ID: 969207070

View in Genome Browser
Species Human (GRCh38)
Location 4:5655163-5655185
Sequence GTTCTTATGGGGTTTGTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969207070_969207075 -9 Left 969207070 4:5655163-5655185 CCCTTTACAAACCCCATAAGAAC 0: 1
1: 0
2: 0
3: 14
4: 163
Right 969207075 4:5655177-5655199 CATAAGAACCCCGTCATGTCAGG 0: 1
1: 0
2: 0
3: 0
4: 54
969207070_969207079 2 Left 969207070 4:5655163-5655185 CCCTTTACAAACCCCATAAGAAC 0: 1
1: 0
2: 0
3: 14
4: 163
Right 969207079 4:5655188-5655210 CGTCATGTCAGGTGCTGCGCAGG No data
969207070_969207080 20 Left 969207070 4:5655163-5655185 CCCTTTACAAACCCCATAAGAAC 0: 1
1: 0
2: 0
3: 14
4: 163
Right 969207080 4:5655206-5655228 GCAGGAACCTGCCACCTCTCAGG 0: 1
1: 0
2: 2
3: 19
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969207070 Original CRISPR GTTCTTATGGGGTTTGTAAA GGG (reversed) Intronic
900664713 1:3807394-3807416 GTTGTGATAAGGTTTGTAAAGGG + Intergenic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
903644939 1:24889487-24889509 CTTCTACTGGGGTTTGTTAAAGG + Intergenic
907709886 1:56869842-56869864 GTTCTTGCAGGGTTTGTGAATGG + Intronic
907724940 1:57011005-57011027 GTTCTCAAGGGGTTGCTAAAGGG - Intronic
908831362 1:68181798-68181820 GTTCTTGTCAGGTTTGCAAATGG - Intronic
910313388 1:85854239-85854261 GTTATTATCGGCTTTGTCAAAGG + Intronic
913411134 1:118553034-118553056 CTTCTTATGGCGATTGTGAATGG - Intergenic
916672751 1:167038372-167038394 GTTCTTGTTGGCTTTGTAAAAGG + Intergenic
917982241 1:180277243-180277265 ACTCTTCTGGGGTTTGGAAATGG + Exonic
918358756 1:183733147-183733169 GTCCTTACGGGGTTTGCTAAAGG + Intronic
920566328 1:206976420-206976442 TTCCTTTTGGGTTTTGTAAATGG + Intergenic
922623483 1:227011623-227011645 GTTCTTTTTGGGTGTCTAAATGG - Intronic
924279381 1:242420778-242420800 GTTCTGATGGTCTATGTAAAAGG - Intronic
1063966225 10:11348139-11348161 GTTGTGATAAGGTTTGTAAAGGG - Intergenic
1066511856 10:36108636-36108658 ATTCTTTGGGGTTTTGTAAAAGG - Intergenic
1068516581 10:58032594-58032616 GTTTTTGTCAGGTTTGTAAAAGG + Intergenic
1072105738 10:92271860-92271882 ATTCTTGTGGTGTTTGCAAATGG + Intronic
1074211476 10:111339486-111339508 ATGCTTTTGGGGTTTGTCAAGGG + Intergenic
1074242760 10:111655265-111655287 TTTGTTATGGGGCTTGTAATAGG - Intergenic
1075247782 10:120839407-120839429 GTTCTCATGGGGGTTGAATAGGG - Intergenic
1075855215 10:125624228-125624250 GTTCTTAGGGGGATAGTGAATGG - Intronic
1080618238 11:33964168-33964190 AGTCTTATTGGGTTTTTAAAAGG + Intergenic
1082137005 11:48560908-48560930 ATTATTATGTGGTTTGTAAGGGG + Intergenic
1083484792 11:62976627-62976649 GTTCTGGTGGGGTTTATAAAGGG + Exonic
1083915060 11:65736989-65737011 GTCATGATGGGGTTTGTGAAGGG - Intergenic
