ID: 969215503

View in Genome Browser
Species Human (GRCh38)
Location 4:5719222-5719244
Sequence AAACCCGAAGGTCAGGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969215503_969215507 14 Left 969215503 4:5719222-5719244 CCCAACTCCTGACCTTCGGGTTT 0: 1
1: 0
2: 0
3: 13
4: 186
Right 969215507 4:5719259-5719281 TCAAAATCTGCTCAAGAATTTGG 0: 1
1: 0
2: 2
3: 25
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969215503 Original CRISPR AAACCCGAAGGTCAGGAGTT GGG (reversed) Intronic
900011251 1:111140-111162 ATCACCTAAGGTCAGGAGTTCGG + Intergenic
900027355 1:287704-287726 ATCACCTAAGGTCAGGAGTTCGG + Intergenic
900041310 1:467148-467170 ATCACCTAAGGTCAGGAGTTCGG + Intergenic
900062744 1:702123-702145 ATCACCTAAGGTCAGGAGTTCGG + Intergenic
900701820 1:4053331-4053353 AAAACTGAAGGGTAGGAGTTAGG - Intergenic
901029240 1:6297256-6297278 ATAACCTGAGGTCAGGAGTTTGG - Intronic
912598272 1:110901396-110901418 AGATCACAAGGTCAGGAGTTCGG - Intergenic
914423626 1:147553493-147553515 AAACCAGAGGGTAAGGATTTAGG + Intronic
917131744 1:171750519-171750541 AAACCCGGAGGTCAGGTTTCTGG - Intergenic
922259692 1:223927143-223927165 ATCACCTAAGGTCAGGAGTTCGG + Intergenic
924340857 1:243029699-243029721 ATCACCTAAGGTCAGGAGTTCGG + Intergenic
1062820981 10:534334-534356 GAGCCAGATGGTCAGGAGTTGGG + Intronic
1063819788 10:9820520-9820542 AAGCACGCAGTTCAGGAGTTAGG + Intergenic
1066735615 10:38475709-38475731 ATCACCTAAGGTCAGGAGTTCGG - Intergenic
1069310931 10:67035362-67035384 AAAACTGAAGCTAAGGAGTTTGG + Intronic
1069601146 10:69708896-69708918 AAACCCAAAGGTGATGAGATGGG - Intergenic
1069999257 10:72364235-72364257 AAATCACAAGGTCAGGAGATCGG - Intergenic
1072323055 10:94269712-94269734 AAAGGCCAATGTCAGGAGTTAGG + Intronic
1072423763 10:95311575-95311597 AATTCAGAGGGTCAGGAGTTAGG + Intergenic
1073199875 10:101726755-101726777 ATCACCTAAGGTCAGGAGTTCGG - Intergenic
1074518365 10:114193512-114193534 ATGACCTAAGGTCAGGAGTTCGG - Intronic
1075882271 10:125863669-125863691 AGATCCCAAGGTCAGGAGATCGG - Intronic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1076798755 10:132811162-132811184 AAACCTGACGGTCATGAGGTCGG - Intronic
1076967583 11:103377-103399 ATCACCTAAGGTCAGGAGTTCGG + Intergenic
1077910754 11:6569907-6569929 GAACCCGAAGCTCAGGAGAGAGG + Intronic
1081665977 11:44917394-44917416 AAACCCATGGGCCAGGAGTTTGG - Intronic
1083577809 11:63804959-63804981 AGATCACAAGGTCAGGAGTTTGG - Intergenic
1086337280 11:85811878-85811900 ATAACCCGAGGTCAGGAGTTCGG + Intergenic
1089240533 11:117074700-117074722 ATTCCCTGAGGTCAGGAGTTTGG + Intronic
1089530979 11:119129259-119129281 AGATCACAAGGTCAGGAGTTTGG - Intronic
1090371230 11:126254535-126254557 AAAACGGAAGGTCAGGGGCTAGG + Intronic
1092108857 12:5945101-5945123 AATCCCGAAGGGTGGGAGTTCGG + Intronic
1093922424 12:24874091-24874113 AACACCTGAGGTCAGGAGTTTGG + Intronic
1094617955 12:32053245-32053267 AGATCACAAGGTCAGGAGTTCGG - Intergenic
