ID: 969212473

View in Genome Browser
Species Human (GRCh38)
Location 4:5698326-5698348
Sequence TAGTGTCTTATCTACCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 3, 3: 1, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969212473_969212476 -1 Left 969212473 4:5698326-5698348 CCAGGGTGGTAGATAAGACACTA 0: 1
1: 0
2: 3
3: 1
4: 95
Right 969212476 4:5698348-5698370 AGATGAGGAGTGGAGAGAACTGG 0: 1
1: 0
2: 3
3: 73
4: 751
969212473_969212477 10 Left 969212473 4:5698326-5698348 CCAGGGTGGTAGATAAGACACTA 0: 1
1: 0
2: 3
3: 1
4: 95
Right 969212477 4:5698359-5698381 GGAGAGAACTGGACTCTAGCTGG 0: 1
1: 0
2: 1
3: 10
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969212473 Original CRISPR TAGTGTCTTATCTACCACCC TGG (reversed) Intronic
905978154 1:42196029-42196051 CAGTTTCTCATCTACCTCCCTGG + Intronic
912660455 1:111524421-111524443 TTGTGCCTTTTCTACCACACTGG + Intronic
921803644 1:219430261-219430283 TAGGATCTTGTCTATCACCCAGG - Intergenic
922344756 1:224687255-224687277 TAGGGTCTTCTCTGCCACCTAGG + Intronic
1064317329 10:14270416-14270438 TATTATCCTATCTACCACCATGG + Intronic
1066373784 10:34839324-34839346 CAGGGTCTTCTCTGCCACCCAGG + Intergenic
1067976187 10:51027824-51027846 TAGTTTCTTATATGCAACCCAGG + Intronic
1071901877 10:90129125-90129147 TAGTGTCCTATCTACCTTCTTGG + Intergenic
1071983805 10:91030938-91030960 TAGGGTGGTATCTACCTCCCAGG - Intergenic
1080102577 11:28476373-28476395 TATTGCCTTATCTACCATCTGGG - Intergenic
1080608542 11:33884839-33884861 TAGTCTCTTATCTGCCACCCTGG + Intronic
1083559337 11:63659909-63659931 CAGGGTCTTATCTGTCACCCAGG - Intronic
1088163265 11:106900207-106900229 CAGGGTCTTCTCTATCACCCAGG + Intronic
1102074273 12:110047656-110047678 TAGTGTCTCCTCTGTCACCCAGG - Intronic
1102664507 12:114559123-114559145 CAGAGTCTTCTCTATCACCCAGG + Intergenic
1102695858 12:114798896-114798918 TACTGTCCTCTCTACCTCCCTGG - Intergenic
1105384160 13:19914669-19914691 TAGTGTCTTATCCACCACCATGG + Intergenic
1107584064 13:41824790-41824812 TAGGGTCTCATCTTTCACCCAGG - Intronic
1107918954 13:45183429-45183451 TACTGTCATATCTACCTCTCAGG + Intronic
1109579382 13:64306355-64306377 CAGTGTCTTAACTAGCATCCTGG + Intergenic
1110727534 13:78842680-78842702 TAGTGGCTTTTCTACCACCCAGG + Intergenic
1111733911 13:92113268-92113290 TTGTGTGTTATCTACCATCAAGG + Intronic
1111930328 13:94506137-94506159 TAGTTTGTTATCTGCCACCATGG + Intergenic
1118628024 14:67676069-67676091 TAGGGTCTTCTCTGTCACCCAGG - Intronic
1119883974 14:78124761-78124783 TGGTCTCTCACCTACCACCCAGG + Intergenic
1119998514 14:79278675-79278697 CAGTGTCCTATCCACCACCGGGG + Intronic
1121635647 14:95452257-95452279 TAGTGTCATCGCTACCATCCAGG - Exonic
1122723660 14:103736324-103736346 TAGTGTCTCATCTCCCTCGCTGG - Intronic
1128461731 15:67873942-67873964 CAGTGTCTTCTCCACCACCCAGG + Intergenic
1135465450 16:22681056-22681078 TACTTTCCTTTCTACCACCCAGG + Intergenic
1136244787 16:28968445-28968467 TAGGGTCTTCTCTGTCACCCAGG + Intergenic
1137425523 16:48377038-48377060 TAGTGTCACATCGACCACCTTGG - Intronic
1138858393 16:60723832-60723854 TACTGTTCTATCAACCACCCAGG - Intergenic
1139460558 16:67118797-67118819 TAGGGTCTTGTCTGTCACCCAGG + Intronic
1142185048 16:88690889-88690911 TAGGGGCGTATCTCCCACCCAGG - Intergenic
1143131054 17:4677182-4677204 TAGTGTCTTAACTTCCAGCTTGG - Intronic
1146891705 17:36510627-36510649 GTCTGTCTTATCTCCCACCCTGG + Intronic
1149970542 17:61213891-61213913 TAGTCTCTTCTCTGCTACCCTGG - Intronic
1150525836 17:65921228-65921250 TATTTCCTTATCTACCAGCCTGG + Intronic
1158826114 18:61221943-61221965 TATTTTCCTATCTACCTCCCTGG - Intergenic
1163283219 19:16330138-16330160 TAGGGTCTCATCTGTCACCCAGG + Intergenic
925320729 2:2965307-2965329 AAGTTTCTTACCTCCCACCCCGG - Intergenic
928319505 2:30271884-30271906 TAGTATTTTATCAACCACCTGGG - Intronic
937407474 2:121643916-121643938 TATTTTATTATCTTCCACCCAGG - Intronic