1085211905 11:74788875-74788897 ACTATAATGGGGTTTGTAAAAGG + Intronic
1091486120 12:890361-890383 TTTCCTATGGTCTTTGTAAAAGG - Intronic
1092717986 12:11411308-11411330 GTTCTTATAACGTTTGTAAAAGG - Intronic
1095075358 12:37914865-37914887 GTTCTTATAGAATCTGTAAAGGG - Intergenic
1095323576 12:40860043-40860065 AGTCTTATAGGGTTTGTAACAGG - Intronic
1096431191 12:51544544-51544566 GTTTTTATGGTGTTTCAAAAGGG - Intergenic
1096549777 12:52364437-52364459 GTTCTTCCGGGGATTGAAAAGGG + Intronic
1102371416 12:112384950-112384972 GTTGTTATTAGGTTTGGAAAAGG - Intergenic
1102653511 12:114460861-114460883 GTTGTTATGGGGATTGAACAAGG + Intergenic
1106194069 13:27478271-27478293 GTTCTTCTGGGGTCTGTATATGG + Intergenic
1106297394 13:28428369-28428391 GTTCTTATTAGTTTTATAAATGG + Intronic
1106730457 13:32536629-32536651 TTTCTCAGGGGGTTTGTAAATGG + Intronic
1107221394 13:37985299-37985321 ATTCTTCTGGTTTTTGTAAAGGG - Intergenic
1108372928 13:49788879-49788901 GTTATTCTGAGGTTTATAAATGG - Intronic
1109324282 13:60848894-60848916 GTTCTTAATGGGTTTGAAATTGG + Intergenic
1111976972 13:94976713-94976735 ATTATTATGGTGTTTGTCAATGG + Intergenic
1118635199 14:67742532-67742554 GTTCATATGGAGTTGGTAGAAGG + Intronic
1121673888 14:95736533-95736555 GTTTTTATGTGTTCTGTAAATGG - Intergenic
1126405595 15:48319604-48319626 ATTGAGATGGGGTTTGTAAAGGG + Intergenic
1126975110 15:54169181-54169203 ATTCTTTTGGGCTTTTTAAAAGG - Intronic
1133765249 16:8833170-8833192 GTTCTTATGGGTTTTGGGATAGG + Intronic
1133765990 16:8838099-8838121 GTTCTTATGGGTTTTGGGATAGG + Intronic
1133767035 16:8845156-8845178 GTTCTTATGGGTTTTGGGATAGG + Intronic
1137323078 16:47406353-47406375 AATCTTCTGGGGTTTTTAAAAGG + Intronic
1138374093 16:56550727-56550749 CTTCCTGTGGGGTTGGTAAAAGG + Intergenic
1140129184 16:72144080-72144102 GTTGTTATTGGTTTTATAAATGG - Intronic
1149956419 17:61055719-61055741 GTTCTTACATGGTTTATAAATGG + Intronic
1150890435 17:69142981-69143003 GTTCTCATGGGGTGTGGGAAGGG + Intergenic
1152038667 17:77889328-77889350 GTTACTTTGGGGTTTGTATAGGG - Intergenic
1153109290 18:1564702-1564724 GTCCTTTTTGGGTTTGTAGACGG + Intergenic
1153855740 18:9144359-9144381 ATTCTTCTGGGGTTTTTGAAGGG - Intronic
1158347472 18:56530400-56530422 GTTTTTGTGAGGTTTGTCAAAGG - Intergenic
1159084425 18:63772374-63772396 ATTATTGTTGGGTTTGTAAATGG - Intronic
1164347270 19:27281831-27281853 GTTTTTCTGAGGTTTGTCAAAGG + Intergenic
1164842604 19:31404439-31404461 GTCCTTATGGGGCTTGTTGATGG + Intergenic
925434617 2:3826241-3826263 ATTATTATGGGGTTTTTAATGGG - Intronic
930652204 2:53973650-53973672 GTTCTTATAGGTTTTGGAATAGG - Intronic
931235045 2:60406052-60406074 ATCCATATGGGGTTTGTAAGAGG - Intergenic
