ID: 969213200

View in Genome Browser
Species Human (GRCh38)
Location 4:5703866-5703888
Sequence CAACATAACCCCATTTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 1, 1: 0, 2: 7, 3: 58, 4: 482}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969213200_969213210 23 Left 969213200 4:5703866-5703888 CCATTTTAAATGGGGTTATGTTG 0: 1
1: 0
2: 7
3: 58
4: 482
Right 969213210 4:5703912-5703934 GTGGCTGTCAGGGTATCAGGGGG 0: 1
1: 0
2: 1
3: 28
4: 263
969213200_969213207 20 Left 969213200 4:5703866-5703888 CCATTTTAAATGGGGTTATGTTG 0: 1
1: 0
2: 7
3: 58
4: 482
Right 969213207 4:5703909-5703931 AGAGTGGCTGTCAGGGTATCAGG No data
969213200_969213203 -7 Left 969213200 4:5703866-5703888 CCATTTTAAATGGGGTTATGTTG 0: 1
1: 0
2: 7
3: 58
4: 482
Right 969213203 4:5703882-5703904 TATGTTGAAAGGCTTTAACAGGG 0: 1
1: 0
2: 0
3: 14
4: 226
969213200_969213211 26 Left 969213200 4:5703866-5703888 CCATTTTAAATGGGGTTATGTTG 0: 1
1: 0
2: 7
3: 58
4: 482
Right 969213211 4:5703915-5703937 GCTGTCAGGGTATCAGGGGGAGG 0: 1
1: 0
2: 2
3: 20
4: 270
969213200_969213206 13 Left 969213200 4:5703866-5703888 CCATTTTAAATGGGGTTATGTTG 0: 1
1: 0
2: 7
3: 58
4: 482
Right 969213206 4:5703902-5703924 GGGTGACAGAGTGGCTGTCAGGG No data
969213200_969213208 21 Left 969213200 4:5703866-5703888 CCATTTTAAATGGGGTTATGTTG 0: 1
1: 0
2: 7
3: 58
4: 482
Right 969213208 4:5703910-5703932 GAGTGGCTGTCAGGGTATCAGGG 0: 1
1: 0
2: 1
3: 20
4: 194
969213200_969213202 -8 Left 969213200 4:5703866-5703888 CCATTTTAAATGGGGTTATGTTG 0: 1
1: 0
2: 7
3: 58
4: 482
Right 969213202 4:5703881-5703903 TTATGTTGAAAGGCTTTAACAGG 0: 1
1: 0
2: 1
3: 7
4: 147
969213200_969213205 12 Left 969213200 4:5703866-5703888 CCATTTTAAATGGGGTTATGTTG 0: 1
1: 0
2: 7
3: 58
4: 482
Right 969213205 4:5703901-5703923 AGGGTGACAGAGTGGCTGTCAGG 0: 1
1: 0
2: 1
3: 20
4: 264
969213200_969213204 4 Left 969213200 4:5703866-5703888 CCATTTTAAATGGGGTTATGTTG 0: 1
1: 0
2: 7
3: 58
4: 482
Right 969213204 4:5703893-5703915 GCTTTAACAGGGTGACAGAGTGG 0: 1
1: 0
2: 0
3: 9
4: 154
969213200_969213209 22 Left 969213200 4:5703866-5703888 CCATTTTAAATGGGGTTATGTTG 0: 1
1: 0
2: 7
3: 58
4: 482
Right 969213209 4:5703911-5703933 AGTGGCTGTCAGGGTATCAGGGG 0: 1
1: 0
2: 2
3: 29
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969213200 Original CRISPR CAACATAACCCCATTTAAAA TGG (reversed) Intronic
902548828 1:17207431-17207453 CAATATAACACCAGTTATAATGG + Intronic
902815246 1:18912964-18912986 CAACATACCCCTATTTCCAAGGG + Intronic
902822369 1:18951140-18951162 CAGCAGAACCCTTTTTAAAATGG + Intronic
902992016 1:20194647-20194669 CATTAGAAACCCATTTAAAACGG - Exonic
904149005 1:28420964-28420986 CATCATAAACCCATTAAAAAGGG - Intronic
906494282 1:46292758-46292780 CACCATAACCAAATTTTAAAAGG - Intronic
907868531 1:58422123-58422145 CAACATCACCAGATTTCAAACGG - Intronic
907970930 1:59380626-59380648 AAACACAACCCCATCAAAAAGGG - Intronic
908771725 1:67603397-67603419 CCACTTTACCCCATTTAGAATGG + Intergenic
910331659 1:86079735-86079757 CAATCTTACCCCAGTTAAAACGG + Intronic
910446200 1:87301038-87301060 TAACAAAATACCATTTAAAAAGG + Intergenic
911659006 1:100478673-100478695 AAAGATAACCTCATTCAAAATGG - Intronic
912599428 1:110913460-110913482 GAAAACAACCCCATTAAAAATGG + Intergenic
913333750 1:117688837-117688859 CCAAATAATCCCATTAAAAATGG + Intergenic
913445675 1:118948219-118948241 CAAAATAACCCATTTTATAATGG + Intronic
913555032 1:119957392-119957414 TTACATTCCCCCATTTAAAAAGG + Intronic
914430578 1:147617404-147617426 CAACAAAACCAAACTTAAAATGG + Intronic
917235541 1:172888297-172888319 TAAAATAATCCCATTTCAAAAGG + Intergenic
918300686 1:183201002-183201024 CTACATAAACCCATCTGAAACGG - Intronic
918651543 1:186970099-186970121 CAACCTTACCCCAGTTAAAATGG - Intronic
919009278 1:191938820-191938842 ACAAATAACCCCATTAAAAATGG - Intergenic
919248575 1:195021940-195021962 AAACATAACCCAACCTAAAAAGG + Intergenic
921105573 1:211973840-211973862 TAAAATAACTCCATTTCAAAAGG + Intronic
921590037 1:216992104-216992126 CTACATAACCTCAATTAAGATGG + Intronic
921718592 1:218445557-218445579 GAATATAACTCCATTTTAAAGGG + Intergenic
922037294 1:221861376-221861398 AAACATAACCCAAATGAAAAGGG - Intergenic
922072725 1:222211951-222211973 CCAAATAATCCCATTAAAAATGG - Intergenic
922310718 1:224387481-224387503 GAACATAACTCCTATTAAAACGG - Exonic
922318265 1:224461660-224461682 CAAAATTCACCCATTTAAAATGG + Intronic
922382620 1:225047829-225047851 CTACATAACCTCATTGAAGAGGG - Intronic
922940394 1:229459436-229459458 ACAAATAACCCAATTTAAAAGGG - Intronic
923513033 1:234669946-234669968 CAACTTAACCCCATTTTAAATGG - Intergenic
1062998947 10:1895956-1895978 CCACAGGACCCCATTTCAAACGG + Intergenic
1063182076 10:3612326-3612348 ACAAATAACCCCATTAAAAATGG + Intergenic
1063209936 10:3870834-3870856 CAAAATAAGCCCTTTTCAAATGG - Intergenic
1063545571 10:6977853-6977875 TAGCATAATCCCATTTAATATGG + Intergenic
1064126087 10:12661918-12661940 CCACATAATACTATTTAAAAGGG - Intronic
1064838975 10:19568326-19568348 CAACAAAACCACTTTTAAAGAGG - Intronic
1065266718 10:23983991-23984013 CAAAACAATCCCATTTGAAAAGG + Intronic
1065640103 10:27773088-27773110 ACAAATAACCCCATTAAAAAGGG - Intergenic
