ID: 969210662

View in Genome Browser
Species Human (GRCh38)
Location 4:5684767-5684789
Sequence GGGTCTTTACAGAGGTAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 8, 3: 34, 4: 219}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969210655_969210662 12 Left 969210655 4:5684732-5684754 CCAGTGCCCTAGGATGGTGACTG 0: 1
1: 0
2: 1
3: 14
4: 144
Right 969210662 4:5684767-5684789 GGGTCTTTACAGAGGTAGTAAGG 0: 1
1: 0
2: 8
3: 34
4: 219
969210656_969210662 6 Left 969210656 4:5684738-5684760 CCCTAGGATGGTGACTGCATTTG 0: 1
1: 0
2: 2
3: 38
4: 357
Right 969210662 4:5684767-5684789 GGGTCTTTACAGAGGTAGTAAGG 0: 1
1: 0
2: 8
3: 34
4: 219
969210657_969210662 5 Left 969210657 4:5684739-5684761 CCTAGGATGGTGACTGCATTTGG 0: 1
1: 0
2: 0
3: 37
4: 295
Right 969210662 4:5684767-5684789 GGGTCTTTACAGAGGTAGTAAGG 0: 1
1: 0
2: 8
3: 34
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969210662 Original CRISPR GGGTCTTTACAGAGGTAGTA AGG Intronic
900502114 1:3011464-3011486 GGGTCTTTGCAGATGTAACAAGG - Intergenic
901339142 1:8479456-8479478 GGGTCTTTGCAGATGTGCTAAGG + Intronic
902086546 1:13867268-13867290 AGGTCTTTGCAGATGTAGTCAGG - Intergenic
902661637 1:17908332-17908354 GAGGATTTGCAGAGGTAGTAAGG + Intergenic
902987873 1:20166423-20166445 GGATCTTCACAGAGGCAGGAGGG - Intronic
904489355 1:30848751-30848773 GGGTCTTTGCAGATGTAATCAGG - Intergenic
906793967 1:48681957-48681979 GGGCTTTTAAAGAGGTAGCAAGG + Intronic
907431863 1:54416950-54416972 GGGTCTTTCCAGTGGGAGAATGG - Intergenic
908313997 1:62914890-62914912 GGATCTTTATAGAGGTAATGAGG + Intergenic
910268796 1:85370101-85370123 GGGTCTTTAGAGAGATAATCAGG + Intronic
910286262 1:85557707-85557729 GGGTCTTTAAAGAGGTAATTAGG + Intronic
911595062 1:99790153-99790175 GGGCCTTTACAGAGCTAATCAGG - Intergenic
912204287 1:107493285-107493307 GGATCTTTAAAGAGGTAATTAGG + Intergenic
912540905 1:110414592-110414614 GGACCTTTACAGAGGTAATCAGG + Intergenic
916439068 1:164804978-164805000 GGCTCTTAGCAGAGGTATTAGGG + Intronic
919088084 1:192945406-192945428 GCGTTTTCACAGATGTAGTAGGG - Intergenic
919516727 1:198534176-198534198 GGGTCTTTGCAGATGTAATCAGG + Intronic
920446937 1:206024779-206024801 GGGTCTTTAAAGAGGTATTAAGG - Intergenic
920702102 1:208225621-208225643 GGGTCTCTACAGAGGTAATCAGG + Intronic
921770260 1:219028364-219028386 GGGTCTTTAAAGGGGTAATTAGG - Intergenic
922274021 1:224060033-224060055 TGGGCTTTACAGAGGAAGGAAGG + Intergenic
923378751 1:233393307-233393329 GGGCCTTTACAGAGGCGATAAGG - Intergenic
923469901 1:234281156-234281178 AGGTCTTTACAGAAGTAATTAGG + Intronic
923542219 1:234896754-234896776 GTTTCTTTTCAGAGGTAGTGTGG - Intergenic
924144800 1:241062848-241062870 GGCTATTTACAGAAGTAATAGGG - Intronic