1095240079 12:39847666-39847688 AAACTCAAGGGTAAGGAGTTGGG - Intronic
1096410138 12:51371302-51371324 AACCCTTGAGGTCAGGAGTTTGG - Intronic
1098077807 12:66751599-66751621 ACACCTCAAGGGCAGGAGTTAGG + Intronic
1099743850 12:86676665-86676687 AAACTCTAATGCCAGGAGTTAGG + Intronic
1101375900 12:104171320-104171342 ATCACCTAAGGTCAGGAGTTGGG - Intergenic
1101451362 12:104782185-104782207 AGACTTGAAGATCAGGAGTTCGG + Intergenic
1101714756 12:107300995-107301017 CAACCCCAAGCTCAGGAGATTGG - Intergenic
1102290002 12:111691815-111691837 AACACCTGAGGTCAGGAGTTGGG - Intronic
1107141044 13:36999087-36999109 AAACTCCGAGGTCAGGAATTTGG + Intronic
1108426082 13:50301906-50301928 ATAACCTGAGGTCAGGAGTTTGG + Intronic
1108666898 13:52641871-52641893 AAAACAAAAAGTCAGGAGTTTGG + Exonic
1109370754 13:61416449-61416471 GAAACAGAAGGCCAGGAGTTAGG - Intronic
1112160317 13:96860255-96860277 AAATCCGAAGGTCAGCAGGCTGG + Intergenic
1113631290 13:111886425-111886447 AACACCTGAGGTCAGGAGTTTGG + Intergenic
1115172336 14:30523786-30523808 GAACCTGAAGTTTAGGAGTTAGG + Intergenic
1115249070 14:31327509-31327531 ATCACCTAAGGTCAGGAGTTCGG - Intronic
1115347262 14:32356261-32356283 AAACCCTAAGGAGAGGACTTAGG - Intronic
1117968576 14:61230421-61230443 AAAATCAAAGGTAAGGAGTTGGG - Intronic
1118304191 14:64640846-64640868 AAACCCCAATGACAGGTGTTGGG - Intergenic
1119487531 14:75000794-75000816 TCACCTGAAAGTCAGGAGTTTGG - Intergenic
1119499359 14:75110565-75110587 ATACCCAAAGGCCAGCAGTTTGG + Intronic
1120920647 14:89752333-89752355 ATAACCTGAGGTCAGGAGTTCGG + Intergenic
1121774433 14:96581425-96581447 AAACCCGAAGGAAGGGGGTTTGG + Intergenic
1124574579 15:30896410-30896432 ATCACCTAAGGTCAGGAGTTTGG + Intergenic
1127564409 15:60172826-60172848 AAAACGGAAGGTCAGGAGATTGG - Intergenic
1128440758 15:67706465-67706487 TAACCAGATGGTCAGGAGTGAGG + Intronic
1128788206 15:70413722-70413744 AAACTGGAGGCTCAGGAGTTAGG - Intergenic
1130142381 15:81238943-81238965 AAACATGAAGGTCAGAAGTCAGG - Intronic
1131167120 15:90150244-90150266 AAATGCAATGGTCAGGAGTTTGG - Intergenic
1132848715 16:2013739-2013761 ATCCCCTGAGGTCAGGAGTTCGG + Intronic
1133521589 16:6563522-6563544 AAATACTATGGTCAGGAGTTGGG + Intronic
1138664124 16:58549066-58549088 ATCACCTAAGGTCAGGAGTTCGG + Intronic
1139941330 16:70607986-70608008 ATCACCTAAGGTCAGGAGTTCGG - Intronic
1140679935 16:77375240-77375262 ATCCCCTGAGGTCAGGAGTTCGG - Intronic
1141371319 16:83488843-83488865 ATCACCTAAGGTCAGGAGTTTGG - Intronic
1142453098 16:90195766-90195788 ATCACCTAAGGTCAGGAGTTCGG - Intergenic
1143792832 17:9312065-9312087 AAATCACAAGGTCAGGAGTTCGG - Intronic
1145210518 17:21009732-21009754 ATCACCTAAGGTCAGGAGTTTGG + Intronic
1145219103 17:21073933-21073955 AGACCACAAGGTCAGGAGTTTGG - Intergenic
1146196090 17:30814431-30814453 ATCACCTAAGGTCAGGAGTTGGG + Intronic
1147295438 17:39478412-39478434 ATCACCTAAGGTCAGGAGTTCGG - Intronic
