGAGCAGG - Intergenic
1187613524 X:20968801-20968823 GTAGCTAGTCAGGCATGAGCAGG + Intergenic
1188171329 X:26931688-26931710 GTACCTAGTCAGACATGAGAAGG + Intergenic
1188624658 X:32268869-32268891 ATAGCTAGTCAGATATGAGCAGG + Intronic
1188898685 X:35700770-35700792 GTAGCTAGTCAGACATGAGCAGG - Intergenic
1189683964 X:43544533-43544555 GTAGTTAGTCAGACATGAGCAGG - Intergenic
1190234062 X:48602579-48602601 GTAACATGACAGATGTGAGTGGG - Intronic
1190604501 X:52126806-52126828 GGATCCAGTCAGATTTGAGCAGG + Intergenic
1190771937 X:53522051-53522073 GTAGCTAGTCAGACATGAGCAGG - Intergenic
1193394555 X:80968356-80968378 GGAACTAGCCAGATGCCAGCCGG - Intergenic
1194463875 X:94207564-94207586 GTAAATAGTTTGATGTAAGCAGG - Intergenic
1194498841 X:94655044-94655066 GTAGCTGGTCAGACATGAGCAGG + Intergenic
1194980728 X:100437822-100437844 GTAGCTAGTCAGGCATGAGCAGG + Intergenic
1195325839 X:103757707-103757729 GTAGGTAGTCAGACATGAGCAGG - Intergenic
1196223128 X:113135419-113135441 GTAGCTAGTCAGACATGAGCAGG - Intergenic
1196366044 X:114925619-114925641 GTAGCTAGTCAGACATGAGCAGG + Intergenic
1196705427 X:118713167-118713189 GTAGCTAGTAAGGTATGAGCAGG - Intergenic
1197932364 X:131709206-131709228 GTCGCTAGTCAGATATGAGCAGG - Intergenic
1198725915 X:139676842-139676864 GTAGCTAGTCAGACATGAGCAGG + Intronic
1198823459 X:140673968-140673990 GTAGCTAGTCAGACATGAGCAGG + Intergenic
1201562155 Y:15329034-15329056 GTAACTAGGCATAGGGGAGCAGG - Intergenic