932532134 2:72546861-72546883 GTTCTTATGAGGCTTATACAAGG + Intronic
932662245 2:73665772-73665794 GTTTTTATCAGGTTTGTCAAAGG + Intergenic
932961388 2:76416021-76416043 GTTTTTATGGGGTTTGTGGGAGG - Intergenic
935515172 2:104027280-104027302 GTTTTTATGGAGTTATTAAAAGG + Intergenic
935855859 2:107272315-107272337 TTTCTTTATGGGTTTGTAAATGG + Intergenic
937173537 2:119902891-119902913 GGTCTTAGGGGGTGTGTAGAGGG - Intronic
938729276 2:134133748-134133770 GTTTTTAAGGGTTTTGGAAAGGG + Intronic
938893966 2:135732758-135732780 GTTCTTACTGGGTCTGCAAAAGG - Intergenic
938962646 2:136356974-136356996 GTTGGTAGGGGGTTTGTAAAAGG - Intergenic
942090722 2:172488082-172488104 GTTTTAATGAGGATTGTAAATGG - Intronic
943496110 2:188622619-188622641 GTTTTTAGAGGGTCTGTAAATGG + Intergenic
943545463 2:189271373-189271395 GTTTTTATCAGGTTTGTCAAAGG - Intergenic
943574875 2:189619532-189619554 TTCCTTATGGGGTTAGTCAAAGG - Intergenic
944143959 2:196486078-196486100 ATTTTTGTGGGTTTTGTAAAGGG + Intronic
947233237 2:227910615-227910637 CATCTTATGGGGTTGTTAAAGGG - Intronic
1170614430 20:17937512-17937534 GTTCTGATGGGGTTTGGAGAGGG - Intergenic
1177284378 21:19029762-19029784 TTTCTGATGGGGTTTATAAAAGG - Intergenic
949985557 3:9537923-9537945 GTTCTTATGGGATGTGCAAGGGG - Intronic
950886908 3:16370277-16370299 TTTCTGTTGGGATTTGTAAAGGG + Exonic
951889298 3:27553501-27553523 GTTCTTATAGGGTTTGGGATAGG + Intergenic
952467432 3:33604642-33604664 GTTCTAATGCGATTTGTAAAAGG - Intronic
955434606 3:58889299-58889321 GCTGTGATGGGGTTTGTAAATGG - Intronic
955945248 3:64187621-64187643 GTTTTTATGGGGGTTTTAGAAGG + Intronic
956550461 3:70452881-70452903 GTTTTTATCAGGTTTGTGAAGGG + Intergenic
957587247 3:82147997-82148019 CTTCATATGGTTTTTGTAAAAGG + Intergenic
959384257 3:105682451-105682473 GTTTTTAATGTGTTTGTAAAGGG + Intronic
959619204 3:108381814-108381836 CTCCTTATGGGGTTGGCAAAGGG - Intronic
965373257 3:167890880-167890902 GCTTTTATGAGCTTTGTAAATGG - Intergenic
966060775 3:175751852-175751874 GTTTTTATGGGGTTTTTGTAGGG + Intronic
966670375 3:182519518-182519540 TTTCTTATGCGGTTTGGAATAGG - Intergenic
967328418 3:188265828-188265850 GCTGTCATGGGCTTTGTAAAAGG + Intronic
968529239 4:1081720-1081742 GTTCTTACTGGGTTTGCAAACGG + Intronic
969207070 4:5655163-5655185 GTTCTTATGGGGTTTGTAAAGGG - Intronic
971597170 4:28545306-28545328 GTTCTTATGCAGCTTGGAAATGG - Intergenic
973687781 4:53390825-53390847 ATTATAATGGCGTTTGTAAAGGG + Intronic
975144417 4:70951994-70952016 GTTGTTAATGGGATTGTAAAAGG + Intronic
977434007 4:96970235-96970257 GTATTTATGTGGTTTTTAAATGG + Intergenic
979648048 4:123094862-123094884 GTGATAATGGGGTTTGTGAAAGG - Intronic