1063085910 10:2817631-2817653 AGGTCTTTACAGAGAAAATAAGG - Intergenic
1063490483 10:6459318-6459340 GGGTTTCTTCAGAGGTAGAATGG - Intronic
1063541715 10:6940766-6940788 GTGTATTTACAGAGGTAATTAGG - Intergenic
1063559503 10:7113212-7113234 GAGTCTTTACAGAGGAAATCAGG + Intergenic
1064726783 10:18288131-18288153 AGGTCTTTACAGAGGTAATCAGG - Intronic
1065015280 10:21457120-21457142 AGGCCTTTACAGAGGTAATGAGG - Intergenic
1065249805 10:23799203-23799225 GGGTCTTTACAGAAGTTGTTAGG - Intronic
1066664972 10:37773791-37773813 GGGCCTTTACAGAGATAATTAGG - Intergenic
1068590318 10:58846326-58846348 GGGTCTTGAAAGCTGTAGTAAGG - Intergenic
1068906976 10:62337545-62337567 GGGGCTTTTCAGATGTAGTTGGG - Intergenic
1069880928 10:71592694-71592716 GGGACTTTGCAGATGTAGTTTGG - Intronic
1071434488 10:85634199-85634221 GGGGCTTTATAGGGGTAGTGGGG + Intronic
1071553669 10:86586149-86586171 GGGTCTTAGCAGAGGGAGTCAGG + Intergenic
1071765077 10:88654955-88654977 GAGTCTTTAAAGAGGTAATTAGG + Intergenic
1073935260 10:108623584-108623606 GGATCTTTACTGAAGTATTAGGG + Intergenic
1074011966 10:109491226-109491248 GGGCCTTTATAGAGGTAATTAGG + Intergenic
1077252299 11:1566058-1566080 GGGTCTCTCCAGAGGGAGAAGGG - Intronic
1080117217 11:28634428-28634450 GGCACTTTACAGAGGTATTTAGG - Intergenic
1080872425 11:36248483-36248505 GGGTCGTCACAGAGGTAATTAGG - Intergenic
1082184693 11:49164906-49164928 TGGACTTTACAGAGTTAGTTGGG - Intronic
1085131959 11:74047721-74047743 GGGCCTGTAAAGAGGTAGAATGG + Intronic
1085393673 11:76195282-76195304 GGGTCTTTGCAGATGTAATGGGG + Intronic
1086681649 11:89680453-89680475 TGGACTTTACAGAGTTAGTTGGG + Intergenic
1088984332 11:114892263-114892285 GGGTCAGTACAGAGGGAGGAAGG + Intergenic
1089579464 11:119472416-119472438 GGGCCTTTACCGAGGTAATTAGG + Intergenic
1089664165 11:120006907-120006929 TGGTCTTTCCAGGGGTAGAAGGG + Intergenic
1094262469 12:28516798-28516820 ATGTCATTACTGAGGTAGTAGGG - Intronic
1095906430 12:47382867-47382889 AGGTCTTTACAGAGGTAATTGGG - Intergenic
1097689347 12:62719833-62719855 GGGTTATTAAAGAGGTAGAATGG - Intronic
1100325083 12:93532725-93532747 GGGTCTTTAAATTGGTATTAAGG + Intergenic
1100442732 12:94631360-94631382 GGGACTTTAAAGAGGTAATTAGG + Intronic
1102580013 12:113880374-113880396 GGATCTTTACAGATGTAGGCAGG - Intronic
1103144221 12:118580440-118580462 GGGTCTTTAAAGAGGGATTAAGG + Intergenic
1103836447 12:123824852-123824874 GGGTCTTTGCAGAGGTAGTTAGG - Intronic
1111107031 13:83659660-83659682 GGGTCGTTATAGATGTAATAAGG - Intergenic
1116402250 14:44522199-44522221 GGGTCTTTACAGATGTAATTAGG + Intergenic
1116927158 14:50651365-50651387 GGGTATTTACAGGGGGAGGAAGG + Intronic
1117003339 14:51393956-51393978 GGGTCTTTATAGAGGTAATTAGG - Intergenic
1117868761 14:60175970-60175992 GGGTCTTTTCAGTGGTCATATGG - Intergenic
