ID: 969215789

View in Genome Browser
Species Human (GRCh38)
Location 4:5721292-5721314
Sequence TGATATATGCAGACATTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 225}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969215784_969215789 24 Left 969215784 4:5721245-5721267 CCAAAATGTGGAAACAACCCAAA 0: 31
1: 381
2: 1471
3: 3257
4: 6038
Right 969215789 4:5721292-5721314 TGATATATGCAGACATTGGAAGG 0: 1
1: 0
2: 1
3: 14
4: 225
969215787_969215789 6 Left 969215787 4:5721263-5721285 CCAAATAGAAAAACTGGAAAAAT 0: 1
1: 1
2: 19
3: 120
4: 1201
Right 969215789 4:5721292-5721314 TGATATATGCAGACATTGGAAGG 0: 1
1: 0
2: 1
3: 14
4: 225
969215786_969215789 7 Left 969215786 4:5721262-5721284 CCCAAATAGAAAAACTGGAAAAA 0: 1
1: 0
2: 10
3: 182
4: 1570
Right 969215789 4:5721292-5721314 TGATATATGCAGACATTGGAAGG 0: 1
1: 0
2: 1
3: 14
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969215789 Original CRISPR TGATATATGCAGACATTGGA AGG Intronic
901872529 1:12146411-12146433 TGAATTCTGCAGACATAGGAAGG - Intergenic
903064007 1:20688427-20688449 TGATAAAAGCAGAGATGGGAAGG - Intronic
904268893 1:29335551-29335573 TGACCTATGCAGAGGTTGGAAGG + Intergenic
908230919 1:62104114-62104136 TTACATATGCAGAGATAGGAAGG + Intronic
909319210 1:74261785-74261807 TGATAAAAGCAGATATTGAATGG + Intronic
911255914 1:95633430-95633452 TGAGATATTGAGACATGGGAGGG + Intergenic
911346700 1:96705462-96705484 TGGCATATACAGACATTTGAGGG + Intergenic
911447849 1:98021203-98021225 AGATAAATGCAGATATTTGAGGG - Intergenic
911775660 1:101808634-101808656 TGATTAATACAGACATTGGAGGG + Intronic
911793289 1:102046076-102046098 GGCTATCTGCAGACATTGGGTGG - Intergenic
912275804 1:108256914-108256936 TGATAAATGCCTACATTGGCTGG - Intergenic
914202981 1:145502917-145502939 TGATATATGTATACACTGAATGG - Intergenic
914236911 1:145820851-145820873 TGATATATGTATACACTGAATGG - Intronic
914482103 1:148076068-148076090 TGATATATGTATACACTGAATGG - Intergenic
915866924 1:159511159-159511181 TGATATATGCAAAACTTGGATGG + Intergenic
917388614 1:174506667-174506689 TGATATATGCATACACTGTAAGG - Intronic
918318501 1:183343104-183343126 TGACATCTGCTGACATGGGAAGG - Intronic
918759549 1:188385582-188385604 TGATATATGTAAAAAATGGAAGG - Intergenic
919313921 1:195947921-195947943 TGAGGTATGCAGACAAGGGAAGG + Intergenic
920822427 1:209393443-209393465 GGTTATTTGCAGACAATGGAGGG + Intergenic
923076325 1:230611969-230611991 TGTTATCTGCAGACATTGTGTGG - Intergenic
924126459 1:240858111-240858133 TGGTATATTCATACAATGGAAGG - Intronic
924304076 1:242669023-242669045 AGATATATGTACACATTGGTTGG + Intergenic
924686373 1:246294914-246294936 TTATATATGAAGACATTTGTAGG - Intronic
1062951772 10:1508843-1508865 TGATTTTAGTAGACATTGGAAGG + Intronic
1063033514 10:2260847-2260869 TGTATTATGCAGCCATTGGATGG - Intergenic
1063284420 10:4669078-4669100 TGTAAGATGCAGACATTAGATGG - Intergenic
1063477491 10:6341773-6341795 TGATATATGTACACATTGTGGGG - Intergenic
1064559685 10:16583911-16583933 TGAAACAGGCAGAGATTGGAGGG - Intergenic
