ID: 969211898

View in Genome Browser
Species Human (GRCh38)
Location 4:5694368-5694390
Sequence TAAGTTCTTCTTAGGCCAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969211895_969211898 11 Left 969211895 4:5694334-5694356 CCAGGCGGTGTGTTATAGGAGAC 0: 1
1: 0
2: 0
3: 2
4: 45
Right 969211898 4:5694368-5694390 TAAGTTCTTCTTAGGCCAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969211898 Original CRISPR TAAGTTCTTCTTAGGCCAGG AGG Exonic
901241344 1:7695569-7695591 TAGGTGCTTCTTAGGCCCTGGGG + Intronic
907323679 1:53621333-53621355 AAAGATCCTCTTAGACCAGGAGG - Intronic
908471543 1:64448890-64448912 TACGTTCTGCTTTGGCCAGCGGG + Intergenic
909089971 1:71213231-71213253 TACATTCTTCTTAGGACAGCCGG + Intergenic
910757530 1:90708256-90708278 TTAGTTCTTGTTAAGCCACGTGG - Intergenic
910977431 1:92921533-92921555 TAAGTGCTTTTGAGGACAGGAGG + Intronic
915534087 1:156524101-156524123 TAAGTGCTTCTTAGACAAGGTGG - Intergenic
916295196 1:163211449-163211471 TAAGTCCTTCTTAGTTGAGGAGG + Intronic
919122842 1:193362481-193362503 TGAGTTGTTCTTAGTCCAGTTGG - Intergenic
921701449 1:218273020-218273042 TAAGTTCTTTTTAGGCACTGAGG - Intergenic
923207722 1:231775003-231775025 TAGGCTCTTCTTAGGCCAGATGG + Intronic
1070145611 10:73771584-73771606 TCAGTCCTTCTTGGGCCTGGAGG + Exonic
1074459923 10:113627382-113627404 TAAGCTCCTCCAAGGCCAGGAGG - Intronic
1075082287 10:119391969-119391991 AAAGTTAGTCTAAGGCCAGGAGG + Intronic
1078340567 11:10495551-10495573 CAAGCTCTTCTTGTGCCAGGAGG + Exonic
1080035640 11:27707385-27707407 TAATGTCTTCTTAGGCCAATTGG - Intronic
1081361920 11:42190501-42190523 TCAGTTTTCCTTAGGGCAGGTGG - Intergenic
1085315831 11:75544415-75544437 GAAGCTCTCCTGAGGCCAGGGGG + Intergenic
1086561757 11:88176572-88176594 TAAATTTTTCTTAGGCCAGTAGG - Intergenic
1087088220 11:94241603-94241625 AAAGTTTCTCTTAGGACAGGAGG + Intergenic
1090643944 11:128752198-128752220 GAAGATCATCTGAGGCCAGGAGG - Intronic
1092846284 12:12588223-12588245 TAACATGTTCTTAGGTCAGGGGG + Intergenic
1093280683 12:17192836-17192858 TAAGAGCTAATTAGGCCAGGAGG + Intergenic
1094147822 12:27248993-27249015 CAAGTTCTTCTAAGTACAGGTGG + Intronic
1094682983 12:32682422-32682444 AAAGTGATTCTTAGGCCAGGCGG - Intronic
1094827006 12:34277110-34277132 TATGTTCTTCTCAGGGTAGGAGG + Intergenic
1107658809 13:42618153-42618175 AACGCTCTTCTCAGGCCAGGAGG - Intergenic
1108667858 13:52650808-52650830 TAAGTTCTTCTTAGACCATAGGG - Intergenic
1118361860 14:65063652-65063674 GAAGATCTTCTGAGCCCAGGAGG - Intronic
1119463729 14:74835251-74835273 TATGTTCTTTTTAGGTCAGATGG + Exonic
1120758132 14:88263167-88263189 TGAGTCCATCTTAGGCCAGCTGG - Intronic
1124008589 15:25814967-25814989 TACATTCTTCATAAGCCAGGTGG - Intronic
1125605338 15:40936986-40937008 TAGGCTCCTCTTAGGCCAGGCGG + Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1128480750 15:68036009-68036031 TTGGTTCTTCTTAGGGGAGGAGG - Intergenic
1130937856 15:88485325-88485347 TAAGCTCTTCTCAGCCCAGCAGG - Intergenic
1134289904 16:12895996-12896018 AAAGCAGTTCTTAGGCCAGGCGG - Intergenic
1135032517 16:19049802-19049824 TAAGTTCTTCTGAATTCAGGAGG - Intronic