1117906641 14:60595858-60595880 GGGGCTTTTGAGAGGTAGTTAGG - Intergenic
1119169371 14:72522303-72522325 GGGTCTTTTGAGAGGTAATTAGG - Intronic
1121240202 14:92424259-92424281 GTGCCTTTAGAGAGGTAATAAGG + Intronic
1121857792 14:97286171-97286193 GGGTCTTTGCAGAGATAATCAGG + Intergenic
1121883467 14:97521524-97521546 GAGTCTTTCCAGGGGCAGTATGG + Intergenic
1122199188 14:100111898-100111920 GGGTCTTTTGAGAGGCAGTCTGG - Intronic
1124636520 15:31368109-31368131 GGGTCTTTGCAGATGTAATCAGG - Intronic
1124696098 15:31865626-31865648 GGGTCTTCTCAGAGGTAGCAAGG + Intronic
1125590573 15:40852331-40852353 GGGTCTTTGCAGAAGTAATTAGG - Intronic
1126607478 15:50493218-50493240 GGGCCTTTAAAGAGGTGATAAGG - Intronic
1127375002 15:58376307-58376329 GGGTCTTTAAAGAGGTAAAATGG + Intronic
1128686699 15:69691627-69691649 GGGTCTTTTAAGAGGTGGTTAGG - Intergenic
1132174320 15:99697939-99697961 GGTTTTTGGCAGAGGTAGTAAGG + Intronic
1132302747 15:100786684-100786706 GGGCCTTTAAAGAGGCAGTTAGG + Intergenic
1135060924 16:19270745-19270767 GGGTCTTTACAAAGGTGATCAGG + Intergenic
1137364063 16:47845422-47845444 GGGCCTTTAAAGAGGTAATTAGG - Intergenic
1137451219 16:48576481-48576503 GGAGATTTACAGATGTAGTAGGG - Intronic
1138687337 16:58737053-58737075 GGGTCTTTACAGATGTAATCAGG - Intergenic
1139130437 16:64136253-64136275 GGGTTTGAACAGAGGAAGTAGGG + Intergenic
1139143764 16:64298875-64298897 GGACTTTTACAGAGGTAGTCAGG + Intergenic
1140644770 16:77017716-77017738 GGGTCTTTGCAGATGTAATCAGG + Intergenic
1141731363 16:85825175-85825197 GGGTCTTTGCAGATGTAATCAGG - Intergenic
1141821208 16:86447286-86447308 GGGTTTTTACAGAGGCAACAAGG - Intergenic
1143276009 17:5711395-5711417 GTGTCTTTCCAGAGGTAGGTGGG - Intergenic
1144359843 17:14481615-14481637 GAGGCTTCACAGAGGAAGTAGGG - Intergenic
1146517326 17:33499357-33499379 GGGTCTTTGCAGATGTAATTAGG + Intronic
1146602744 17:34232905-34232927 GGGTCTTTTCAAAGATAGTCTGG - Intergenic
1147139475 17:38453318-38453340 GGGTCTGTACAGAGTGGGTAGGG + Intronic
1148478952 17:47947395-47947417 GAGACTTTACAGAGATAGTGGGG - Exonic
1150426376 17:65080508-65080530 AGGTCTTTACAGAAGTAATCAGG - Intergenic
1151447873 17:74178954-74178976 GGGTCTTTGCAGATGTAGTTAGG + Intergenic
1151871958 17:76842434-76842456 GGGTCTTTAAAGAGGTAATTAGG + Intergenic
1156234472 18:35188196-35188218 AGGCCTTTAAAGAGGTAGTTAGG - Intergenic
1157294418 18:46432533-46432555 GCATCTTTAAAAAGGTAGTAGGG + Intronic
1157565543 18:48676818-48676840 GATTCTTTAGAGAGGTAGTGGGG - Intronic
1157602463 18:48902359-48902381 CGGTCTCTACAGAGGAAGAAGGG - Intergenic
1158453953 18:57590626-57590648 GGGTCTTTGCAGACGCAGTCAGG - Intergenic
1158979938 18:62750106-62750128 GGGTCTTTAGAGGGGTGATAAGG - Intronic