1064581079 10:16793637-16793659 TAAGATATGCAGTCACTGGATGG + Intronic
1066682835 10:37951447-37951469 TCATATATGTAGACATTTGCAGG + Exonic
1067731633 10:48817053-48817075 TAATATGTGCAGACGTTGTAAGG - Intronic
1068598483 10:58930445-58930467 TCATCAATGCAGACATTGTAAGG + Intergenic
1070227612 10:74526696-74526718 TTATAAATGGTGACATTGGAAGG + Intronic
1070422356 10:76249580-76249602 TCAAAGAGGCAGACATTGGAAGG + Intronic
1071547558 10:86539878-86539900 AGAAATCTCCAGACATTGGAAGG + Intergenic
1073614902 10:104983820-104983842 AGATATAGGCAGAGAATGGAGGG - Intronic
1073676490 10:105652994-105653016 TGGTATATGCAAACATTCTAAGG + Intergenic
1073938511 10:108664600-108664622 TGATATTTGCAGAAAATGGAAGG - Intergenic
1074567372 10:114592829-114592851 TGATATCTGCTGAAATTAGAAGG + Intronic
1075071063 10:119320145-119320167 TGATGTATACAGGGATTGGAGGG + Intronic
1075408066 10:122207775-122207797 TGATAACTGCTGACATTTGAAGG + Intronic
1075968006 10:126629538-126629560 TGACAGATGCAGACATCTGAAGG + Intronic
1079446615 11:20562774-20562796 TGATAGATAAGGACATTGGAAGG + Intergenic
1079782681 11:24627887-24627909 AAATATATGCACACATTGAAGGG - Intronic
1081790838 11:45783074-45783096 TGATATGTCCATACAATGGAAGG - Intergenic
1082143129 11:48632995-48633017 GAAAATATGCAGACATTGCATGG + Intergenic
1082570326 11:54730357-54730379 GAAAATATGCAGACATTGCATGG + Intergenic
1082953020 11:58838131-58838153 TGATGTATGCAGGTTTTGGAAGG - Intronic
1083196502 11:61091662-61091684 TGTAAAATGCAGAGATTGGATGG - Intergenic
1087692769 11:101340738-101340760 TCAGATATGCATACATTGGCAGG - Intergenic
1088053047 11:105541991-105542013 TGAAATAAGCTGACAATGGATGG + Intergenic
1089142619 11:116299167-116299189 AGATAAATGCAGAAATTGAAAGG - Intergenic
1090712431 11:129399751-129399773 TGATTTATGCAGACATTTCTAGG + Intronic
1091585612 12:1814639-1814661 TGAGGTGTGCAGACGTTGGATGG - Intronic
1091617882 12:2063549-2063571 TGATAAATGATGACATTGAAAGG + Intronic
1093670770 12:21872643-21872665 GGTGAGATGCAGACATTGGAAGG - Exonic
1093804830 12:23419208-23419230 TAAGATATTAAGACATTGGAGGG + Intergenic
1095147203 12:38745131-38745153 TGAGAAATGCAGACATAGAAAGG - Intronic
1095275520 12:40277974-40277996 TGATATTGGAAGACATTTGATGG - Exonic
1097232093 12:57519192-57519214 TGAAATAGGAAGTCATTGGAGGG - Intronic
1098424173 12:70340779-70340801 TGTTATATGAAGAGATTGTACGG - Intronic
1098814986 12:75148105-75148127 TGATATATGTATACATTGTAGGG - Intronic
1100128869 12:91465154-91465176 TGATTTGTGTAGACATTGGTTGG - Intergenic
1100825834 12:98473361-98473383 TGATGGAGGCAGAGATTGGAGGG + Intergenic
1100916800 12:99432948-99432970 TGAGATGGGAAGACATTGGAAGG + Intronic
1102733208 12:115132947-115132969 CGATACATGCAGACTTTGAAAGG + Intergenic
1104164077 12:126209590-126209612 TGATACATGTATACATTGTAGGG + Intergenic
1106142577 13:27023622-27023644 GGAGCTATGCAGATATTGGAGGG - Intergenic
1108403297 13:50071773-50071795 TGATATAAGCAGACCTTGAGAGG - Intergenic
1109700736 13:66021506-66021528 TGATGTGGGAAGACATTGGATGG - Intergenic