1148516830 17:48226932-48226954 AAACTGGAAGGTATGGAGTTAGG - Intronic
1150560350 17:66289099-66289121 ATGCCCGAAGGTTGGGAGTTAGG - Intergenic
1158679661 18:59555903-59555925 AAACCCACAGCTCAGGAGATTGG + Intronic
1160644387 19:173000-173022 AACACCTAAGGTCAGGAGTTCGG + Intergenic
1162025750 19:7893226-7893248 AAATCACAAGGTCAGGAGTTAGG - Intronic
1162740718 19:12772124-12772146 AAATCCAAAGGCCGGGAGTTGGG - Intronic
1163639441 19:18453049-18453071 ATCACCTAAGGTCAGGAGTTCGG + Intronic
1164654149 19:29908713-29908735 ATCACCTAAGGTCAGGAGTTCGG + Intergenic
1164802870 19:31092201-31092223 AAACCCCAAGGTCAAGAGGCAGG + Intergenic
1165435367 19:35792152-35792174 AAACCCCAAGGCCGGGACTTGGG + Intergenic
1165799134 19:38536908-38536930 AAACCTGGAGATCAGGAGTCTGG + Intronic
1166223072 19:41377788-41377810 ATCCCCTAAGGTCAGGAGTTCGG + Intronic
1166806978 19:45493235-45493257 GAACCCGGAGGACAGGAGTAGGG + Exonic
1166989051 19:46679843-46679865 AACACCTGAGGTCAGGAGTTTGG - Intronic
1168284798 19:55325678-55325700 AACACCGGATGTCAGGAGTTTGG - Intronic
925517512 2:4699847-4699869 ATCACCCAAGGTCAGGAGTTCGG - Intergenic
927819092 2:26246559-26246581 ATCACCTAAGGTCAGGAGTTCGG - Intronic
928229351 2:29483045-29483067 AAACCCAAAGGGCAGGAACTTGG + Intronic
928667196 2:33561285-33561307 AATACCTGAGGTCAGGAGTTTGG - Intronic
934936212 2:98467291-98467313 AATCCCGAATGTCAGAAGTGGGG - Intronic
935532626 2:104253630-104253652 CAACCTGAGGGTCAGGAGGTGGG - Intergenic
937262555 2:120595800-120595822 AAACATGAAGCTGAGGAGTTAGG + Intergenic
938228530 2:129638036-129638058 AGATCACAAGGTCAGGAGTTTGG - Intergenic
939497868 2:142945956-142945978 ATCACCCAAGGTCAGGAGTTCGG - Intronic
940642945 2:156366265-156366287 ATCGCCTAAGGTCAGGAGTTGGG + Intergenic
941191972 2:162395862-162395884 AAACCCTAAAGTCAATAGTTAGG - Intronic
942613638 2:177767107-177767129 AGACCACAAGGTCAGGAGTTCGG + Intronic
942709581 2:178818021-178818043 ATCACCTAAGGTCAGGAGTTTGG - Intronic
943687260 2:190831576-190831598 AAACAAGAAGGACATGAGTTGGG + Intergenic
944653617 2:201856795-201856817 AAACCCAAATGTCTGAAGTTTGG - Intronic
945973526 2:216253257-216253279 AAACCCGGAGTTCAGGAGTCTGG + Intergenic
947537316 2:230948311-230948333 AGACCCAGAGGTCAGGAGATGGG - Intronic
949084536 2:242140429-242140451 ATCACCTAAGGTCAGGAGTTCGG - Intergenic
1172976938 20:38913210-38913232 AAATCAGAATCTCAGGAGTTGGG + Intronic
1175006871 20:55693227-55693249 AAATCCGATGGTGAGGAGATAGG - Intergenic
1176281115 20:64312923-64312945 ATCACCTAAGGTCAGGAGTTCGG - Intergenic
1180661018 22:17467368-17467390 AAACCCTTAGGACAGGACTTGGG + Intronic
1182863682 22:33583468-33583490 AAACCTTAAGGTCAGGGTTTTGG + Intronic
953946047 3:47148349-47148371 ATCCCCTGAGGTCAGGAGTTTGG - Intronic
954653894 3:52182206-52182228 AAACCAGAAGGTTCTGAGTTGGG - Intergenic
955199146 3:56834123-56834145 AGACCACAAGGTCAGGAGTTCGG - Intronic