1159194764 18:65098685-65098707 GGGTTTTTATAGAGGTCATATGG + Intergenic
1160784852 19:895335-895357 GGGTCTTTGCAGAGGTAATCAGG + Intergenic
1161077650 19:2294121-2294143 GGGTCTTTACAGATGTGCTCAGG + Intronic
1167340021 19:48909912-48909934 AGGTCTTTACAGAGGGAATCAGG - Intronic
925867660 2:8243299-8243321 GGGTCTTTGCAGATGTAATCAGG + Intergenic
927189968 2:20510846-20510868 GGGTCTTTGCAGAGGTAATTAGG - Intergenic
927691005 2:25208154-25208176 GGGTCTTTGCAGATGTAATCAGG + Intergenic
929399494 2:41563540-41563562 GGGTCATTAGAGAGGTAAAAAGG - Intergenic
930107426 2:47651088-47651110 GGGTCTCTGCAGATGCAGTAAGG - Intergenic
931669046 2:64630514-64630536 GGGTCTTTATAGAGGTAATTAGG - Intergenic
933942519 2:87256294-87256316 GGGTATTTATAGAGGTAATTAGG + Intergenic
935468195 2:103424918-103424940 GGGTCTTTACAGAGGAAATCAGG + Intergenic
936337706 2:111605274-111605296 GGGTATTTATAGAGGTAATCAGG - Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937438462 2:121897863-121897885 GGGTCTTTAAGGAGGTAACAGGG - Intergenic
939962624 2:148578849-148578871 GGGTCTTTACAGAGGTAATCAGG + Intergenic
939971536 2:148667371-148667393 GGATCTTTACAGAGATTGTCTGG + Intronic
940921453 2:159312404-159312426 GAGTCTGTTCAGAGGTAATAAGG + Intergenic
941361543 2:164557742-164557764 GGGTTTTTACAGAGCTGGTGTGG - Intronic
941414767 2:165206253-165206275 GGGTATTTACAGAGATAATCAGG - Intergenic
945607743 2:211957199-211957221 GGGTTTTTAAAGAGGTAATTAGG + Intronic
946499182 2:220227432-220227454 GAGTCTTTTCAGATTTAGTAGGG + Intergenic
948286491 2:236789929-236789951 GGGTCTTGGCAGAGGTAATCAGG + Intergenic
948557456 2:238823238-238823260 GGGTCTTTGCAGATGTAATTAGG + Intergenic
948756360 2:240161780-240161802 GGGTCTTTACAGAGGTAATGAGG - Intergenic
949005929 2:241647769-241647791 GTGGCTTTAGAGAGGTAGCAGGG + Intronic
1174633383 20:51977950-51977972 AGGTCTTTGCAGATGTAATAAGG + Intergenic
1175525632 20:59631517-59631539 GGGCCTTGACAGAGGCAGGAGGG + Intronic
1176423722 21:6535062-6535084 GGGTCTTTGCAGATGTAATGAGG - Intergenic
1177375689 21:20268399-20268421 GGTTCTTTAAAGAGGTAATTAGG + Intergenic
1178135800 21:29625990-29626012 GGGCCTTTATAGAGGTAATTAGG + Intronic
1178181022 21:30161743-30161765 GGGTCTTTATAGAGGTAATTAGG - Intergenic
1179119307 21:38528221-38528243 GGGTTATTGCAGATGTAGTAGGG - Intronic
1179261936 21:39765217-39765239 GGGTCTTTGCAGATGTAATTAGG - Intronic
1179699215 21:43143377-43143399 GGGTCTTTGCAGATGTAATGAGG - Intergenic
1180784616 22:18539844-18539866 GGGTCTTTGCAGATGTAATTAGG + Intergenic
1181128194 22:20713897-20713919 GGGTCTTTGCAGATGTAATTAGG + Intronic
1181241519 22:21479201-21479223 GGGTCTTTGCAGATGTAATTAGG + Intergenic
1182228064 22:28815427-28815449 GGTTCTGTACAGAGGCAGTGCGG + Intergenic