1135228613 16:20683611-20683633 TTAATTCTTCTTAGCCCAGAGGG + Intronic
1135946723 16:26871587-26871609 CATGGTCTTCTTAGGCAAGGCGG + Intergenic
1136593867 16:31233479-31233501 TAAAGTATTTTTAGGCCAGGCGG - Intergenic
1139229896 16:65273538-65273560 TAGGCCCTGCTTAGGCCAGGTGG + Intergenic
1141829707 16:86503206-86503228 TAAGTCCTTCTGAGACCGGGAGG - Intergenic
1143152244 17:4814870-4814892 TCAGTTCTCCTTAGGGCAGAGGG - Intronic
1145860929 17:28209298-28209320 TAAGTCCATCTTTGGCCAGAGGG + Intergenic
1150923168 17:69504808-69504830 TAACTTCTTCTTGGGCCAAATGG - Intronic
1150944115 17:69725593-69725615 TAAGTTTTTCTTAAATCAGGAGG - Intergenic
1153433453 18:5043476-5043498 TAGGGTCATCTTATGCCAGGAGG + Intergenic
1155698823 18:28717472-28717494 TATGTACTTCTTAGGCCACTAGG + Intergenic
1156427793 18:37034267-37034289 TAAGTACTTTTTGGCCCAGGAGG - Intronic
1163139121 19:15334103-15334125 TAAGCTCTTCCGTGGCCAGGTGG - Intergenic
1163771813 19:19195670-19195692 TAAGTCCTTCTTAGACAAGGTGG - Intronic
1165438681 19:35811634-35811656 TAAGTTCTGATTAGGCCAATGGG - Intronic
925217336 2:2108459-2108481 CAAGTTCTTCTTAAAGCAGGAGG + Intronic
925717176 2:6795148-6795170 TGAGCTCTTCTCAGGCCATGAGG - Intergenic
926901002 2:17752465-17752487 TCAGTTCTTCTTATGCAAGTTGG - Intronic
928460435 2:31467413-31467435 AAAGCCCTTCTTAGGCCAAGGGG + Intergenic
937619277 2:123967127-123967149 TAATTTTTTTTTTGGCCAGGGGG + Intergenic
938962164 2:136353645-136353667 TAAGCTATAATTAGGCCAGGTGG + Intergenic
941211146 2:162641415-162641437 TATGTGATTCCTAGGCCAGGTGG + Intronic
946297051 2:218793366-218793388 TAAGTATCTTTTAGGCCAGGTGG - Intronic
947910307 2:233796225-233796247 GAAGTTCTTCTTCAGCCAGATGG + Exonic
1172973402 20:38889490-38889512 TACATTCTTCATAGGCCTGGGGG + Intronic
1173715568 20:45200874-45200896 TAATTTCTTCTTTGACCAGTTGG + Intergenic
1177402047 21:20617650-20617672 TAAGTTCTTGTTAGGCAAAGAGG - Intergenic
1179302160 21:40122168-40122190 TATGTAATTCTTAGGCCAGGAGG + Intronic
1185346199 22:50311884-50311906 TAAGGTCTGCAGAGGCCAGGTGG + Exonic
949597470 3:5563157-5563179 TAAGTAGTGATTAGGCCAGGAGG + Intergenic
952498718 3:33938971-33938993 TAAGAGCTGATTAGGCCAGGAGG - Intergenic
954839317 3:53496341-53496363 TAATTCCCTCTTAGGCCTGGAGG + Intronic
955170188 3:56556619-56556641 TAAGATATTCTTAGGACAAGTGG + Intergenic
958441879 3:94165128-94165150 TTAGTTCTTCCTGGGGCAGGCGG + Intergenic
960985494 3:123277477-123277499 TAACTTCTTCATGGCCCAGGTGG - Intergenic
961070397 3:123918976-123918998 TAAAGTTTTCCTAGGCCAGGAGG + Intronic
966910867 3:184559295-184559317 CAAGTCCTTCTTTTGCCAGGTGG + Intronic
969211898 4:5694368-5694390 TAAGTTCTTCTTAGGCCAGGAGG + Exonic
969607188 4:8208246-8208268 CACGTTCTTCTTAGCCCATGGGG + Intronic
970145359 4:13030350-13030372 TAACTTTTTCTTGGGCCTGGGGG + Intergenic
970991789 4:22221249-22221271 GGGGTTCTTCTGAGGCCAGGAGG - Intergenic
971110783 4:23583213-23583235 TCAGTTCTTGTTAGACCAGCAGG - Intergenic
974384978 4:61192480-61192502 TCAGTTCTTCTTAGGGAAGTTGG - Intergenic
975425161 4:74216804-74216826 TAGGATCTTATTAGTCCAGGTGG - Intronic