1109755896 13:66760147-66760169 TGATATATGCAGACTGCTGAAGG - Intronic
1111389289 13:87570677-87570699 TGAAATATGAGGACTTTGGAAGG - Intergenic
1113059260 13:106303604-106303626 TGCTATATGCATAGATTGCATGG - Intergenic
1117828734 14:59729325-59729347 TGAGATTAGAAGACATTGGAGGG + Intronic
1118473612 14:66097289-66097311 TGTTATGTGCAGAGATTGGGTGG - Intergenic
1119453411 14:74732633-74732655 TGATCTATGCAGAGATTTTAAGG - Intronic
1120253796 14:82092302-82092324 TAATATATGCAGAAATACGAAGG + Intergenic
1120587669 14:86334382-86334404 AGAATTTTGCAGACATTGGAGGG + Intergenic
1120648922 14:87107453-87107475 TGGTATATTCAGACATATGAAGG + Intergenic
1123954058 15:25315410-25315432 TGATAGAGGCAGAGATTGGAGGG - Intergenic
1125461624 15:39912716-39912738 TGACATATGCAGAAATTGTTTGG + Intronic
1127465020 15:59235406-59235428 TAATATATGCTGCCATTTGAGGG - Intronic
1134293964 16:12928370-12928392 TGTAAAATGCAGACAATGGATGG - Intronic
1135835164 16:25818860-25818882 TGATATCTGAAGACAGAGGATGG + Intronic
1139106720 16:63835372-63835394 TGATCTATGCAGAGCCTGGAGGG + Intergenic
1139822661 16:69732654-69732676 TGTCATATGCAGACATTGTTTGG + Intergenic
1140730929 16:77855493-77855515 GGACATATGCAGACAATGAAGGG - Intronic
1144362012 17:14504679-14504701 TGAGTTAGGAAGACATTGGAGGG + Intergenic
1145728484 17:27155148-27155170 TGAAATATCAAGACAATGGAAGG + Intergenic
1149062847 17:52444070-52444092 AGATATATGCAAACATAGAAAGG - Intergenic
1150944388 17:69728981-69729003 TGAAATTTGCAGACATGGAAAGG + Intergenic
1157118956 18:44890005-44890027 TGATATATGCATCCATGGTAAGG + Intronic
1158495907 18:57954964-57954986 TGAGATAATCAGTCATTGGATGG + Intergenic
1158770222 18:60507249-60507271 TGATATGTGCTGAAATTGGGAGG - Intergenic
1159949206 18:74467889-74467911 TGGTATATACAGACAACGGAAGG - Intergenic
1164049743 19:21574820-21574842 TCATATGTACATACATTGGAAGG + Intergenic
1164349264 19:27314483-27314505 GGATATTTGCAGCCCTTGGAGGG + Intergenic
1167346297 19:48947512-48947534 TGAGGTATGCAGACAACGGAAGG - Intergenic
1168637529 19:58008216-58008238 TAAGAGATGCAGACATCGGAGGG + Exonic
926540888 2:14179916-14179938 TGATATATGTAAAAATTGGAAGG + Intergenic
927265165 2:21138612-21138634 TGGTATATGCACACATTGATTGG + Exonic
927411295 2:22829350-22829372 TGAGATATGAAGACTCTGGATGG - Intergenic
928675749 2:33649375-33649397 TGATATATTTACATATTGGAAGG - Intergenic
929388884 2:41444639-41444661 TGTTATATGCATAAATAGGATGG + Intergenic
931760040 2:65408516-65408538 TTATACATACAGACATTGGAAGG - Intronic
937779279 2:125818894-125818916 TGACATATGCATACATAGGTAGG + Intergenic
938709571 2:133964536-133964558 TGACATATGGAGACTTTGGTAGG + Intergenic
940612159 2:156006109-156006131 TGAGATATGCAGACAAGTGAAGG + Intergenic
940663173 2:156573025-156573047 TGATACATGCTGACAGTGCAAGG + Intronic
941159398 2:162019018-162019040 TGATATTTCCAAACAATGGAAGG - Intronic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
942291707 2:174478955-174478977 TCATATATCTAGACGTTGGAAGG - Intronic