957554738 3:81751678-81751700 AAAAGCGAAGGTCAGTGGTTTGG - Intronic
959081929 3:101811222-101811244 AGACCTGCAGGTCAGGAGTTTGG - Intronic
959947712 3:112144397-112144419 GGACGCCAAGGTCAGGAGTTTGG - Intronic
962113637 3:132477285-132477307 AAAGTCAAAGATCAGGAGTTGGG - Intronic
963603981 3:147398498-147398520 AAAGCCGAGGGTCGGGGGTTGGG + Intronic
964074173 3:152673062-152673084 AAACCCAAAACTCAGGAATTGGG - Intergenic
964278007 3:155028412-155028434 AAAGCCTAAGGACAGGAGTGAGG + Intronic
968185871 3:196633236-196633258 ATCGCCTAAGGTCAGGAGTTCGG + Intergenic
968340491 3:197951571-197951593 ATCACCTAAGGTCAGGAGTTTGG - Intronic
969215503 4:5719222-5719244 AAACCCGAAGGTCAGGAGTTGGG - Intronic
970167577 4:13255876-13255898 ATACCATAAGCTCAGGAGTTAGG + Intergenic
972859191 4:43146456-43146478 AAACCAGGAGATCAGGTGTTGGG + Intergenic
979261967 4:118658663-118658685 ATCACCTAAGGTCAGGAGTTCGG - Intergenic
981535029 4:145790852-145790874 AAAACCCAAGGTCAGGAGAAAGG - Intronic
981999155 4:151006119-151006141 ATCACCTAAGGTCAGGAGTTCGG + Intronic
982368174 4:154603506-154603528 AAAGCCAAAGCTCAGGACTTCGG + Intergenic
986064544 5:4222910-4222932 AGACCCAAGGGGCAGGAGTTAGG - Intergenic
990553489 5:56908292-56908314 ATCCCCTGAGGTCAGGAGTTCGG - Intergenic
990633304 5:57694916-57694938 AAATCCGAAGCTCTGGAGTGTGG - Intergenic
996905380 5:128594197-128594219 ATCTCCTAAGGTCAGGAGTTTGG - Intronic
997136314 5:131330010-131330032 AATCATGAAGGTCAGGAATTTGG + Intronic
997346799 5:133198094-133198116 AAACCCCAAGGACACGAGTGGGG - Exonic
1000113333 5:158129983-158130005 AAACACTGAGGTCAGGAATTTGG - Intergenic
1000813515 5:165891444-165891466 AAACCCGAAGGACAGGGTTCAGG + Intergenic
1002362308 5:178682095-178682117 AGATCACAAGGTCAGGAGTTTGG - Intergenic
1002732536 5:181351780-181351802 ATCACCTAAGGTCAGGAGTTCGG - Intergenic
1002752003 6:122328-122350 ATCACCTAAGGTCAGGAGTTCGG + Intergenic
1003354908 6:5359258-5359280 TCACCCTGAGGTCAGGAGTTTGG - Intronic
1003436940 6:6099276-6099298 ATCACCCAAGGTCAGGAGTTTGG + Intergenic
1003642431 6:7887238-7887260 ATGCCTGAAGGCCAGGAGTTTGG - Intronic
1004310929 6:14544198-14544220 AAACCCAAAGCCCAGGGGTTTGG - Intergenic
1005436470 6:25817067-25817089 ATAACCTAAAGTCAGGAGTTCGG - Intronic
1005792915 6:29325743-29325765 AATCTAGAAGGTCAGGAGTGTGG + Intergenic
1006264689 6:32910587-32910609 AGATCACAAGGTCAGGAGTTTGG + Intergenic
1008042360 6:46815736-46815758 AAACCCCACGGTCAGGACTCAGG - Intronic
1008620799 6:53269929-53269951 AAACACGGAGGTCAGGAGCAAGG - Intronic
1009901289 6:69810606-69810628 ATAACCTGAGGTCAGGAGTTCGG - Intergenic
1012196419 6:96347070-96347092 AAACCAAAAGGTCATGAGCTTGG + Intergenic
1012873292 6:104696548-104696570 TTACCCCAATGTCAGGAGTTTGG + Intergenic
1013288223 6:108698528-108698550 AAACTCAAAGGCCAGGAGTGAGG - Intergenic
1019236788 6:170624099-170624121 ATCACCTAAGGTCAGGAGTTCGG - Intergenic
1020406471 7:7840930-7840952 AAGCCAGCAGGTTAGGAGTTGGG + Intronic