1184120487 22:42446566-42446588 GGGTCTTTTCAGATGTAATCAGG + Intergenic
1184919131 22:47593321-47593343 GGGTCTTTACAGGGGTGGTATGG + Intergenic
950164585 3:10784485-10784507 GGGTCACTACTGAGGTATTAGGG - Intergenic
951979491 3:28549796-28549818 GGGTCTTTAAAGAGGTAATTAGG - Intergenic
952182449 3:30932453-30932475 GGGCCTTTAGAGAGGTAATACGG - Intergenic
955520411 3:59770336-59770358 GGGTCTTTGTAGAGGTAATCAGG + Intronic
955547104 3:60042654-60042676 CGGCCTTTACAGAGGTAATCAGG - Intronic
955612525 3:60772974-60772996 GGGGCTTTTCAAAGGTAGTTTGG - Intronic
956552302 3:70474909-70474931 GGGTCTTTGCAGATGTAATCTGG - Intergenic
957245512 3:77711447-77711469 GGGTCTTTGCAGATGTAATTAGG - Intergenic
958523544 3:95223148-95223170 GGGTATTTAAATAGGAAGTAAGG - Intergenic
959108925 3:102098383-102098405 GAGCTTTCACAGAGGTAGTATGG + Intergenic
959167596 3:102799737-102799759 GGGTCTTTAAGGAGGTAATTAGG - Intergenic
961123799 3:124397719-124397741 GAGTCTATACAAACGTAGTAGGG - Intronic
962203826 3:133419210-133419232 GGGTCTTTAAAGAGGTAATTCGG - Intronic
962921868 3:139957668-139957690 GGGACTTTACAGGGGTAATGAGG + Intronic
963232986 3:142927584-142927606 GGGCCTTTAAAGAGGTAATCAGG - Intergenic
963773967 3:149419987-149420009 GGGTTATTACAGAGGTATTAAGG + Intergenic
964000113 3:151760992-151761014 GGGTCTTTACAAAGACAGTCAGG - Intronic
964100200 3:152979737-152979759 GGGTCTTTAAAAAGGTAATTAGG - Intergenic
966266723 3:178054960-178054982 GGTTCTTAGCAGAGGTAGGAAGG - Intergenic
968627351 4:1632200-1632222 CGGTCTCTAAAGAGGTAGTTAGG + Intronic
969210662 4:5684767-5684789 GGGTCTTTACAGAGGTAGTAAGG + Intronic
969336733 4:6515035-6515057 GGGTCTTTGCAGATGTAATCAGG - Intronic
969844913 4:9912887-9912909 GGGTCCTTAAAGAGGGAGTCAGG + Intronic
970801130 4:19975106-19975128 GGCACTTTAAAGAGGTAGTTAGG + Intergenic
971439342 4:26663136-26663158 GGGTCTTTTCAGAGTTGTTATGG + Intronic
971529380 4:27665622-27665644 GGGCCTATAAAGAGGTATTAAGG - Intergenic
973611734 4:52642165-52642187 GGGTGATTACAGAGGAATTATGG + Intronic
974095751 4:57362066-57362088 GGGTCTTTAAGGAGGTAATAAGG - Intergenic
974139598 4:57868040-57868062 TGATCTTTACAGAGGTAAAATGG - Intergenic
975983171 4:80182271-80182293 TGACCTTTACAGAGGTAGTTAGG + Intergenic
977020775 4:91756343-91756365 GGGCCTTTACAAAGGTAATTAGG - Intergenic
977027204 4:91834432-91834454 GGGTCTCTTCAGAGGCAGTGAGG + Intergenic
982429820 4:155309981-155310003 GGGACTTTTAAGAGGTAGTTGGG + Intergenic
984687815 4:182691086-182691108 GGGCATATACACAGGTAGTAAGG - Intronic
985316775 4:188666272-188666294 GGGTCTATACAGAGGTCTAATGG - Intergenic
985316782 4:188666322-188666344 GGGTCTATACAGAGGTCTAATGG - Intergenic
988411321 5:30889288-30889310 GGGTCTTTAAAGAGGTAATTTGG - Intergenic