942688585 2:178560983-178561005 AGATAAATGCAGACATTGCAGGG - Exonic
942976487 2:182025026-182025048 TGTTATGTGCAGAGATTGGGTGG - Intronic
942977682 2:182038512-182038534 AGATATATGTAGGCATTGAATGG + Intronic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
944373928 2:199017900-199017922 TGAAATAGGAAGCCATTGGAAGG + Intergenic
944907640 2:204278672-204278694 TGATTTAGGCAGACATTTAATGG - Intergenic
945043015 2:205758170-205758192 AGAGATAGGCAGACCTTGGAAGG + Intronic
945647038 2:212510241-212510263 TGTTGTATGAATACATTGGATGG - Intronic
946085359 2:217165018-217165040 TGATATATGTTTACATTGCATGG - Intergenic
947420876 2:229940684-229940706 TGATGAAGGCAGAGATTGGAGGG + Intronic
1170004235 20:11647543-11647565 TGATGTATGCAGACAACTGAAGG - Intergenic
1174973053 20:55299539-55299561 TGATATATACAGTAATTGTATGG - Intergenic
1180958996 22:19754282-19754304 TGAGAGAGGCAGACATGGGATGG - Intergenic
1181331987 22:22099917-22099939 TGATTTATGCAGACAGAGTAGGG + Intergenic
1183518139 22:38279673-38279695 TTACAGATGAAGACATTGGAGGG - Intergenic
951838629 3:27009340-27009362 TGACATAAGCTGACATTGGCAGG + Intergenic
952016161 3:28959324-28959346 TGATAGCTGGAGACATTGGGAGG + Intergenic
952806174 3:37354896-37354918 TAATATGTGTAGACATTGTAAGG + Intronic
953604178 3:44398858-44398880 TGATACATGCAGCAACTGGATGG + Intronic
955240664 3:57175114-57175136 TGATATATGCATGCTTTTGAAGG - Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
960333911 3:116393058-116393080 TGATATATGCAGACAAGTGGAGG - Intronic
960556796 3:119039080-119039102 TGATACAGGAAGCCATTGGAAGG - Intronic
963501965 3:146138491-146138513 TGAGCTATGCAGATATTTGAGGG + Intronic
963584387 3:147165694-147165716 AGATATAGGCAGAGATTGTATGG - Intergenic
964335882 3:155653915-155653937 AGATATATGCAGACATGGAGTGG - Intronic
965957701 3:174390460-174390482 TGAAACAGGCAGAGATTGGAAGG - Intergenic
967199515 3:187059753-187059775 TGATATTTGCAGACATTGGTAGG + Intronic
969215789 4:5721292-5721314 TGATATATGCAGACATTGGAAGG + Intronic
969508761 4:7605188-7605210 TGGGATATGCAGACAATGGCTGG - Intronic
970385444 4:15551584-15551606 TGAAATATACAGTAATTGGAAGG - Intronic
970553587 4:17208999-17209021 TGAGAGATGGAGACATTTGAAGG - Intergenic
970809230 4:20072058-20072080 TGGTATATGCAGAGATTACATGG + Intergenic
971730649 4:30375335-30375357 TGATTTATGGAGAAATTGGGAGG + Intergenic
972863734 4:43204405-43204427 TGGTATTTGCAGACATTTTAAGG - Intergenic
973170563 4:47137859-47137881 TTATATATACATATATTGGATGG - Intronic
973566796 4:52197090-52197112 AGATATAAGCAGACATTGTAGGG + Intergenic
973696367 4:53494701-53494723 GGTTAGATGCAGAAATTGGAGGG - Intronic
973956513 4:56068448-56068470 TGAGACAGGCAGACTTTGGAGGG + Intergenic
975913727 4:79298235-79298257 TGAGATATGCAGACAAGTGAAGG - Intronic
976008222 4:80456276-80456298 TGAGATATGAAGACATTAGAGGG + Intronic
976474967 4:85473579-85473601 TGAAATTTGCACACATTTGATGG - Intergenic
976533630 4:86185492-86185514 TGAGATAGGAAGACATTGAAAGG + Intronic
