ID: 969207018

View in Genome Browser
Species Human (GRCh38)
Location 4:5654763-5654785
Sequence GGCCTGACTCAACAACAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969207018_969207025 12 Left 969207018 4:5654763-5654785 CCACTCTGTTGTTGAGTCAGGCC 0: 1
1: 0
2: 0
3: 10
4: 95
Right 969207025 4:5654798-5654820 ACTAAGCAGAACAAGCAGTTGGG 0: 1
1: 1
2: 0
3: 14
4: 141
969207018_969207024 11 Left 969207018 4:5654763-5654785 CCACTCTGTTGTTGAGTCAGGCC 0: 1
1: 0
2: 0
3: 10
4: 95
Right 969207024 4:5654797-5654819 AACTAAGCAGAACAAGCAGTTGG 0: 1
1: 0
2: 0
3: 10
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969207018 Original CRISPR GGCCTGACTCAACAACAGAG TGG (reversed) Intronic
905626559 1:39493387-39493409 GTCCTGGCTCAGCAACATAGAGG - Intronic
908234923 1:62139488-62139510 GGACTGACTGAACAACACAGAGG - Intronic
908332037 1:63080725-63080747 GGCCTCAACCAACAACAGATGGG - Intergenic
912559652 1:110541098-110541120 GGGCTTACTCATCAACAGACTGG - Intergenic
922580186 1:226691494-226691516 GGCCTGAGTCAACAGCAGGAAGG + Intronic
922901969 1:229144269-229144291 GGCCTGGTTCAAAAACAGATTGG + Intergenic
924906977 1:248465404-248465426 ACCCTGACTCAAAAACAGGGCGG + Intergenic
1063342733 10:5283342-5283364 GGCCTGACTCAGCAGGAGGGTGG - Intergenic
1066470482 10:35693055-35693077 ACCCTGACTCAAAAAAAGAGAGG + Intergenic
1067756874 10:49012023-49012045 GGCCTGGGTCAACAGCACAGAGG + Intergenic
1069758041 10:70785693-70785715 GGCCTGACCCCACCACACAGGGG + Intergenic
1070953285 10:80447776-80447798 AGCCAGACACACCAACAGAGAGG + Intergenic
1071487078 10:86109448-86109470 GGCCTGCCTCAACATCTCAGTGG + Intronic
1077061480 11:619636-619658 GCCCTGACCCACCCACAGAGGGG + Intronic
1078919426 11:15815495-15815517 GAACTGAGTCACCAACAGAGTGG - Intergenic
1078952322 11:16148196-16148218 GGTCTAACTCAACAACTGATTGG - Intronic
1081417367 11:42831998-42832020 GGCCTCGCTCAACCACAGAGGGG + Intergenic
1085284470 11:75350967-75350989 GGCATGTCTCACCAACACAGCGG - Intronic
1085721337 11:78914850-78914872 GGCCTGACTCTCCACCAGTGAGG - Intronic
1088949292 11:114550449-114550471 GGCCGCACTCAACATCAGTGAGG + Intronic
1089442673 11:118530315-118530337 GGCCAGACTCATAAACATAGTGG + Intronic
1090627398 11:128618789-128618811 GGCCTGCCTCAACCACAAAGAGG + Intergenic
1091570510 12:1681369-1681391 AGTCTGACTCAACCACTGAGAGG + Intergenic
1092311524 12:7360574-7360596 GGATTGCCTCAACAACAGAAAGG - Intronic
1102699298 12:114825309-114825331 GGCCAGCCTCAACAACATAGTGG + Intergenic
1103481228 12:121251022-121251044 GGCCTGACTCAAGAGCAGCTTGG + Intronic
1107267186 13:38569660-38569682 AGCCAGCCTCAACAACAGAGTGG + Intergenic
1110961377 13:81630579-81630601 GGCCTGACTAACAAACAGAAAGG + Intergenic