980792659 4:137639013-137639035 TTATTTCTTCCTAGGCCAGGAGG - Intergenic
981401621 4:144320631-144320653 TTGGTTCTTCCTAGGTCAGGGGG + Intergenic
988759711 5:34300425-34300447 TATGCTCTTTTGAGGCCAGGAGG + Intergenic
989230893 5:39085755-39085777 TTGGTTCTTCTTTGGGCAGGAGG - Intergenic
989518815 5:42376765-42376787 TAGTGTCTTCATAGGCCAGGTGG + Intergenic
993919707 5:93785990-93786012 TAATTTCTTCATAAGCCAGTTGG - Intronic
995956309 5:117780628-117780650 TAAATTGTTCTTGTGCCAGGCGG - Intergenic
997785176 5:136704107-136704129 TTAGTTCTTCTTAGTGGAGGAGG - Intergenic
998228642 5:140345626-140345648 TACGTTCTTCTTAGGTAAGCTGG - Intronic
1001681604 5:173561907-173561929 TGAGTTCTTCTGAAGCCAGTGGG + Intergenic
1002725298 5:181290597-181290619 TAAGTCCTTCTGAGTCAAGGTGG + Intergenic
1010387630 6:75300455-75300477 CAAGTTGTTCTGAGGCCAGTAGG - Intronic
1012587260 6:100939110-100939132 TTTGTTCTTCTGAGGCCAGATGG + Intergenic
1013277782 6:108602420-108602442 AAAGATCTTCTTAGGCCAAGTGG - Intronic
1017532462 6:155309602-155309624 TTCTTTCTTATTAGGCCAGGGGG - Intronic
1018300053 6:162392241-162392263 TAAGGTCTGCTCAGGCCAGAGGG + Intronic
1026530750 7:71195303-71195325 AAAGATCTCCTGAGGCCAGGAGG - Intronic
1031905896 7:127459130-127459152 TGAGTTCTTCTTGGCCCTGGGGG - Intergenic
1032667669 7:134053086-134053108 TACCGTCTTCTTAGGCCAAGGGG + Intronic
1034257917 7:149734511-149734533 TAAGTCCAGCTTAGACCAGGGGG - Exonic
1035454542 7:158999416-158999438 CAGGATCTTCTGAGGCCAGGCGG + Intergenic
1037047673 8:14328794-14328816 TAAGACATTATTAGGCCAGGAGG + Intronic
1039266539 8:35830735-35830757 TAGGTTCATCTGAGACCAGGAGG + Intergenic
1040516918 8:48143214-48143236 AAAGCCCTTCTTAGGCCCGGCGG + Intergenic
1040845733 8:51837046-51837068 CAGGTTTTTCTTGGGCCAGGGGG + Intronic
1042214959 8:66421820-66421842 TAAGTCCTATTTAGGCCTGGGGG + Intergenic
1042538789 8:69886537-69886559 TACATTCTTCTTTGGCCAGTAGG - Intergenic
1042627442 8:70773792-70773814 TAACTTGTTCTTAAGCCAGTTGG + Intronic
1043154462 8:76760633-76760655 AAAGTTAGTCTGAGGCCAGGTGG + Intronic
1043201645 8:77376724-77376746 TATGTGTTTCTTAGGCCATGAGG - Intergenic
1045703246 8:104891361-104891383 TATGTTCTTCTTGGGTCAGGAGG + Intronic
1050978537 9:11975963-11975985 TAAGTTATTCTTTAGCCAGCAGG + Intergenic
1051517129 9:17942575-17942597 CAAATTCTTCCTAGGCCATGTGG - Intergenic
1052360506 9:27551448-27551470 TAGGTTCTACTCAGGCCAGAGGG + Intronic
1053564515 9:39234390-39234412 TTTGTTCTTATTAGGCCACGTGG + Intronic
1053830296 9:42072291-42072313 TTTGTTCTTATTAGGCCAGGTGG + Intronic
1054132637 9:61384646-61384668 TTTGTTCTTATTAGGCCATGTGG - Intergenic
1054600263 9:67115164-67115186 TTTGTTCTTATTAGGCCAGGTGG - Intergenic
1056840772 9:89996571-89996593 TAAGACCTCCATAGGCCAGGTGG - Intergenic
1056949465 9:91030510-91030532 AAAGCTCATGTTAGGCCAGGCGG + Intergenic
1058263715 9:102872025-102872047 TACGTTTTTCTTAGTCCAGGTGG + Intergenic
1187169446 X:16836862-16836884 TGAGTTCATCTTAGACCAGGAGG - Intronic
1188614114 X:32136322-32136344 TCAGTTTTTCTTTGCCCAGGGGG - Intronic
1202097388 Y:21266021-21266043 TAAGTTTTTCTGATGCCAAGAGG - Intergenic