977641512 4:99362626-99362648 TCATATATGTGGCCATTGGAGGG + Intergenic
978542742 4:109836440-109836462 TGAAATGTGCAAATATTGGAAGG - Intronic
979104150 4:116663490-116663512 TGGTATGTCCAGACAATGGAAGG - Intergenic
979587174 4:122434046-122434068 TGGTATATGCAGAAGTGGGAGGG - Intergenic
980249055 4:130290570-130290592 TCAAATATGCAGAGATTGTAGGG + Intergenic
981239362 4:142457671-142457693 TGAGAGATCCATACATTGGAAGG - Intronic
981693823 4:147539075-147539097 TGAAACATGCTGACCTTGGACGG - Intronic
981878000 4:149572082-149572104 TGATATATGATGACCCTGGATGG + Intergenic
983917156 4:173304477-173304499 TGATATATGTATACATTGTGGGG + Intronic
989577430 5:43001156-43001178 TGTCTTATGCAGAGATTGGAGGG + Intergenic
989581216 5:43034782-43034804 TGTCTTATGCAGAGATTGGAGGG + Intergenic
992513335 5:77463744-77463766 TGATGGATGAAGACACTGGATGG - Intronic
993199597 5:84797222-84797244 AGACATATGCAGACATTTGTAGG + Intergenic
995983745 5:118142493-118142515 TGATATTTGAAGGCATTAGAAGG - Intergenic
997001363 5:129766069-129766091 AGGTATCTGCAGACAATGGAAGG - Exonic
997275494 5:132584027-132584049 TAATACATGCATACAATGGAAGG - Intronic
998739155 5:145179067-145179089 TGATAGATGCAGAAATTTCAAGG + Intergenic
999255601 5:150208515-150208537 TGAGATGTGCAGCCATTGGCAGG + Intronic
1000849028 5:166317518-166317540 TGATATCTTCAGAAATTGTATGG + Intergenic
1001191154 5:169632554-169632576 TGAAATATGGAGACATTGATGGG + Intergenic
1001307700 5:170587643-170587665 TGACAGAAGCAGAGATTGGAGGG - Intronic
1003615136 6:7648324-7648346 TGATATAAGCCATCATTGGAAGG - Intergenic
1005043431 6:21620126-21620148 TGAGATATGCAGACAACTGAAGG + Intergenic
1005734103 6:28729568-28729590 TGAAACAAGCAGACATTGAAAGG + Intergenic
1005775903 6:29130439-29130461 TGAGATATGCAGAAAGTGGAGGG - Intergenic
1008366426 6:50686166-50686188 TTCTATTTGTAGACATTGGAAGG + Intergenic
1009532497 6:64837951-64837973 TGTTATATGCATATATTGCAAGG - Intronic
1009918482 6:70026250-70026272 TGATACATGCATATATTTGAGGG + Intronic
1010011028 6:71048557-71048579 TCCAAAATGCAGACATTGGAAGG - Intergenic
1010386541 6:75286632-75286654 TGATATAGGCAGAAATGGGGAGG - Intergenic
1010471529 6:76233958-76233980 AGACATATTCAAACATTGGAGGG - Intergenic
1011229003 6:85138911-85138933 TGATAGTTGCAGCCATAGGATGG - Intergenic
1012011800 6:93797388-93797410 TGATACATGTATACATTGTAGGG - Intergenic
1012088299 6:94857947-94857969 TGATAAATGCAAACATTGGTTGG - Intergenic
1012497898 6:99854969-99854991 TGATATATAGAGAGAATGGATGG + Intergenic
1013445150 6:110217917-110217939 TGATATTTGCTGACAGTGAATGG - Intronic
1014512631 6:122343171-122343193 AAATAAATGCAGACATTTGATGG + Intergenic
1016089365 6:139957071-139957093 TTCTATATTCAGAAATTGGATGG + Intergenic
1016327630 6:142921180-142921202 TTATAGATGAAAACATTGGAAGG - Intronic
1016742666 6:147544603-147544625 TCATTTATGCTGACATTGCAGGG + Intronic
1018252709 6:161888245-161888267 TGTCATATGCTGATATTGGAGGG - Intronic
1018810836 6:167296690-167296712 TGACAGATGTGGACATTGGATGG + Intronic
1020344443 7:7147985-7148007 TGAGATGAGGAGACATTGGAGGG - Intergenic