980506087 4:133724108-133724130 GTTCTTTCGTGTTTTGTAAATGG - Intergenic
980514762 4:133841389-133841411 GTTCTCATTGGGTTTGTGATTGG + Intergenic
980784487 4:137534332-137534354 GCTCTTTTGGTGTTTGCAAAGGG - Intergenic
981250056 4:142590208-142590230 ATTTTTATGGGTTTTGAAAAAGG - Intronic
982714628 4:158793843-158793865 GCTGTGATGGGGTTTGTAAATGG + Intronic
983795714 4:171860073-171860095 GTTCTTATGTGGACAGTAAAAGG - Intronic
985701129 5:1373474-1373496 GTTGTAATGGGGTTTGTGAAGGG + Intergenic
989840151 5:46055009-46055031 GTTCTTATAGGATCTGCAAAGGG + Intergenic
989840763 5:46065127-46065149 GTTTTTATAGGGTCTGCAAAGGG + Intergenic
992865022 5:80949542-80949564 GACCTTATGGGGTTTGTAATGGG - Intergenic
993788126 5:92170199-92170221 GTTAGTTTGGGATTTGTAAATGG - Intergenic
995806200 5:116054925-116054947 GTTTTTATGGAGTTTTTAATGGG - Intronic
996190642 5:120537211-120537233 GTTCTTCTGGGATTTTTATATGG - Intronic
996905546 5:128595704-128595726 CTTCATATGGGTATTGTAAAAGG + Intronic
998724574 5:144995841-144995863 GTTTTTCTCAGGTTTGTAAAAGG + Intergenic
1000401087 5:160827865-160827887 GTTCTTCTCAGGTTTGTCAAAGG + Intronic
1003134426 6:3423371-3423393 GTTCTTATTCGTTTTGTACAGGG + Intronic
1003246899 6:4389638-4389660 GCTATTATGAGGCTTGTAAAGGG - Intergenic
1008118845 6:47586795-47586817 GTTCTTGTGAGATTTTTAAATGG - Intronic
1008370037 6:50721539-50721561 CTTCTTTAGGGTTTTGTAAAAGG - Intronic
1008487724 6:52053620-52053642 ATTCTCATGGGTCTTGTAAATGG - Intronic
1009298584 6:61986289-61986311 GTTAGTAAGGGGTTTGAAAATGG + Intronic
1012369925 6:98491364-98491386 GTGCATATGGGGTATGGAAAAGG - Intergenic
1014404407 6:121031684-121031706 GTTCTTATGTGGCTTGTAGCTGG - Intergenic
1015973252 6:138763617-138763639 GTTGTTTTGGAGTTTATAAATGG - Intronic
1015995452 6:138991609-138991631 CTTGTTATTGGGTTTGCAAAGGG + Intergenic
1016710711 6:147168442-147168464 ATTCCTATGGGGTCTGTGAAAGG + Intergenic
1017849512 6:158292719-158292741 TTTCTTATAGCGTTTGTATAAGG - Intronic
1018843761 6:167539735-167539757 GATATTGTGGGTTTTGTAAATGG - Intergenic
1023110877 7:36809353-36809375 CATCTTATGGGATTTGTTAAGGG + Intergenic
1026166473 7:67914537-67914559 GTTATCATGGCATTTGTAAACGG - Intergenic
1028675584 7:93456957-93456979 CTGCTTATGGGGTTTATTAAAGG + Intronic
1029901074 7:104040345-104040367 GAACTCATGGGGTTTCTAAAAGG + Intergenic
1031027885 7:116700366-116700388 CTTCTTTTGTGCTTTGTAAATGG + Intronic
1031353829 7:120766215-120766237 GTTCCTATAAGCTTTGTAAACGG - Intergenic
1031716632 7:125116537-125116559 GTTGTTATGGGGTTTTAATATGG + Intergenic
1032479044 7:132232081-132232103 TTTCTTGTGGGGTCTGTCAAGGG + Intronic
1033084447 7:138329535-138329557 GTTCTTATAGGTTTTGGAATAGG - Intergenic