1066156400 10:32682824-32682846 CCAAAGAACCCCATTAAAAATGG - Intronic
1066978264 10:42388940-42388962 CAACTAGACCCCATTTAGAAAGG - Intergenic
1067151596 10:43739536-43739558 GAAGACAACCCAATTTAAAATGG - Intergenic
1067154522 10:43766477-43766499 AAACATAAGCCCATTAAAAACGG + Intergenic
1068038953 10:51798827-51798849 CAAAATTACCCCATTTTAAGGGG - Intronic
1068114198 10:52719012-52719034 AAAAATTACCCCATTAAAAAGGG + Intergenic
1068433876 10:56966310-56966332 ACAAATAACCCCATTAAAAATGG + Intergenic
1068782105 10:60930913-60930935 CAACCCAACCCCCTTAAAAAAGG - Intronic
1068989334 10:63134249-63134271 CAACAGAACCCCACTAACAACGG + Intronic
1069343957 10:67445526-67445548 CAACATTAATCCATTTAAGAAGG + Intronic
1070083664 10:73213164-73213186 ATAAATAACCCTATTTAAAAGGG - Intronic
1070894368 10:79969589-79969611 CAACTTCACTCCTTTTAAAATGG - Intronic
1071377893 10:85029072-85029094 AAAAACAACCCCATTAAAAATGG + Intergenic
1071594223 10:86907291-86907313 CAACCTCACCCCAATTAAAATGG + Intronic
1071892997 10:90032568-90032590 ACAAATAACCCCATTAAAAATGG + Intergenic
1071935057 10:90520514-90520536 CAAGAACACCCCAGTTAAAATGG - Intergenic
1072056575 10:91764126-91764148 ATAGATAACCCCATTAAAAATGG + Intergenic
1073669469 10:105571421-105571443 AAAAACAACCCCATTAAAAAGGG + Intergenic
1073992175 10:109274439-109274461 CCAAATAACACCATTAAAAAGGG - Intergenic
1074056880 10:109930401-109930423 CCTAATAACCCAATTTAAAATGG - Intergenic
1074637593 10:115338424-115338446 TAATATCACCCCAGTTAAAATGG - Intronic
1074804612 10:117036089-117036111 CATCTTAACCACAGTTAAAATGG + Intronic
1075828306 10:125379817-125379839 AAAAACAACCCCATTAAAAATGG - Intergenic
1077682747 11:4259573-4259595 CCACCTCACCCCAGTTAAAATGG - Intergenic
1077687292 11:4307180-4307202 CCACCTCACCCCAGTTAAAATGG + Intergenic
1077692454 11:4358357-4358379 CCACCTCACCCCAGTTAAAATGG + Intergenic
1077792618 11:5457799-5457821 ACACATAACTCCATTAAAAATGG - Intronic
1079573541 11:21974962-21974984 CCCTATAACCTCATTTAAAAAGG - Intergenic
1079651027 11:22930064-22930086 TAATCTCACCCCATTTAAAATGG - Intergenic
1079925574 11:26488189-26488211 AAACAAAATCCCATTTTAAAAGG + Intronic
1080215944 11:29840687-29840709 ACAAATAACCCCATTAAAAATGG - Intergenic
1080997986 11:37628029-37628051 CCACCTAACTCCAGTTAAAATGG - Intergenic
1081248554 11:40800309-40800331 CAACATTCCCCCAGTTAGAAGGG - Intronic
1082753035 11:57042781-57042803 CAACATTATTCCATTTACAATGG + Intergenic
1083024500 11:59538652-59538674 AAAAATAACCCCATTGAAAATGG + Intergenic
1083555289 11:63621303-63621325 CAACATGACAACATTCAAAATGG + Intergenic
1086185241 11:84005648-84005670 AAAAATAATCCCATTAAAAATGG + Intronic
1086236805 11:84641272-84641294 CAACATAACCCTTTTAAAAGAGG - Intronic
1086599037 11:88609567-88609589 AAAAACAACCCCATTTAAAATGG - Intronic
1087185003 11:95180855-95180877 CAACAGAAACACTTTTAAAATGG + Intronic
1087968346 11:104447955-104447977 CAAACAAACCCCATTCAAAAGGG + Intergenic
1088197430 11:107290918-107290940 CCAAATAATCCCATTAAAAATGG - Intergenic
1088424670 11:109690110-109690132 GAAAATAACCCAATTAAAAATGG + Intergenic
1088543352 11:110936145-110936167 CAACATAACCCCAGGTTTAATGG - Intergenic
1088961036 11:114665024-114665046 GAACATAACCCCATGTAAGCTGG + Intergenic
1089892023 11:121891057-121891079 CAGTATAACTCCATTAAAAAGGG - Intergenic
1090104086 11:123833154-123833176 CCAAATAACCCAATTAAAAATGG + Intergenic
1090344052 11:126053190-126053212 TAAAATGACCCCATTTAAAAAGG + Intronic
1090646874 11:128773443-128773465 CACCCTAACCCCATTTGACAGGG + Intronic
1091126119 11:133099747-133099769 ACAAATAACCCCATTAAAAATGG - Intronic
1093902890 12:24656153-24656175 CAAAAGAATCCCATTTATAATGG - Intergenic
1094695754 12:32816919-32816941 CTAAATAACCCCATTTAAAAAGG - Intronic
1095181181 12:39147946-39147968 CTACTTCACCCCAGTTAAAATGG - Intergenic
1095662349 12:44752342-44752364 TATCATAACACCATTTAAAAAGG + Intronic
1096756868 12:53806881-53806903 CAACAGAAACCCATTTGTAATGG + Intergenic
1099003638 12:77211258-77211280 CCATATCACCCCAATTAAAATGG - Intergenic
1099252915 12:80280130-80280152 CAAAACAACCCCATTAGAAATGG - Intronic
1099729151 12:86476250-86476272 ACAAATAACCCCATTAAAAATGG + Intronic
1099768822 12:87026009-87026031 AAAAATAACCCCATTAAAAATGG + Intergenic
1099917252 12:88909882-88909904 AAAAATAATCCCATTAAAAATGG - Intergenic
1101036338 12:100710862-100710884 CAATTTAACCAAATTTAAAATGG - Intergenic
1101084212 12:101218729-101218751 CAACAAAAAACAATTTAAAATGG - Intergenic
1102319907 12:111923959-111923981 GAAAATAATCCAATTTAAAAAGG + Intergenic
1103135533 12:118503918-118503940 CAACAAAACCAGTTTTAAAAGGG - Intergenic
1105204670 13:18210785-18210807 AAACACAACCCCATTTAAAAAGG + Intergenic
1105363274 13:19740838-19740860 CCCCATAACCCCTTTTAACACGG + Intronic
1105861446 13:24418810-24418832 ACAAATAACCCCATTAAAAATGG - Intergenic
1106105675 13:26731219-26731241 ACAAATAATCCCATTTAAAAGGG - Intergenic
1107989525 13:45805883-45805905 CCAAATAACCCCATTAAAAATGG + Intronic
1108627069 13:52240806-52240828 ACAAATAACCCCATTAAAAATGG + Intergenic
1108658997 13:52565659-52565681 GCAAATAACCCCATTAAAAATGG - Intergenic
1108900500 13:55400011-55400033 GAAAACAACCCCATTAAAAATGG - Intergenic
