ID: 969207018

View in Genome Browser
Species Human (GRCh38)
Location 4:5654763-5654785
Sequence GGCCTGACTCAACAACAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969207018_969207025 12 Left 969207018 4:5654763-5654785 CCACTCTGTTGTTGAGTCAGGCC 0: 1
1: 0
2: 0
3: 10
4: 95
Right 969207025 4:5654798-5654820 ACTAAGCAGAACAAGCAGTTGGG 0: 1
1: 1
2: 0
3: 14
4: 141
969207018_969207024 11 Left 969207018 4:5654763-5654785 CCACTCTGTTGTTGAGTCAGGCC 0: 1
1: 0
2: 0
3: 10
4: 95
Right 969207024 4:5654797-5654819 AACTAAGCAGAACAAGCAGTTGG 0: 1
1: 0
2: 0
3: 10
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969207018 Original CRISPR GGCCTGACTCAACAACAGAG TGG (reversed) Intronic