1112340176 13:98546538-98546560 GGCCTCACTCACCACCAGATGGG + Intronic
1113344798 13:109466846-109466868 GGCCTGACAGAGCAACAGGGTGG + Intergenic
1116857150 14:49962809-49962831 GCCGTGACTCACCAAGAGAGAGG + Intergenic
1120716560 14:87847001-87847023 GGCCAAGCTCAACAACAAAGAGG - Intronic
1125690046 15:41588699-41588721 GTGCTGACTCAAGAACACAGAGG + Intergenic
1137037399 16:35578295-35578317 GGCCTCAGACAAGAACAGAGGGG - Intergenic
1139937617 16:70582781-70582803 TGCCTGTGTCAACAGCAGAGAGG - Intronic
1140433087 16:74921584-74921606 GGTCTCCCTCATCAACAGAGTGG + Intronic
1141818907 16:86431748-86431770 GGTCTGACTCAGCACCAGAGTGG + Intergenic
1142179663 16:88662258-88662280 GGACTGGCTCAGCAACAGAGGGG + Intronic
1144237488 17:13275742-13275764 GGGCTGATTCAAAAAAAGAGGGG - Intergenic
1144704948 17:17362228-17362250 TGCCTGTCTCAAAAACAGTGTGG - Intergenic
1144707332 17:17378185-17378207 GGCCTGGCTAACCAGCAGAGAGG - Intergenic
1165259324 19:34598738-34598760 GCCCTGTCTCAGCCACAGAGAGG - Intronic
1165933207 19:39373515-39373537 GGCCTGAGGCAGCAGCAGAGGGG + Intronic
1167598141 19:50438004-50438026 AGCCTGAGTGAACAGCAGAGTGG - Intronic
1168597273 19:57688076-57688098 AGCCTCATTCAACACCAGAGAGG + Exonic
926047640 2:9721516-9721538 GGCCAGACTAAACATCAAAGTGG + Intergenic
926743029 2:16127805-16127827 GGCCTGACACATCAAAGGAGAGG - Intergenic
929756171 2:44767622-44767644 GGCCTGACTCCACCAGTGAGAGG - Intronic
931821147 2:65953680-65953702 GGCCTGACAGAGCAGCAGAGTGG - Intergenic
938599716 2:132824662-132824684 GGCCCCACCCAACCACAGAGGGG - Intronic
942804227 2:179910887-179910909 GCCCTGACTCCCCAGCAGAGGGG + Intergenic
943228357 2:185210298-185210320 GGACTGCCTCAACTGCAGAGTGG + Intergenic
1168823919 20:796017-796039 GTGCTGACTCAAGAACACAGAGG + Intergenic
1172545015 20:35753963-35753985 GGCCAGCCTGAGCAACAGAGAGG + Intergenic
1172805246 20:37607261-37607283 GGACTTAGTCAACAACAGACCGG + Intergenic
1176216888 20:63952239-63952261 GGGCTGTCTGAACAGCAGAGTGG + Intronic
1178880014 21:36441972-36441994 GGCCTGAGTCAATGCCAGAGTGG - Intergenic
1181589677 22:23876471-23876493 GGCGTGACACCACAACACAGTGG + Intronic
1184149801 22:42631366-42631388 GGCGTGACTCACCGACAGGGAGG + Exonic
1184948642 22:47823037-47823059 GGCCCAACTCAACTACTGAGTGG + Intergenic
949128911 3:477928-477950 GCCCTGAGTCAACAGAAGAGGGG - Intergenic
949482633 3:4508680-4508702 GGCCTGTTTTAACACCAGAGTGG + Intronic
952910588 3:38181216-38181238 GGACAGACTCAATAGCAGAGTGG - Intronic
955532286 3:59886648-59886670 GGAGTAACTCACCAACAGAGAGG + Intronic
955872254 3:63451573-63451595 GCCCTGACTCCACAACAAATGGG - Intronic
958510231 3:95037997-95038019 GAACAGACTCAACAACAGTGTGG - Intergenic
967819214 3:193825750-193825772 GGCCTGAGTCCATGACAGAGGGG + Intergenic