1110170623 13:72496323-72496345 CAACATCTTCCCATTTAAATTGG - Intergenic
1110587061 13:77205142-77205164 CAAAATAAACCCAGTTAAAAAGG + Intronic
1110658343 13:78027541-78027563 CAAAATAACCCCATGGAAGATGG + Intergenic
1111089064 13:83417734-83417756 TAAGACAACCCAATTTAAAAAGG + Intergenic
1111816406 13:93159253-93159275 CAAGATAACCCACTTAAAAATGG - Intergenic
1112616189 13:101008104-101008126 CATCATAATGCCATTCAAAATGG + Intergenic
1113100876 13:106716122-106716144 ACAAATAACCCAATTTAAAATGG - Intergenic
1114279487 14:21178201-21178223 ACACATAACCCAATTTTAAATGG - Intergenic
1115061463 14:29195703-29195725 AAAAATAGCCCAATTTAAAAGGG - Intergenic
1115182429 14:30644684-30644706 AAAAACAACCCCATTAAAAATGG - Intronic
1115189231 14:30729075-30729097 CAAAATAACCCAATTAAAAATGG - Intronic
1115299040 14:31864152-31864174 TAAGACAACCCAATTTAAAATGG + Intergenic
1115325813 14:32136921-32136943 AAAGATAACCCAATTTAAAAAGG - Intronic
1115802419 14:37010110-37010132 AAACATAACCACATATATAATGG + Intronic
1115924870 14:38420989-38421011 CCATGTAACCCCAGTTAAAATGG + Intergenic
1115963200 14:38858673-38858695 GCAAATAACCCCATTAAAAATGG - Intergenic
1116403613 14:44541036-44541058 ACAAATAACCCCATTAAAAATGG + Intergenic
1117525626 14:56599813-56599835 CAACATAAGCCCATACAAAATGG + Intronic
1118931054 14:70241025-70241047 CAACATAATCCCAGAAAAAATGG + Intergenic
1119220096 14:72899703-72899725 CCCCATAACCCCACTTTAAAGGG + Intergenic
1119821966 14:77624441-77624463 CAACATAACTTCTTTTAAAATGG + Intergenic
1120886938 14:89459197-89459219 CATCATAAGGTCATTTAAAATGG - Intronic
1122309815 14:100787440-100787462 CAACAAAACCCCATTTCCAAGGG + Intergenic
1123154858 14:106214336-106214358 TCAGATAACCCCATTAAAAATGG + Intergenic
1123181388 14:106473764-106473786 CCAAATAACCCCATTAAAAATGG + Intergenic
1123189365 14:106553439-106553461 AATAATAACCCCATTAAAAATGG - Intergenic
1202945513 14_KI270726v1_random:22963-22985 CCAAATAACCGCATTAAAAATGG - Intergenic
1123458975 15:20451126-20451148 ACAAATAACCCTATTTAAAAAGG + Intergenic
1123659087 15:22549292-22549314 ACAAATAACCCTATTTAAAAAGG - Intergenic
1124312951 15:28643784-28643806 ACAAATAACCCTATTTAAAAAGG - Intergenic
1124797518 15:32796472-32796494 CAACATAACATCATTAACAAGGG - Intronic
1125019967 15:34974850-34974872 CAACATATCCCAATTAATAATGG - Intergenic
1125104124 15:35950684-35950706 CAACTCAAGCCCATTTAAAAGGG - Intergenic
1125121330 15:36162069-36162091 CATGACAACCCCATTTGAAAAGG - Intergenic
1125898877 15:43327109-43327131 CAACAGATTCCCATTTAAAAGGG + Exonic
1126359494 15:47831874-47831896 AAAAACAACCCCATTAAAAAGGG + Intergenic
1126521675 15:49602332-49602354 CAATCTCACCCCAGTTAAAATGG - Intronic
1126642080 15:50838310-50838332 GAAAACAACCCAATTTAAAAAGG - Intergenic
1126674767 15:51151076-51151098 AAAAATAACCCCATTAAAAATGG + Intergenic
1126853355 15:52812892-52812914 CAACATAAATCCATTTATGAGGG - Intergenic
1126928840 15:53624014-53624036 AAAAATAACTCCATTAAAAATGG - Intronic
1127145687 15:56020844-56020866 ACAAATAACCCCATTAAAAACGG - Intergenic
1127818675 15:62636005-62636027 CAACATAACCCCATGCTAAGAGG - Intronic
1128425488 15:67538395-67538417 CAAAATAACCCTATTAAAATGGG + Intergenic
1129548900 15:76427376-76427398 CTAAATAACCCAATTCAAAAAGG + Intronic
1129565971 15:76624275-76624297 GAATATAATCCCATTTACAATGG + Intronic
1129806604 15:78466228-78466250 CAAAATAAAGCCATTTAAAAGGG - Intronic
1130139058 15:81208204-81208226 CCAAATAACCCCATTAAAAATGG - Intronic
1130670652 15:85909526-85909548 AAACATCACCCAATTTTAAATGG - Intergenic
1130739560 15:86584018-86584040 AAAAATAACCCCATTAAAAATGG - Intronic
1131896008 15:97029985-97030007 CAACAAAACCACATCTGAAATGG + Intergenic
1132366354 15:101260278-101260300 CAACTTCACCCCAGTTAACATGG - Intergenic
1136703402 16:32164405-32164427 ACAAATAACCCTATTTAAAAAGG + Intergenic
1136764297 16:32763194-32763216 ACAAATAACCCTATTTAAAAAGG - Intergenic
1136803801 16:33107192-33107214 ACAAATAACCCTATTTAAAAAGG + Intergenic
1138797412 16:59985831-59985853 CCAAATAACCCAATTAAAAAGGG + Intergenic
1139784177 16:69377691-69377713 CAACACAATGCCATTTACAATGG - Intronic
1139814079 16:69652712-69652734 CTACATACCCCCATACAAAATGG - Intronic
1140467057 16:75191004-75191026 CACCATAAACCCATTAAAATGGG + Intergenic
1141931397 16:87206662-87206684 AAAAATAACCCAATTCAAAATGG + Intronic
1203066654 16_KI270728v1_random:1025318-1025340 ACAAATAACCCTATTTAAAAAGG - Intergenic
1143436580 17:6932612-6932634 AAACACAACCCAATTTAAAAAGG + Intronic
1144075313 17:11714295-11714317 CAACAAAATCCAATTTAAGAGGG - Intronic
1145258377 17:21340136-21340158 CACCATAACCCCATTTCACAGGG - Intergenic
1145318251 17:21747870-21747892 CACCATAACCCCATTTCACAGGG + Intergenic
1148002972 17:44400940-44400962 CAACATTATCCAAATTAAAAAGG - Exonic
1149136813 17:53376434-53376456 TTAAATAACCCCATTAAAAATGG - Intergenic
1149194821 17:54107155-54107177 ACAAATAACCCCATTAAAAATGG + Intergenic
1149945413 17:60920402-60920424 ACAAATAACCCCATTAAAAATGG + Intronic
1150444115 17:65215252-65215274 CCACATCACCCCATTTCAATCGG - Intronic
1153070832 18:1102552-1102574 AAATACAACCCCATTAAAAATGG - Intergenic
