ID: 969202385

View in Genome Browser
Species Human (GRCh38)
Location 4:5616274-5616296
Sequence AACTTGGATCCCAGCTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969202378_969202385 9 Left 969202378 4:5616242-5616264 CCAGGCCACAGGGAGCCTTGAGG No data
Right 969202385 4:5616274-5616296 AACTTGGATCCCAGCTCAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 131
969202380_969202385 4 Left 969202380 4:5616247-5616269 CCACAGGGAGCCTTGAGGTCATG 0: 1
1: 0
2: 1
3: 19
4: 234
Right 969202385 4:5616274-5616296 AACTTGGATCCCAGCTCAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 131
969202382_969202385 -6 Left 969202382 4:5616257-5616279 CCTTGAGGTCATGTTGGAACTTG 0: 1
1: 0
2: 0
3: 16
4: 135
Right 969202385 4:5616274-5616296 AACTTGGATCCCAGCTCAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 131
969202377_969202385 10 Left 969202377 4:5616241-5616263 CCCAGGCCACAGGGAGCCTTGAG 0: 1
1: 0
2: 1
3: 50
4: 512
Right 969202385 4:5616274-5616296 AACTTGGATCCCAGCTCAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969202385 Original CRISPR AACTTGGATCCCAGCTCAGA GGG Intronic