1021289674 7:18827491-18827513 TGTTCTATGCTGACAATGGAGGG - Intronic
1022235912 7:28460073-28460095 AGATGTATGAAGACATTCGATGG + Intronic
1023071537 7:36439756-36439778 TGACACATGCAGACAGTGGAAGG + Intronic
1023251727 7:38270458-38270480 TAATATATGCAGTCAGTGTATGG + Intergenic
1023571130 7:41573073-41573095 TGAAAAATGCAGAGATTGAAAGG - Intergenic
1023799237 7:43819079-43819101 TGATATTTGCAGAAAGAGGAGGG + Intergenic
1027600003 7:80228243-80228265 GGACAGATGCAGAGATTGGAGGG - Intergenic
1028025833 7:85837520-85837542 TGATATATGGAAACATAGAAAGG + Intergenic
1029558421 7:101286476-101286498 AGAGATAAGCAGACATTTGAAGG - Intergenic
1031109372 7:117587646-117587668 TGATATATGATTACATTAGAAGG + Intronic
1031427093 7:121618075-121618097 GAATGTATGCAGACATTTGAAGG - Intergenic
1034915076 7:155031963-155031985 TGGTATATCCATACAATGGAAGG + Intergenic
1037658355 8:20906522-20906544 TATTAGATGCAGGCATTGGAGGG + Intergenic
1037992206 8:23328972-23328994 TGGAATCTGCAGACTTTGGAGGG - Intronic
1038661480 8:29501159-29501181 TGGTATTTGCAGACTTTAGAAGG + Intergenic
1042336522 8:67635406-67635428 TGAGAAATGCACATATTGGATGG + Intronic
1044334818 8:90968678-90968700 ATATATATGCACACACTGGAAGG + Intronic
1044708698 8:95033943-95033965 TGAGATAGGCAGCCACTGGAGGG + Intronic
1046457651 8:114487996-114488018 TGACATTTGCAGCAATTGGATGG + Intergenic
1046533445 8:115476925-115476947 TGAGAAATGCAGACATACGAAGG - Intronic
1046665494 8:116998030-116998052 TGATCTAAGCAGAGATTGTAAGG + Intronic
1046817754 8:118603838-118603860 TAATATATGAATATATTGGAAGG + Intronic
1047011903 8:120681685-120681707 TGATATTTGCAGAATTGGGAAGG + Intronic
1048524984 8:135194318-135194340 TGATATCTGGAGCCATGGGAGGG - Intergenic
1049756867 8:144314654-144314676 AGATATATACACACAGTGGATGG + Exonic
1050759235 9:9045834-9045856 TGAGATATGCAGACTTTTTAGGG + Intronic
1050842170 9:10164847-10164869 TGAGATATGCTGAGCTTGGAAGG + Intronic
1053360544 9:37483587-37483609 TGATATAGGAACACATTGTATGG - Intergenic
1053897025 9:42753112-42753134 TGAGGTATGCAGACAAAGGAAGG + Intergenic
1057237167 9:93370915-93370937 TGAAATTTGAAGCCATTGGAGGG - Intergenic
1057514429 9:95709511-95709533 TGATATATGCCCACTGTGGAAGG - Intergenic
1058846622 9:108966804-108966826 TAATATAGGCAGAAAATGGATGG + Intronic
1058978151 9:110144015-110144037 TGATATTTGCAGATAATGAAGGG - Intronic
1060364054 9:122990970-122990992 AGTTATCTGCATACATTGGAAGG + Intronic
1190474835 X:50815548-50815570 TCATATATGCAGACAGTCCAGGG - Intergenic
1190662324 X:52666192-52666214 TGAAAAATGCAGACATTCGGGGG + Intronic
1192698652 X:73445353-73445375 TGAGATAGGGAGACATTGTAGGG - Intergenic
1196013663 X:110914972-110914994 TGATATTTGAAGAAATTGCAGGG - Intergenic
1197582966 X:128308508-128308530 TAGTTGATGCAGACATTGGAAGG - Intergenic
1199107566 X:143888693-143888715 TGATACATGGACACATTGCATGG + Intergenic
1199908273 X:152258114-152258136 TGTTATATGAAGTCCTTGGAGGG - Intronic
1201053971 Y:9969737-9969759 TGATATTTGGAGACTTTGAAAGG - Intergenic