1153131997 18:1865189-1865211 AAAAATAACCCGATTCAAAAAGG + Intergenic
1153657160 18:7292946-7292968 AAAAACAACCCCATTAAAAATGG + Intergenic
1153844511 18:9036873-9036895 ATAAATAACCCAATTTAAAATGG + Intergenic
1155206626 18:23563945-23563967 ATAAATAACCCAATTTAAAATGG - Intronic
1155246715 18:23917687-23917709 CCAAACAACCCCATTAAAAATGG - Intronic
1155457381 18:26032549-26032571 CAACAAAAACCCACATAAAAAGG + Intronic
1155644484 18:28061109-28061131 TGACATAACATCATTTAAAATGG + Intronic
1155706354 18:28819429-28819451 CCAAATCACCCAATTTAAAATGG - Intergenic
1155832300 18:30532933-30532955 CCACATAACCCTTATTAAAATGG - Intergenic
1156106656 18:33671343-33671365 CAACATAAAGCTATTTATAAAGG + Intronic
1156158002 18:34326827-34326849 ACAAATAACCCCATTAAAAATGG + Intergenic
1158794251 18:60823457-60823479 CAAAATAATCCCCTTAAAAATGG + Intergenic
1158884018 18:61808127-61808149 CAACATTACCACATATACAAAGG + Exonic
1159328875 18:66962170-66962192 GAACACAATCTCATTTAAAATGG - Intergenic
1159456686 18:68668373-68668395 AAAAACAACCCCATTAAAAAGGG + Intergenic
1159515857 18:69456977-69456999 TCAAATAACCCCATTAAAAATGG - Intronic
1159543375 18:69809707-69809729 CAAAATAATCCTATTTATAATGG + Intronic
1160627639 18:80223431-80223453 AAAGACAACCCCATTAAAAATGG + Intronic
925192463 2:1895999-1896021 ACAAATAACCCCATTAAAAATGG + Intronic
925253746 2:2464671-2464693 CAAAATGACCACATTCAAAATGG - Intergenic
925292849 2:2759365-2759387 CTACATAAGCCTATTTTAAATGG + Intergenic
925300461 2:2807973-2807995 CAACATACCCCAATGTCAAATGG + Intergenic
925474286 2:4195451-4195473 ACATATAATCCCATTTAAAAAGG + Intergenic
926420374 2:12690611-12690633 CAACCTCACTCCAATTAAAATGG + Intergenic
926433267 2:12812383-12812405 AAAGACAACCCAATTTAAAATGG + Intergenic
926554970 2:14346538-14346560 CAATATAATCCTATGTAAAATGG - Intergenic
927673271 2:25086893-25086915 GAAAATAACCCAATTAAAAATGG - Intronic
928147796 2:28795635-28795657 AAAAACAACCCCATTAAAAATGG - Intronic
928720245 2:34112646-34112668 AAACATAACTCCAAGTAAAAAGG - Intergenic
928855295 2:35796243-35796265 CAACATGCCACCATTTAGAAAGG - Intergenic
929436367 2:41931526-41931548 CACCACAACTCCATTTTAAAGGG - Intergenic
929752129 2:44726458-44726480 AACAATAACCTCATTTAAAAAGG - Intronic
929925946 2:46209000-46209022 AAAAACAACCCTATTTAAAATGG - Intergenic
930046033 2:47174150-47174172 CAACATATGCTCATTGAAAACGG - Intronic
930521541 2:52473752-52473774 CTTCATAACCCCCTTTTAAATGG + Intergenic
930935910 2:56951305-56951327 CAAAATAAACACAATTAAAATGG - Intergenic
931427349 2:62183317-62183339 AAAGACAACCCAATTTAAAATGG + Intergenic
931567127 2:63626494-63626516 AAAAATAACCCCATTAAAAAAGG + Intronic
932859125 2:75270302-75270324 CAAAATAATCTCATTAAAAATGG - Intergenic
933024303 2:77235362-77235384 CCAAATAACCCCATTAAAAATGG - Intronic
933027757 2:77283139-77283161 TCAAATAACCCCATTAAAAATGG + Intronic
933053736 2:77634302-77634324 AAAAATAGCCCAATTTAAAATGG - Intergenic
933549532 2:83758241-83758263 CCAAATAACCCAATTAAAAATGG - Intergenic
933812564 2:86042224-86042246 AACCATCTCCCCATTTAAAATGG + Intronic
934514288 2:94975505-94975527 CCAAATAACCCCATTAAAAATGG + Intergenic
935313950 2:101812824-101812846 CAACGTAATCCAATTTAAATAGG - Intronic
935348154 2:102128119-102128141 AACCAAAACCACATTTAAAAAGG - Intronic
935662929 2:105485447-105485469 CAACATAAACTCAGTAAAAAAGG - Intergenic
936808427 2:116365701-116365723 CAACATAACGCTGTTGAAAAAGG - Intergenic
937571640 2:123370217-123370239 GGACATAACCCCATTAAAAATGG - Intergenic
938686952 2:133747758-133747780 AAAAATAACCCCATCAAAAATGG + Intergenic
938879720 2:135572334-135572356 ACACATAACCCAATTTAAAAGGG + Intronic
938925705 2:136039691-136039713 AAAGACAACCCAATTTAAAATGG + Intergenic
939122714 2:138137321-138137343 GAGCATAACCCCAGTTAATAGGG - Intergenic
939314064 2:140524136-140524158 ACAAATAACCCCATTAAAAATGG + Intronic
939486092 2:142812588-142812610 ACAAATAACCCCATTAAAAATGG - Intergenic
940956734 2:159737332-159737354 AAATATAACCCAATTTCAAATGG + Intronic
942180453 2:173375366-173375388 GAAAAGAACCCAATTTAAAATGG - Intergenic
942400428 2:175595859-175595881 CAACTTTACACAATTTAAAAAGG + Intergenic
942741844 2:179189804-179189826 GAACATATTCCCATTTATAATGG + Intronic
943111584 2:183612831-183612853 AAAAATAACCCAATTAAAAATGG - Intergenic
943128380 2:183825857-183825879 CAATACTACCCCAGTTAAAAAGG + Intergenic
943264780 2:185714685-185714707 ACAAATAACCCCATTAAAAATGG - Intergenic
943341560 2:186688343-186688365 CAACACAACAATATTTAAAATGG - Intergenic
943502477 2:188709226-188709248 ACAAATAACCCCATTAAAAATGG - Intergenic
943555731 2:189401758-189401780 CCACCTAACCCCAGTTAGAATGG - Intergenic
944184471 2:196931639-196931661 CAAACTAACTCCAGTTAAAATGG + Intergenic
945844169 2:214923752-214923774 CCATATCACCCCACTTAAAATGG - Intergenic
946515128 2:220403168-220403190 CAGCACCACACCATTTAAAAGGG - Intergenic
946976304 2:225156189-225156211 AAACATAATACCATTTACAATGG - Intergenic
947039089 2:225894684-225894706 CAAAATAATCCCAAATAAAATGG + Intergenic
947043482 2:225950130-225950152 CCACATAAGCCCATTAAAATTGG + Intergenic
947467285 2:230362409-230362431 CAACATCCCCACATTTAAATGGG - Intronic
1169838103 20:9903303-9903325 CAAAATAAAACCATGTAAAATGG + Intergenic