969207018 4:5654763-5654785 GGCCTGACTCAACAACAGAGTGG - Intronic
973038650 4:45442664-45442686 GGCCTTACTCAACCACAAGGGGG - Intergenic
973216813 4:47678787-47678809 GTCTTGACTCAAGAACAGAGAGG - Intronic
974025759 4:56732029-56732051 GGGCTGACCCAACAGCACAGAGG + Intergenic
982949494 4:161672201-161672223 TGCCTGACTCAACTTCAGACAGG + Intronic
984162484 4:176270805-176270827 TGCCTGACTCCACACTAGAGAGG + Intronic
984426177 4:179589177-179589199 AGCCTGAATCAACAGCAAAGAGG - Intergenic
985669678 5:1200994-1201016 GGCCTGAATCAACCTGAGAGTGG - Intergenic
988477852 5:31603562-31603584 GGCCTAACACCAAAACAGAGAGG + Intergenic
988488089 5:31683706-31683728 AGCCTGCCTCAACAGCAGACTGG - Intronic
988684846 5:33516186-33516208 GGTCTCACTCAACAAGTGAGTGG - Intergenic
992050625 5:72937274-72937296 GTCCTGCCTCAACCACTGAGTGG + Intergenic
1000294211 5:159898944-159898966 GACCTGCCTGAACAACATAGTGG + Intergenic
1010446293 6:75952453-75952475 GGCATAACTCACCAACAGACAGG - Intronic
1012989261 6:105908278-105908300 GACCTGAACCAACTACAGAGGGG + Intergenic
1017873178 6:158503115-158503137 GCCCTGACTCAGCATCAGAGAGG - Exonic
1023315427 7:38931222-38931244 GACTTGACTCAGGAACAGAGAGG - Intronic
1024579388 7:50789625-50789647 GGCTGGACCCAGCAACAGAGTGG - Intronic
1024783584 7:52880253-52880275 GCCCAGTCTCAACAACATAGAGG + Intergenic
1029649219 7:101879520-101879542 GACCAGCCTCAACCACAGAGAGG - Intronic
1030866468 7:114706407-114706429 AGGCTGACTCAACCACAGAGGGG - Intergenic
1033097802 7:138446121-138446143 GTACTGACTCAAGAACACAGAGG - Intergenic
1036035391 8:5013114-5013136 GGCCTGACTTAGCAACAGGCTGG - Intergenic
1038646816 8:29368991-29369013 GGCCTGTCTGAACAACAGCAAGG + Intergenic
1039006753 8:33046589-33046611 GGATGGACTCAACAACAGAATGG + Intergenic
1039243495 8:35582502-35582524 GGCCTCACAGAACAACTGAGTGG - Intronic
1042829731 8:73013439-73013461 TGCCTGACTCAACATCTGGGTGG + Intronic
1043692304 8:83169351-83169373 GCCCTGGCTCAACAATAAAGTGG - Intergenic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1048879407 8:138860289-138860311 GTCCTGACTCTGCCACAGAGGGG - Intronic
1049256007 8:141614303-141614325 GAGATGACTCAACATCAGAGAGG + Intergenic
1052328920 9:27247323-27247345 GACTTGACTGAACAACAGTGAGG - Intergenic
1053417136 9:37953831-37953853 GTCCTGACTCATCACCCGAGGGG - Intronic
1055629899 9:78212714-78212736 GGCCAAACTGAACCACAGAGAGG - Intergenic
1056414654 9:86364823-86364845 GTGCTGACTCAAGAACAGGGAGG - Intergenic
1056991718 9:91419386-91419408 TGCCTGACTCACCAGCTGAGTGG - Intronic
1057721959 9:97539277-97539299 GGCCAGAGCCAACAACAGAATGG + Intronic
1058754781 9:108074226-108074248 GCCCTGAGTCAACATCACAGTGG + Intergenic
1061190845 9:129081713-129081735 GGCACGATTCCACAACAGAGAGG + Intronic