989142491 5:38215359-38215381 GGGTCCTTTCAGAGGTAATTAGG - Intergenic
989799649 5:45521633-45521655 GGGTCATAACAGAGGTAATCAGG - Intronic
990683841 5:58277872-58277894 CGGTCTTTACAGGGATAGGATGG - Intergenic
991446677 5:66707658-66707680 GGGTCTTTAGAGAGGTATTTAGG - Intronic
991613233 5:68469597-68469619 GGGTCTTTGCAGAGGTAATCAGG + Intergenic
993914814 5:93731227-93731249 GGATCTTTACTGAGGTAATTAGG + Intronic
994605331 5:101960150-101960172 GCTGCTTTGCAGAGGTAGTAAGG + Intergenic
994796981 5:104316336-104316358 CTGTCTTCACAGAGATAGTATGG + Intergenic
997853056 5:137349867-137349889 GAGTCTTTAGAGAGGTAATCAGG - Intronic
999797685 5:155003570-155003592 GGGTGTTTAAAGAGGTATTCAGG - Intergenic
1000690063 5:164306538-164306560 GGGCCTTTAAAGAGGTAATTAGG + Intergenic
1001154702 5:169262968-169262990 GGGTCTTTGCAGATGTAATCAGG + Intronic
1003143394 6:3490140-3490162 GGGTCTTTACAGAGGTAATCAGG + Intergenic
1003617491 6:7668770-7668792 GGGTCTTTAAAGAGGTAATTAGG + Intergenic
1005027133 6:21474008-21474030 GAATCTTTACAGAGGTAATCAGG - Intergenic
1007050435 6:38822929-38822951 GGGAATTTACAGAGGAAGAAAGG - Exonic
1010021365 6:71163380-71163402 GGGTCTTTAGAGAGATTGTTTGG + Intergenic
1010729972 6:79380901-79380923 GGGTCTTTAAAGATGTAATTAGG - Intergenic
1012972225 6:105743607-105743629 GGATCTTTACATCAGTAGTATGG + Intergenic
1013066877 6:106692771-106692793 GGGCCTTTAAAGAGGTAATTAGG + Intergenic
1013487090 6:110607420-110607442 GGGCCTTTACAGAGGTAAGTAGG - Intergenic
1014409070 6:121091818-121091840 GGGTCTTTACAGACGTAATCAGG + Intronic
1015873322 6:137798778-137798800 GGGTCTTTAAAGAGGTTTTAAGG - Intergenic
1016134834 6:140527320-140527342 GGATCTTTACAAAGATAGTCAGG + Intergenic
1016188381 6:141226954-141226976 GTGTATTTACACAGGTATTATGG - Intergenic
1020514772 7:9104614-9104636 GGGTCTTTTGGGAGGTAGTTAGG - Intergenic
1020758470 7:12237437-12237459 GAGACATTACAGAGGTAGAATGG - Exonic
1022304022 7:29129420-29129442 GGGTCTTTGCAGACGTAGTAAGG + Intronic
1022637111 7:32146603-32146625 GGGTCTTTGCAGATGTATTTAGG - Intronic
1024248472 7:47488598-47488620 AGGTCTTTAAAGAGGTAATTAGG - Intronic
1024536538 7:50439524-50439546 GGGACTTTGCAGAGGTAATGCGG - Intergenic
1024762234 7:52612504-52612526 AAGTCTTTACAGAGGTAATTAGG - Intergenic
1026153359 7:67807138-67807160 GGGTCTTTAAAGAGGTAATTAGG + Intergenic
1026396014 7:69955181-69955203 GGGTGTGTTCAGAGGTGGTAGGG + Intronic
1028729123 7:94124945-94124967 GGAACTTTAGAGAGGTAGAAAGG - Intergenic
1029375746 7:100176105-100176127 GAGTCTTCACAGATGGAGTAAGG + Intronic
1029687512 7:102158882-102158904 GGGTGTTTAGAGATGGAGTAGGG - Intronic
1033575988 7:142685394-142685416 AGGACTTCACAGAGGTAGTGTGG - Intergenic
1033955019 7:146836393-146836415 CAGTTTTAACAGAGGTAGTATGG + Intronic