1170051106 20:12146294-12146316 AAAAACAACCCCATTAAAAAGGG - Intergenic
1170818174 20:19732770-19732792 CATCTCAACTCCATTTAAAATGG - Intergenic
1171440312 20:25155508-25155530 GAACTTAACCCAATTAAAAATGG - Intergenic
1172528467 20:35615513-35615535 CCAGAAAACCCCATCTAAAATGG - Intergenic
1175044237 20:56089222-56089244 CATCAAAACCCCATTTAAACAGG - Intergenic
1176713313 21:10327315-10327337 AAACACAACCCCATTTAAAAAGG - Intergenic
1176865569 21:14051895-14051917 CACAATAAGCCAATTTAAAATGG + Intergenic
1176930165 21:14800632-14800654 GAATATAGTCCCATTTAAAATGG + Intergenic
1177222935 21:18217812-18217834 CAATATTTCCCCATTTTAAATGG - Intronic
1177734823 21:25075901-25075923 GCAAATAACCCCATTAAAAATGG + Intergenic
1177761362 21:25406063-25406085 CCACCTTACCCCAGTTAAAATGG + Intergenic
1178003324 21:28189021-28189043 TAACCTCACCCCAGTTAAAATGG - Intergenic
1180829689 22:18897883-18897905 AAACACAACCCCATTTAAAAAGG - Intergenic
1181526005 22:23488123-23488145 AAAAACAGCCCCATTTAAAAAGG - Intergenic
1181625938 22:24122073-24122095 CAACATAAAGCCATTTAGCAGGG - Intronic
1182138012 22:27924241-27924263 TAACATAACCACATTTAAGAAGG - Intergenic
1183711040 22:39503270-39503292 CAACATTACCCCATTTTAAGTGG - Intronic
1183921485 22:41172847-41172869 CATCAGAGCCCCTTTTAAAATGG + Intronic
1203279780 22_KI270734v1_random:123156-123178 AAACACAACCCCATTTAAAAAGG - Intergenic
949153970 3:806961-806983 CAACATGAGCTGATTTAAAAGGG - Intergenic
949328114 3:2889981-2890003 GCAGATAACTCCATTTAAAAAGG - Intronic
949878890 3:8646116-8646138 CATGATAACCCCATTTACCATGG - Intronic
951237455 3:20252177-20252199 GAACAAAATCCCATTTACAATGG - Intergenic
952136460 3:30427787-30427809 TAACATAACCCCAGATAGAAGGG - Intergenic
952647568 3:35680127-35680149 GAACATGACCAGATTTAAAATGG - Intronic
953204243 3:40807681-40807703 ACAAATAACCCAATTTAAAAAGG - Intergenic
953721322 3:45357892-45357914 GAACTTAACCCCATTAAAAATGG - Intergenic
955460320 3:59174875-59174897 TATCATCACCCCAGTTAAAATGG - Intergenic
955851634 3:63226153-63226175 CAATCTAACCCCAGTTAGAATGG + Intergenic
956752496 3:72354449-72354471 CAACAAAACCACATTTTAGATGG - Intergenic
956981144 3:74639648-74639670 CCAGATAAACCCATTCAAAATGG - Intergenic
957028403 3:75211661-75211683 TAACATAACCACACTTAAAGGGG - Intergenic
957612392 3:82485014-82485036 TCACCTCACCCCATTTAAAATGG - Intergenic
957877673 3:86170836-86170858 TGACAAAGCCCCATTTAAAAAGG + Intergenic
957922272 3:86760931-86760953 ACAAATAACCCCATTAAAAATGG - Intergenic
958563083 3:95773591-95773613 ATAAATAACCCCATTTAAAATGG - Intergenic
958753900 3:98227352-98227374 CAAGATAACCACACTTACAAAGG + Intergenic
959659436 3:108849671-108849693 CATCATATCCCTATTTTAAAAGG + Intronic
960712858 3:120548409-120548431 CCAAATAATCCAATTTAAAATGG - Intergenic
960760346 3:121066480-121066502 CCACATTAACACATTTAAAAAGG - Intronic
963385654 3:144589815-144589837 AAACACAACACCATTTATAATGG - Intergenic
963584147 3:147163219-147163241 CAAAATAACCCCATAAATAATGG - Intergenic
964111792 3:153095702-153095724 CATCAAAACCCCATATAATAAGG - Intergenic
965819515 3:172670735-172670757 CCATAAAACCCCATATAAAACGG - Intronic
965880130 3:173379297-173379319 AAAAATAACCCCATTAAAAAGGG - Intergenic
965919183 3:173891731-173891753 CAACATAATCAGATTTAGAAAGG + Intronic
966032706 3:175370387-175370409 CCATAAAACCCCATATAAAATGG + Intronic
966268080 3:178070838-178070860 TAACATAGCCCCATTTATTAAGG - Intergenic
967532334 3:190563129-190563151 CCATATAACATCATTTAAAATGG - Intronic
967635616 3:191799264-191799286 TAAAATAACCCCATTAAAAATGG + Intergenic
969213200 4:5703866-5703888 CAACATAACCCCATTTAAAATGG - Intronic
970420905 4:15905036-15905058 CATGAAAACCCTATTTAAAATGG + Intergenic
971147276 4:23992429-23992451 CTACATAACACCCTGTAAAATGG + Intergenic
971446346 4:26753512-26753534 CAACTTAAACCACTTTAAAATGG - Intronic
971489558 4:27197222-27197244 GAAAACAACCCCATTAAAAAGGG + Intergenic
971791401 4:31174295-31174317 CAAAACAACCCCATTAAAACTGG - Intergenic
972191111 4:36592301-36592323 TCAAATAACCCCATTAAAAAGGG + Intergenic
972241670 4:37199786-37199808 AAACATAACCCCATTAAAAAAGG - Intergenic
972854202 4:43086915-43086937 TAACATCAACACATTTAAAAAGG + Intergenic
972921072 4:43942573-43942595 CCAAATAACCCCATTAAAAATGG + Intergenic
972994218 4:44860120-44860142 CAACAGAACACCAGTGAAAAAGG + Intergenic
973208363 4:47586184-47586206 CAATCTCACCCCAGTTAAAATGG - Intronic
973938433 4:55876828-55876850 GAATATATCCCAATTTAAAATGG - Intronic
973939156 4:55886992-55887014 CAAAATAAATCTATTTAAAAAGG - Intronic
974330463 4:60471022-60471044 ACAAATAACCCCATTAAAAATGG + Intergenic
974591689 4:63956847-63956869 CAACACAATCCCAATTGAAATGG - Intergenic
975752785 4:77541084-77541106 GAAAATAACCCCATTAAGAATGG - Intronic
975932608 4:79543664-79543686 GAAAACAACCCCATTAAAAATGG - Intergenic
975938320 4:79609241-79609263 GAATGTAATCCCATTTAAAATGG - Intergenic
977442123 4:97081035-97081057 CCAAATAACCCCATTAAAAATGG - Intergenic
977939175 4:102839939-102839961 AAAAATAACCCCATTAAAAGTGG + Intronic
977982881 4:103346231-103346253 CCCCATAAACCCAATTAAAATGG - Intergenic
978821031 4:112966604-112966626 CACCATAACACTACTTAAAATGG - Intronic