1020439855 7:8205927-8205949 CAACTCGAAGGCCTGGAGTTGGG + Intronic
1020512089 7:9069515-9069537 AGATCACAAGGTCAGGAGTTTGG + Intergenic
1021180473 7:17499875-17499897 AAACCAGAAGATGAAGAGTTTGG + Intergenic
1022837757 7:34133331-34133353 AACCCCAAAGGTCAGGGTTTGGG + Intronic
1026441596 7:70449511-70449533 AACCCAGAAAGTTAGGAGTTGGG + Intronic
1026844254 7:73688965-73688987 AAAACCGAAGGCCAGCAGTATGG + Intronic
1027434949 7:78154825-78154847 AAACCTGGATGTCAGGACTTGGG + Intronic
1034095232 7:148401525-148401547 AAACACGAAGGTAAGGTATTTGG - Intronic
1034123897 7:148653631-148653653 ATAACCTGAGGTCAGGAGTTCGG + Intergenic
1034149805 7:148906180-148906202 ACAGCAGAAGGTCAAGAGTTAGG + Intergenic
1034606935 7:152325367-152325389 GATCCCTGAGGTCAGGAGTTTGG - Intronic
1035510984 8:182511-182533 AACACCTAAGGTCAGGAGTTCGG + Intergenic
1036241124 8:7081930-7081952 GAATCACAAGGTCAGGAGTTCGG + Intergenic
1037923730 8:22828586-22828608 AAACCTCAGGGTCAGGAGGTTGG + Intronic
1039463451 8:37764742-37764764 AAACCCAAACGTTAGCAGTTTGG - Intronic
1039973923 8:42343906-42343928 AGATCACAAGGTCAGGAGTTCGG + Intronic
1040402572 8:47066807-47066829 AGATCACAAGGTCAGGAGTTTGG + Intergenic
1042827769 8:72995707-72995729 AGATCACAAGGTCAGGAGTTTGG - Intergenic
1043851841 8:85224888-85224910 AAACCTTAATGTCATGAGTTTGG + Intronic
1047795723 8:128253488-128253510 AGATCACAAGGTCAGGAGTTTGG - Intergenic
1050809085 9:9720466-9720488 GAAGCCGAAAGTCAGAAGTTAGG + Intronic
1050934447 9:11377378-11377400 AGATCACAAGGTCAGGAGTTTGG + Intergenic
1052064692 9:24003459-24003481 ACACCTCTAGGTCAGGAGTTTGG + Intergenic
1052611597 9:30782431-30782453 CAACACGAACATCAGGAGTTGGG + Intergenic
1056069626 9:82972751-82972773 AAACCCCAGGTTCAGGAGATAGG + Intergenic
1058810999 9:108639403-108639425 AAACTCGAACGTCAGGATTCTGG - Intergenic
1059201694 9:112423528-112423550 GATCCCTGAGGTCAGGAGTTTGG - Intronic
1059249672 9:112877403-112877425 GGACCAGAAGGTAAGGAGTTGGG + Intronic
1061195957 9:129107252-129107274 AGATCACAAGGTCAGGAGTTCGG - Intronic
1061497479 9:130983209-130983231 TCACCCGAAGGACAGGGGTTGGG - Intergenic
1062117397 9:134816817-134816839 AAACCCGCAGGATGGGAGTTGGG + Intronic
1062756939 9:138304105-138304127 AACACCTAAGGTCAGGAGTTCGG - Intergenic
1187333551 X:18362402-18362424 AACACCTGAGGTCAGGAGTTCGG + Intergenic
1189913705 X:45836478-45836500 GAATCACAAGGTCAGGAGTTTGG + Intergenic
1190572082 X:51793222-51793244 ATCCCCTGAGGTCAGGAGTTCGG + Intergenic
1196836285 X:119817046-119817068 AAACCTGAAGGGCAGAAGTGTGG - Intergenic
1197887680 X:131235398-131235420 GAACCAGGAGCTCAGGAGTTAGG + Intergenic
1198362888 X:135913427-135913449 AAATCACAAGGTCAGGAGTTCGG + Intergenic
1199150251 X:144423966-144423988 ATTACCTAAGGTCAGGAGTTCGG - Intergenic
1202384053 Y:24307140-24307162 ATCACCTAAGGTCAGGAGTTCGG - Intergenic
1202486730 Y:25362980-25363002 ATCACCTAAGGTCAGGAGTTCGG + Intergenic