1034045514 7:147923224-147923246 GAGTCTTTACAGATGTACTCAGG + Intronic
1034241958 7:149617606-149617628 GGGTCTCTACAGAGGGAGTGAGG + Intergenic
1034258017 7:149735019-149735041 GGGTGTTTAGAGAGGTAATCAGG - Intergenic
1034825907 7:154262310-154262332 GGGCCTTTAAAGAGGTAATTAGG + Intronic
1036217987 8:6896798-6896820 GAGGGTTTACAGAGGTAGGAGGG - Intergenic
1036772979 8:11591795-11591817 GGGCCTGTTCAGAGGGAGTAAGG + Intergenic
1037831376 8:22191725-22191747 TGGTCTCTACAGTGGTAGGAAGG - Intronic
1039441162 8:37596197-37596219 GGGTCTCTAAAGAGGTAATTAGG - Intergenic
1039834204 8:41243526-41243548 GGGTTTTTGCAGATGTAGTTAGG + Intergenic
1039864183 8:41487011-41487033 GGGTCTTTACAGATGTAATCAGG + Intergenic
1041487100 8:58391653-58391675 GGATCTTTACTGATGTAATAAGG + Intergenic
1041902296 8:62995646-62995668 GGGAGTTTAGAGAGGTAGGAAGG + Intronic
1042315013 8:67417014-67417036 GGGTCATTGCAGATGTAGTTAGG + Intergenic
1044297854 8:90549120-90549142 TGATCTTTACAGATGTAGTTAGG + Intergenic
1045080740 8:98623376-98623398 GGGCCTTTAAAGAGGTATTAAGG + Intronic
1046404726 8:113757917-113757939 GGGTCTTTGCAGATGTTATAAGG + Intergenic
1048923007 8:139247578-139247600 GTGTCTGTACAGAGGGAGAAAGG + Intergenic
1048995924 8:139793701-139793723 GGCTGTTTAGAGAGGTGGTACGG + Intronic
1049352752 8:142172790-142172812 GGGTCTTTACAGAGGTACTTAGG + Intergenic
1050511094 9:6396642-6396664 GGGTCTTTAATGAGGTAACAAGG + Intergenic
1052889606 9:33686177-33686199 AGGACTTCACAGAGGTAGTGTGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055336023 9:75234438-75234460 GGGGCCTTTCAGAGGTGGTAAGG + Intergenic
1057040145 9:91842067-91842089 GGGTCTGCACAGGGGCAGTATGG - Intronic
1059264644 9:113015241-113015263 GGGACTTTAAAGAGGTGGTTAGG + Intergenic
1060758856 9:126232124-126232146 AGGTCTTTAAAGAGGTGATAAGG + Intergenic
1061247788 9:129409941-129409963 TGGTCTTTACAGAGGTAACCAGG + Intergenic
1061464241 9:130765248-130765270 GGGTTTTTTCAGAGGTACAAGGG + Intronic
1062470697 9:136702567-136702589 GGGTCTTTACAGCTGTAATTAGG + Intergenic
1185544018 X:927071-927093 GGGTCTTTGCAGATGTAATTAGG - Intergenic
1185770346 X:2761164-2761186 GGGTCTTTAAAGAGGTGAGAAGG + Intronic
1195732726 X:107982229-107982251 GGGTCTTGTCAGAGGTGGGAGGG - Intronic
1196069717 X:111507388-111507410 GGATTTTTATTGAGGTAGTATGG - Intergenic
1197822674 X:130557033-130557055 GGGTCATTACAGAGGTAATCAGG + Intergenic
1198420983 X:136470571-136470593 AGGTCTTTACAGGGCTGGTAAGG + Intergenic
1198882231 X:141294042-141294064 AGGTCTTTAAAAAGGTAATAAGG + Intergenic
1199981286 X:152921907-152921929 GGGTCTTTGCAGATGTAATCAGG - Intronic
1201299911 Y:12496563-12496585 GGGTCTTTAAAGAGGTGAGAAGG - Intergenic
1201905888 Y:19085255-19085277 GAGTCTTTACAGAGGTTTGAGGG + Intergenic