979102774 4:116643634-116643656 CAAAATAAGCCTATCTAAAAAGG + Intergenic
979522065 4:121679022-121679044 CAATGTAAGCCCATATAAAAGGG + Intronic
979837099 4:125384489-125384511 ATAAATAACCCAATTTAAAATGG - Intronic
981150323 4:141372767-141372789 ACAAGTAACCCCATTTAAAATGG - Intergenic
981445737 4:144836385-144836407 GCAAATAACCCAATTTAAAATGG - Intergenic
982111256 4:152057346-152057368 GAAAATAATCCCATTTACAATGG - Intergenic
982669979 4:158308734-158308756 AAAAATAACCTCATTAAAAATGG - Intergenic
982907141 4:161089048-161089070 CATCATCTCTCCATTTAAAATGG + Intergenic
983001768 4:162423520-162423542 CAAAAAAAACCCATTAAAAATGG - Intergenic
983074702 4:163311760-163311782 AAAAATAACCCTATTGAAAATGG + Intergenic
983453240 4:167932097-167932119 ATAAATAATCCCATTTAAAAAGG - Intergenic
983453582 4:167935323-167935345 ATAAATAATCCCATTTAAAAAGG + Intergenic
983457144 4:167979466-167979488 CCACCTCACCCCAGTTAAAATGG + Intergenic
983864408 4:172747325-172747347 ACAAATAACCCCATTAAAAATGG + Intronic
984071876 4:175124850-175124872 AAAAACAACCCCATTAAAAATGG + Intergenic
984465013 4:180088216-180088238 CAACACAAACCCATTTATCAAGG - Intergenic
985114196 4:186575271-186575293 CCAAATAACCCAATTAAAAATGG + Intergenic
985918951 5:2951501-2951523 CCAAATAATCCAATTTAAAATGG - Intergenic
986475571 5:8127503-8127525 CAACTCAACCCCTTTTACAATGG - Intergenic
986552149 5:8969158-8969180 TAAAATTACCCCATTTAGAATGG - Intergenic
987477317 5:18407233-18407255 AAAAATAACCCAATTAAAAATGG + Intergenic
987615529 5:20269042-20269064 CCAAATAATCCCATTAAAAATGG + Intronic
987696888 5:21343734-21343756 TAAAACAACCCCAGTTAAAAAGG - Intergenic
987821168 5:22968628-22968650 AAAAACAACCCCATTAAAAATGG - Intergenic
988137420 5:27192171-27192193 CCAAACAACCCCATTAAAAAAGG + Intergenic
988235040 5:28531709-28531731 AAAAACAACCCCATTAAAAATGG - Intergenic
988701058 5:33674933-33674955 CAACATTAATCCATTTACAAGGG - Intronic
988755317 5:34242813-34242835 TAAAACAACCCCAGTTAAAAAGG + Intergenic
989010401 5:36865280-36865302 AAAAATAACCCCACTTAAAATGG - Intergenic
989343159 5:40400026-40400048 GGACATAACCCCATTGTAAATGG + Intergenic
989359261 5:40581481-40581503 GCAAATAACCCCACTTAAAATGG + Intergenic
989395459 5:40951202-40951224 ATAAATAACCCCATTAAAAATGG - Intronic
989523415 5:42426056-42426078 CATCATAAACCACTTTAAAATGG + Intronic
989690421 5:44136730-44136752 CCACCTCACCCCAGTTAAAATGG - Intergenic
989758127 5:44980986-44981008 ACAAATAACCCCATTAAAAATGG + Intergenic
990548003 5:56843095-56843117 CAAAATGACCCCATTTTAACAGG - Intronic
991174606 5:63672565-63672587 TCAAATAACCCCATTAAAAATGG + Intergenic
991743553 5:69708541-69708563 TAAAACAACCCCAGTTAAAAAGG + Intergenic
991754156 5:69846691-69846713 TAAAACAACCCCAGTTAAAAAGG - Intergenic
991795126 5:70288273-70288295 TAAAACAACCCCAGTTAAAAAGG + Intergenic
991803781 5:70403450-70403472 TAAAACAACCCCAGTTAAAAAGG - Intergenic
991822924 5:70583819-70583841 TAAAACAACCCCAGTTAAAAAGG + Intergenic
991833472 5:70721814-70721836 TAAAACAACCCCAGTTAAAAAGG - Intergenic
991887491 5:71287795-71287817 TAAAACAACCCCAGTTAAAAAGG + Intergenic
992340092 5:75814564-75814586 GAACATAACTCCATTGACAAGGG - Intergenic
992356503 5:75989968-75989990 AAAAAAAACCCCATTAAAAAGGG - Intergenic
993007808 5:82447060-82447082 CAACCTTCCCCCAGTTAAAAGGG - Intergenic
994151915 5:96457368-96457390 CAGCATAATCCTCTTTAAAAAGG + Intergenic
995426411 5:112028508-112028530 CAAGAGAACCACAATTAAAAAGG + Intergenic
996579978 5:125020953-125020975 AAAAATAACCCAATTGAAAATGG + Intergenic
996773769 5:127112440-127112462 ACAAATAACCCCATTAAAAATGG + Intergenic
997763517 5:136474618-136474640 ATAAATAACCCCATTAAAAATGG + Intergenic
998574966 5:143305178-143305200 AAAAACAACCCCATTAAAAATGG + Intronic
998803930 5:145900064-145900086 AAAAACAACCCCATTAAAAATGG + Intergenic
999543908 5:152605683-152605705 CTAAATAACCCAATTAAAAATGG - Intergenic
999633004 5:153590938-153590960 CACAATACCCCCATTTAAAGGGG - Intronic
999860891 5:155644546-155644568 CAAGCAAACACCATTTAAAAAGG - Intergenic
1000612991 5:163395736-163395758 CCAAATAACCCCATTAAAAATGG + Intergenic
1000941973 5:167372603-167372625 CTATGTAATCCCATTTAAAATGG - Intronic
1002672457 5:180879076-180879098 AAAAATAACCCAATTAAAAATGG - Intergenic
1002768777 6:269145-269167 CACTATAACCACAGTTAAAAGGG - Intergenic
1004691992 6:18000249-18000271 CAAAATAACCTGATTAAAAATGG + Intergenic
1004812871 6:19278741-19278763 AAAGATAATCCAATTTAAAATGG - Intergenic
1008575804 6:52859048-52859070 CAACAAGATGCCATTTAAAATGG + Intronic
1008778893 6:55077315-55077337 AAAAACAACCCCATTAAAAAGGG + Intergenic
1009492291 6:64306358-64306380 CAAAATAACCCCTTTTATAAGGG + Intronic
1010299781 6:74246154-74246176 AAAAACAACCCCATTAAAAATGG - Intergenic
1010371899 6:75119922-75119944 CATCACAACCTCATTGAAAATGG + Intronic
1010612526 6:77971493-77971515 GCAAATAACCCCATTGAAAATGG + Intergenic
1010659499 6:78553116-78553138 CCAAACAACCCCATTAAAAATGG - Intergenic
1010828390 6:80500496-80500518 CCAAATAATCCCATTAAAAATGG + Intergenic
1010987689 6:82443846-82443868 CAAAATAAACACATTTCAAAAGG - Intergenic
1011256657 6:85428896-85428918 AGAAATAACCCTATTTAAAATGG + Intergenic