937804906 2:126127939-126127961 TACTGTCTTTTCTACCTCACAGG + Intergenic
940362528 2:152811971-152811993 TGGTGTCTTATATACCACATAGG + Intergenic
943228534 2:185213020-185213042 TTCTGTTTTATCTACCAACCTGG - Intergenic
943701757 2:190994888-190994910 TAGAGTCTCACCTATCACCCAGG - Intronic
945999816 2:216472327-216472349 TAGAGTCTTGTCTCTCACCCAGG - Intronic
1169013724 20:2273982-2274004 TAGTGTCTTATCTGTCAAACAGG + Intergenic
1177490900 21:21824799-21824821 CAGTGTCTTATTTAACAGCCAGG - Intergenic
1180255507 21:46624622-46624644 CAGTGTCTTACCTTCCTCCCAGG - Intergenic
1181849944 22:25742880-25742902 AGGTGTCTTATCTGGCACCCCGG + Intronic
1181882677 22:25993352-25993374 AAGTGTCTTCTCTGCTACCCAGG - Intronic
949576908 3:5347113-5347135 TAGTGCCTTATCTCCAGCCCAGG - Intergenic
958258852 3:91355586-91355608 GAGTGCCTTATCTACCATCATGG - Intergenic
958729357 3:97944919-97944941 TTGTGCCTTTTCTACCACACTGG + Exonic
962198905 3:133385447-133385469 TAGTGTCTGACCCACCAGCCTGG - Intronic
962214865 3:133512537-133512559 GAATGTCTTATCTACCATCATGG + Intergenic
968733288 4:2281825-2281847 TAGTGTCTGATCTACCCCTGAGG - Intronic
969212473 4:5698326-5698348 TAGTGTCTTATCTACCACCCTGG - Intronic
971328166 4:25661343-25661365 GCGTGTTTTACCTACCACCCAGG - Intronic
973599747 4:52530166-52530188 TATTGTATTATCCACCACCAGGG - Intergenic
982017236 4:151166993-151167015 AAGTTTCTTATCTACCACTTAGG + Intronic
983195646 4:164803391-164803413 TAGGGTCTTCTCTTTCACCCAGG - Intergenic
987168658 5:15228982-15229004 CAGAGTCTTATCTGTCACCCAGG + Intergenic
988498928 5:31767978-31768000 CAGTGTCTTTTTTACCAGCCAGG + Intronic
995730687 5:115238327-115238349 CAGGGTCTTATCTGTCACCCAGG + Intronic
995747954 5:115423682-115423704 TAGAGTCTTATATAATACCCGGG - Intergenic
995947432 5:117665577-117665599 TAGTCTTTTATCTAGCAGCCAGG - Intergenic
996235519 5:121125450-121125472 TAGTGTTTTTACTGCCACCCAGG - Intergenic
1003161961 6:3643843-3643865 TGGTGTATTACCTACCACCAGGG - Intergenic
1004406378 6:15337506-15337528 TAGGGTCTCAGCTACCACCATGG - Intronic
1011732646 6:90281441-90281463 CAGTGTTTTATCTCCCAACCTGG - Intronic
1012526422 6:100183320-100183342 GAGTGCCTTATCTGACACCCAGG - Intergenic
1012765188 6:103358122-103358144 TCATGTCATATCCACCACCCAGG + Intergenic
1019838402 7:3413945-3413967 TAGGGTCTCATCCATCACCCAGG - Intronic
1023150635 7:37198467-37198489 TATAGTCGTATCTCCCACCCAGG - Intronic
1026541093 7:71280689-71280711 TGCTGTCTTATCTATCACACTGG - Intronic
1027499822 7:78935405-78935427 TAGTGTCTTTTCCTCCACTCTGG - Intronic
1030667257 7:112293160-112293182 TAATGTATTAATTACCACCCCGG - Intronic
1030711833 7:112758636-112758658 TTGTGCCTTTTCTACCACACTGG + Intergenic
1031538467 7:122963546-122963568 TAGTGTCCTGTCTACATCCCAGG - Intergenic
1036916600 8:12810291-12810313 TATTGTCTTATATAACCCCCTGG + Intergenic
1038542393 8:28400908-28400930 TAATGTCTTAATAACCACCCAGG - Intronic
1042547463 8:69963919-69963941 TAATGTCTTATCTATCAGGCTGG + Intergenic
1044539448 8:93393100-93393122 TAGCCTCTTCTCTACCACCACGG - Intergenic
1045309676 8:100990094-100990116 TGCTGTCTTATCTGCCACCATGG - Intergenic
1046466150 8:114605737-114605759 TAGGGTCTCATCTGTCACCCAGG - Intergenic
1047647681 8:126886074-126886096 TAGTTTTCTTTCTACCACCCTGG + Intergenic
1047958788 8:129995906-129995928 CTGTGTCTTGTCTTCCACCCAGG - Intronic
1049550648 8:143257016-143257038 AAGTGTCTTATCTTTCACCTGGG - Intronic
1049678321 8:143903334-143903356 CAGAGTCTTATCCCCCACCCTGG - Intergenic
1056671066 9:88627291-88627313 TAGTGTGTTATATGCCATCCAGG + Intergenic
1185472222 X:390831-390853 TAGTGTTCGATCAACCACCCAGG - Intergenic
1188609939 X:32083040-32083062 TATTGTCCTAGCTAACACCCTGG + Intronic
1195054217 X:101127759-101127781 TAGGGTCTTACCTGTCACCCAGG + Intronic
1195438032 X:104867695-104867717 TAGTTGATTATCTACCTCCCTGG - Intronic
1196929473 X:120666955-120666977 TAGTTTCTTATTTGCCTCCCTGG + Intergenic
1200472008 Y:3596144-3596166 TAGTGTATTATCTACAAGCTAGG - Intergenic