ID: 969210474

View in Genome Browser
Species Human (GRCh38)
Location 4:5683527-5683549
Sequence CTGGAGACACAGTTGTGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969210469_969210474 7 Left 969210469 4:5683497-5683519 CCTATTACGTGCAGGGTTCTCTT 0: 1
1: 0
2: 0
3: 3
4: 93
Right 969210474 4:5683527-5683549 CTGGAGACACAGTTGTGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969210474 Original CRISPR CTGGAGACACAGTTGTGAAT AGG Intronic
No off target data available for this crispr