1011965315 6:93149931-93149953 CAACATAACTGCCTTTTAAATGG + Intergenic
1012008339 6:93745605-93745627 CAACATAATCCCAATAAAAATGG - Intergenic
1012687292 6:102267895-102267917 CAAAACAACCCTATTAAAAATGG + Intergenic
1012761133 6:103303746-103303768 AAAAATAACCCCATTAAAAATGG + Intergenic
1012768889 6:103403927-103403949 CAACATAGAACCATTTATAAAGG - Intergenic
1013479335 6:110539959-110539981 CCAAATAACTCCATTAAAAATGG - Intergenic
1014343069 6:120232730-120232752 CAACATTATCCCAGTTAGAATGG + Intergenic
1014653575 6:124071636-124071658 CAAAATAACCCCTTTAAAAATGG + Intronic
1014720655 6:124913724-124913746 CCAAATAACCCAATTAAAAATGG - Intergenic
1014945159 6:127488604-127488626 AAACAAAAGCCCATTTGAAAAGG + Intronic
1015375602 6:132506410-132506432 ACAAATAACCCCATTAAAAAGGG + Intronic
1016185158 6:141189650-141189672 TAACCTCACCCCAGTTAAAATGG - Intergenic
1016223892 6:141709937-141709959 CCAAATAACCCCATTAAAAATGG + Intergenic
1016660747 6:146576545-146576567 CAACCTCACCCCAATTAGAATGG + Intergenic
1020224673 7:6271422-6271444 CATCAGAACCCCATGTAATAAGG - Intronic
1020329576 7:7003823-7003845 CAGCATAACCCAATCTAAACTGG + Intergenic
1020579964 7:9984722-9984744 CCAAATAACCCAATTTAAAATGG - Intergenic
1021155151 7:17200754-17200776 AAAAACAACCCCATTAAAAATGG - Intergenic
1021436257 7:20619512-20619534 ACAAATAACCCCATTAAAAATGG - Intronic
1021797578 7:24272615-24272637 CAACATAAAGCCATTCATAAGGG + Intergenic
1021814541 7:24434406-24434428 CAACATAACCACAATTATACTGG + Intergenic
1022781214 7:33586202-33586224 CCAAATAACCTCATTAAAAATGG + Intronic
1023290617 7:38665193-38665215 CCAAATAACCCTATTTAAAATGG + Intergenic
1023791579 7:43757861-43757883 CAACAAAACCTCACTTAAACAGG + Intergenic
1024382361 7:48712321-48712343 CAAGAGAACCCCAATTCAAATGG - Intergenic
1025101339 7:56137683-56137705 CCAGATAACCCCATTAAAAAGGG + Intergenic
1025702730 7:63834848-63834870 CATAATAAGCCCCTTTAAAATGG - Intergenic
1026171980 7:67961954-67961976 CATAATAAGCCCTTTTAAAATGG - Intergenic
1026462500 7:70627326-70627348 ACAAATAACCCCATTAAAAATGG - Intronic
1026494260 7:70888834-70888856 CAACATTAACCCATTTATGAAGG + Intergenic
1027356318 7:77359485-77359507 CAATATAAGCCCATTTTAATAGG + Intronic
1027423445 7:78039652-78039674 CAACAGAACCGCCTCTAAAATGG - Intronic
1027666964 7:81051541-81051563 AAAATTAAACCCATTTAAAAAGG + Intergenic
1027939683 7:84659714-84659736 GAATATTCCCCCATTTAAAATGG + Intergenic
1027945654 7:84742089-84742111 CAACTATACCCCCTTTAAAAGGG - Intergenic
1027957201 7:84895801-84895823 TAAAATAACCCTATTAAAAATGG - Intergenic
1027997512 7:85444016-85444038 CAAAATAACCATTTTTAAAAAGG - Intergenic
1028995345 7:97094247-97094269 AAACAAAACACAATTTAAAAAGG + Intergenic
1029000249 7:97146210-97146232 AAACATCAGCACATTTAAAAAGG - Intronic
1031904949 7:127450490-127450512 ACAAATAATCCCATTTAAAATGG + Intergenic
1032330740 7:130976791-130976813 CAACAGAACTTGATTTAAAATGG + Intergenic
1033462385 7:141558954-141558976 CAACAAAACTCAATTAAAAATGG - Intronic
1033725516 7:144112108-144112130 AAAAACAACCCCATTAAAAATGG - Intergenic
1034112574 7:148552251-148552273 GAACACAATCCCATTTACAATGG - Intergenic
1035400118 7:158559166-158559188 CTTCATCACCCCATTTAAAAAGG + Intronic
1036056917 8:5265525-5265547 CATCATAACCCCAATTAATGTGG - Intergenic
1036739983 8:11351522-11351544 CACCATAATACCATTGAAAATGG - Intergenic
1037048006 8:14333817-14333839 AAATATAACTCCATTTTAAATGG - Intronic
1037966871 8:23141629-23141651 GAAAACAACCCCATTAAAAATGG + Intronic
1039657984 8:39431112-39431134 AAAAATAACCCCATTTAAATTGG - Intergenic
1040356313 8:46621841-46621863 CAGCATAACCCAATCTAAACTGG + Intergenic
1040409072 8:47136459-47136481 CAAAACAATCCCATTGAAAATGG - Intergenic
1040628432 8:49179427-49179449 CCACTTCACCCCAGTTAAAATGG + Intergenic
1041295207 8:56349855-56349877 AAACACAATCCCATTCAAAATGG - Intergenic
1041700200 8:60780211-60780233 AAAAATAACCACATTTAGAATGG - Intronic
1042628039 8:70781251-70781273 ACAAATAACCCAATTTAAAATGG - Intronic
1042825946 8:72979387-72979409 CAACATAATACCATTTATTAAGG - Intergenic
1042984578 8:74568821-74568843 CCTCACAACCCTATTTAAAATGG - Intergenic
1043380789 8:79699985-79700007 CAATATAAACTCATTTTAAATGG + Intergenic
1044119133 8:88372739-88372761 ACAAATAACCCAATTTAAAATGG - Intergenic
1044123599 8:88429318-88429340 TAATCTAACCCCAGTTAAAATGG - Intergenic
1044965523 8:97570310-97570332 CAACATGACCTCATTGCAAATGG - Intergenic
1045978826 8:108160451-108160473 CAACATAAAAGTATTTAAAATGG - Intergenic
1046317219 8:112520097-112520119 CAATAGAACCCTATTTAATAAGG - Intronic
1046777062 8:118175650-118175672 AAAAATAACCCCACTAAAAATGG + Intergenic
1047572890 8:126120091-126120113 GAAAACAACCCCATTTACAATGG - Intergenic
1047813207 8:128433135-128433157 ACATATAACCCCATTAAAAATGG + Intergenic
1048426343 8:134327573-134327595 CAACATTATCCCATTTTACATGG + Intergenic
1048578028 8:135708231-135708253 AAAAATAACCCAATTAAAAATGG + Intergenic
1050050375 9:1594617-1594639 AAAAATAATCCCATTTTAAATGG + Intergenic
1050304056 9:4288713-4288735 CAACCTAAAACTATTTAAAACGG - Intronic
1051437282 9:17046308-17046330 CACCATTCACCCATTTAAAATGG + Intergenic
1051643225 9:19243014-19243036 CAAGATACCCCCCTTTAAATTGG - Intronic