1033783435 7:144700774-144700796 TTTCATATGGGGTTAGAAAAGGG - Intronic
1034152667 7:148929122-148929144 GGTCCTATGGGGTCTGAAAAAGG - Intergenic
1035332410 7:158104953-158104975 GTTCTGATGGAGTTTGGATAAGG - Intronic
1036097469 8:5739864-5739886 GTTTTTGTCGGGTTTGTCAAAGG + Intergenic
1041125639 8:54635841-54635863 TTTCTTGTGGGGGTTGTAGATGG - Intergenic
1046175152 8:110566040-110566062 CTACTTATGGGCTTTCTAAATGG + Intergenic
1048344308 8:133565469-133565491 CTTCTTCTGGGGGTGGTAAATGG + Intronic
1048349891 8:133607778-133607800 GTTCTTATAGGGTTTGGGATAGG - Intergenic
1048960914 8:139576006-139576028 GATCTGATGGGTTTTATAAAGGG + Intergenic
1049092967 8:140530631-140530653 GTTCTTCTGGGGTTTGCATTTGG - Intergenic
1050017914 9:1254859-1254881 ATTCCTATGAGGTATGTAAATGG + Intergenic
1050465325 9:5916855-5916877 GTTATTAAGGGTTCTGTAAAGGG - Intronic
1050607622 9:7317779-7317801 GTTTTCATGGGGTTTGAGAAGGG - Intergenic
1051670636 9:19506202-19506224 ATTTTTATTAGGTTTGTAAATGG + Intergenic
1051869657 9:21723066-21723088 GTTCTTAAGGAGTTTGTACTGGG + Intergenic
1053715908 9:40886457-40886479 GTTCTTATAGGTTTTGGAATAGG - Intergenic
1058811907 9:108647924-108647946 TTTGTTTTGGGGTTTGGAAAGGG + Intergenic
1059723268 9:116982502-116982524 GGTCTTTTGGGTTTTGCAAAGGG - Intronic
1061019948 9:128007957-128007979 GTTGTTTTTGAGTTTGTAAAGGG - Intergenic
1203466202 Un_GL000220v1:90434-90456 GTTCATATGGACTTTGTACATGG - Intergenic
1203396460 Un_KI270519v1:18967-18989 GTTTTTGTAGGGTCTGTAAATGG + Intergenic
1186995794 X:15120718-15120740 GTTCTTATGGTGATGGTAGAAGG - Intergenic
1187931015 X:24293568-24293590 GTTGTTTTGGGGTTTGGAGATGG - Intergenic
1189096780 X:38148867-38148889 GATCTTATGGGGTAAGGAAAAGG + Intronic
1189585978 X:42462407-42462429 CTCCTTATGGGCTTTGTACATGG - Intergenic
1190224480 X:48534627-48534649 ATGCTTATAGGGTTAGTAAAGGG - Intergenic
1192692530 X:73379571-73379593 GTTTTTGTTGGGTTTGTCAAAGG - Intergenic
1193090187 X:77485779-77485801 TTTCTTATGGGTTTTCTAGATGG - Intergenic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1195947225 X:110228066-110228088 GTTCTTATGGCCTCTGTAATTGG + Intronic
1197171154 X:123435913-123435935 GTCCTTATGGGGTTGGTGAGAGG + Intronic
1197349398 X:125364593-125364615 GTTTTTGTCAGGTTTGTAAAAGG + Intergenic
1197579691 X:128266316-128266338 GTTCTTATGAGGTTGTTATAAGG - Intergenic
1198004226 X:132475657-132475679 GTTTTTATTGGGTGTGAAAATGG + Intronic
1199003898 X:142673473-142673495 GTTCTTCTCAGGTTTGTCAAAGG + Intergenic
1199417370 X:147600685-147600707 ATTGTTATGCGGTTTTTAAAAGG - Intergenic
1200812540 Y:7500872-7500894 GTTCTTATAGGTTTTGGAATAGG - Intergenic
1201455930 Y:14166692-14166714 CTTCTTATAGGGTTTGGGAATGG + Intergenic