1052144727 9:25035165-25035187 ACAAATAACCCAATTTAAAATGG + Intergenic
1052208613 9:25873182-25873204 TATCATCACCCCAGTTAAAATGG - Intergenic
1052372619 9:27682799-27682821 CAATATTCCCACATTTAAAATGG + Intergenic
1054822549 9:69538026-69538048 CTACAAAAGCCCATTGAAAAAGG + Intronic
1055869417 9:80855932-80855954 AAAAATAAACCCATTAAAAATGG - Intergenic
1056361930 9:85867129-85867151 CAAAACAACCCCATTAAAATGGG + Intergenic
1057749121 9:97776829-97776851 CCAAATAACCAAATTTAAAAAGG + Intergenic
1057881940 9:98799005-98799027 GAACACAACCTCATTTACAATGG + Intergenic
1058526374 9:105863340-105863362 ATAAATAACCCCATTAAAAATGG + Intergenic
1059876296 9:118639034-118639056 AAACACAACCCCCTTAAAAATGG - Intergenic
1059883988 9:118724347-118724369 GAACACAATCCCATTTATAATGG - Intergenic
1059966543 9:119620229-119620251 CCAAACAACCCCATTAAAAATGG - Intergenic
1060383104 9:123195577-123195599 GAAAATAATCCCATTTATAATGG + Intronic
1060935383 9:127511897-127511919 CCACGTCACCCCAGTTAAAATGG + Intronic
1062663162 9:137650573-137650595 AAAGACAACCCAATTTAAAATGG - Intronic
1186938725 X:14480193-14480215 ACAAATAACCCCATTAAAAATGG - Intergenic
1187051193 X:15697198-15697220 AAAAACAACCCCATTAAAAAAGG - Intronic
1187184653 X:16971322-16971344 AAAGACAACCCAATTTAAAATGG - Intronic
1187322591 X:18253729-18253751 AAACATAACACTATTTATAAGGG + Intronic
1187632611 X:21191676-21191698 ACAAATAACCCCATTAAAAATGG + Intergenic
1187696078 X:21922402-21922424 AAACATAATCACATTTGAAAGGG - Intergenic
1188014510 X:25093337-25093359 AAAAACAATCCCATTTAAAATGG - Intergenic
1188237230 X:27745320-27745342 TAAAATAACATCATTTAAAAAGG - Intronic
1188363933 X:29291266-29291288 CCAAATATCCCCATTTGAAATGG + Intronic
1188723102 X:33547119-33547141 AAAAAAAACCCCATTAAAAATGG - Intergenic
1188950168 X:36361543-36361565 CAACATTAATACATTTAAAAGGG - Intronic
1189129861 X:38486563-38486585 CCAAATAACCCCATTAAAAGTGG - Intronic
1189614097 X:42766576-42766598 CAACTAGACCCCATTTACAAAGG + Intergenic
1189614260 X:42767809-42767831 CCATATACCCCCAGTTAAAAAGG + Intergenic
1189766367 X:44376493-44376515 CCAAATAACCCCATTAAAAATGG + Intergenic
1191031130 X:55973506-55973528 AAAAACAACCCCATTAAAAATGG + Intergenic
1191586378 X:62831414-62831436 GAATATAATCCCATTTATAAGGG + Intergenic
1191920623 X:66253268-66253290 ACCCATAACCCAATTTAAAATGG + Intronic
1192028290 X:67479748-67479770 ACAGATAACCCCATTAAAAATGG - Intergenic
1192573651 X:72225894-72225916 CAACTAGACCCCATTTACAAAGG + Intronic
1192889670 X:75376241-75376263 AAAAACAACCCCATTAAAAATGG - Intronic
1192981353 X:76346727-76346749 ACAAATAACCCCATTAAAAAGGG - Intergenic
1193143306 X:78052401-78052423 CAAAAAAACCCTATTAAAAATGG + Intergenic
1193417864 X:81246144-81246166 CAAAATAACCCCATTACAAATGG - Intronic
1193424297 X:81321967-81321989 CTAGCAAACCCCATTTAAAAAGG - Intergenic
1193508981 X:82376800-82376822 ATAAATAACCCCATTAAAAATGG - Intergenic
1193767318 X:85545654-85545676 ACAAATAACCCCATTAAAAATGG - Intergenic
1193768076 X:85556239-85556261 AAACAGAACCCCATAAAAAAAGG - Intergenic
1193773281 X:85613347-85613369 CCCAATAACCCCATTAAAAATGG - Intergenic
1193889156 X:87021819-87021841 AAAAAAAACCCCATTAAAAATGG + Intergenic
1193927646 X:87508235-87508257 GAAGACAACCCCATTAAAAATGG + Intergenic
1193984600 X:88224971-88224993 TAACATAATCCCATTTACAATGG - Intergenic
1194099715 X:89688797-89688819 CCAAATAACCCAATTAAAAATGG - Intergenic
1194242375 X:91468037-91468059 CCAAATAACCTCATTAAAAATGG - Intergenic
1195058785 X:101173905-101173927 AAAAACAACCCCATTAAAAATGG + Intergenic
1196265647 X:113642099-113642121 AAAAACAACCCCATTAAAAATGG - Intergenic
1196371891 X:114988276-114988298 TAACATAACCTCATTTGAACAGG + Intergenic
1196486134 X:116210091-116210113 CAAAATAACCTTATTAAAAATGG + Intergenic
1196553889 X:117063906-117063928 CAACATTAATCCATTTATAAAGG - Intergenic
1197090769 X:122533935-122533957 CCATCTAACCCCAGTTAAAAAGG + Intergenic
1197368024 X:125590239-125590261 CAAAATAACCCATTTTAAAAAGG + Intergenic
1197519619 X:127481152-127481174 TAACCTCACCCCAATTAAAATGG - Intergenic
1197537941 X:127713853-127713875 GATAGTAACCCCATTTAAAATGG + Intergenic
1197576393 X:128217401-128217423 CCAAATAACTCCATTAAAAATGG + Intergenic
1197576714 X:128221649-128221671 CAAAATAACCTGATTAAAAATGG + Intergenic
1197963319 X:132029411-132029433 CATCATAACACCTTTTACAAAGG - Intergenic
1198305487 X:135378738-135378760 CAGCATCAGCCAATTTAAAAGGG - Intergenic
1198946600 X:142022830-142022852 TATTATCACCCCATTTAAAATGG - Intergenic
1199136471 X:144259392-144259414 ACAAAGAACCCCATTTAAAATGG - Intergenic
1199175116 X:144778395-144778417 GAACACAACCCCATTTACAGTGG - Intergenic
1199750405 X:150811084-150811106 CACAATAACCCAATTTAAAATGG + Intronic
1199932260 X:152535220-152535242 AAACACAACCCCAATAAAAATGG - Intergenic
1200365155 X:155655191-155655213 CCAAATAACCCCATTAAAAATGG - Intronic
1200452720 Y:3350180-3350202 CCAAATAACCCAATTAAAAATGG - Intergenic
1201634469 Y:16107178-16107200 AAATATAACTCCATCTAAAATGG + Intergenic
1202300645 Y:23410086-23410108 AAACAAAACCCAATTAAAAATGG - Intergenic
1202570166 Y:26260512-26260534 AAACAAAACCCAATTAAAAATGG + Intergenic