ID: 969217645

View in Genome Browser
Species Human (GRCh38)
Location 4:5734998-5735020
Sequence CTGTGGACACTCGCTGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969217645_969217652 1 Left 969217645 4:5734998-5735020 CCACAGCCAGCGAGTGTCCACAG 0: 1
1: 0
2: 1
3: 9
4: 159
Right 969217652 4:5735022-5735044 GAGCAGCTTACAGTCCTGGAGGG 0: 1
1: 0
2: 2
3: 25
4: 178
969217645_969217650 -3 Left 969217645 4:5734998-5735020 CCACAGCCAGCGAGTGTCCACAG 0: 1
1: 0
2: 1
3: 9
4: 159
Right 969217650 4:5735018-5735040 CAGGGAGCAGCTTACAGTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 199
969217645_969217651 0 Left 969217645 4:5734998-5735020 CCACAGCCAGCGAGTGTCCACAG 0: 1
1: 0
2: 1
3: 9
4: 159
Right 969217651 4:5735021-5735043 GGAGCAGCTTACAGTCCTGGAGG 0: 1
1: 0
2: 2
3: 20
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969217645 Original CRISPR CTGTGGACACTCGCTGGCTG TGG (reversed) Intronic
900255785 1:1697722-1697744 CTGAGGAGACACCCTGGCTGTGG + Intronic
900264456 1:1750332-1750354 CTGAGGAGACACCCTGGCTGTGG + Intergenic
903301825 1:22384626-22384648 CTTTGGACACTGGCTCCCTGGGG + Intergenic
904206853 1:28861155-28861177 CTGTGGACCCACTCTGTCTGTGG + Intronic
905172950 1:36119745-36119767 CTGTGGACACTGGACGGGTGTGG + Intronic
905447207 1:38035031-38035053 CTGTGGACACTGCCTGCTTGAGG + Intergenic
905882549 1:41474212-41474234 CTGGGGACACTGGCTGGATGGGG - Intergenic
906193307 1:43913017-43913039 ATGTGGACACTTGCAGGCAGAGG + Intronic
909340326 1:74524402-74524424 CTGTGGAGTTTCACTGGCTGTGG + Intronic
916737108 1:167617767-167617789 CTGTTGACACTCACTTCCTGAGG + Intergenic
920310254 1:205044278-205044300 CTCTGGACACTCACTGGCTGGGG - Intronic
920557064 1:206911863-206911885 CTCTGGACACTCGAGGGCGGTGG + Exonic
922184319 1:223260562-223260584 CTGTGGGCCCTGGCTTGCTGTGG - Intronic
924054633 1:240113242-240113264 CTGTGCAAACTGGCTGGCTGGGG - Intronic
1063522074 10:6750187-6750209 GTGTGGACAGATGCTGGCTGAGG - Intergenic
1064188514 10:13185085-13185107 CTGTGGAGTCTCGCTGCCTAAGG - Intronic
1064768289 10:18697171-18697193 CTGTGGCTCCTCACTGGCTGTGG - Intergenic
1067056696 10:43056729-43056751 CTGTGCACACCCGGTAGCTGTGG + Intergenic
1067056750 10:43056964-43056986 CTGTGCACACCCAGTGGCTGTGG + Intergenic
1070916941 10:80161072-80161094 CTGTGCAGAATCCCTGGCTGTGG - Intronic
1071523668 10:86346119-86346141 CTATGGCCACTAGCTGGGTGTGG - Intronic
1071888490 10:89976999-89977021 GTGTGTACAATCACTGGCTGTGG + Intergenic
1075658027 10:124174624-124174646 CTGGGGACACTGGGTGCCTGAGG - Intergenic
1075907830 10:126097640-126097662 CTGAGGATACTCCCTGTCTGAGG + Intronic
1075921277 10:126215340-126215362 CTGTGGCCTCTCCCTGGCTCTGG + Intronic
1077235155 11:1478414-1478436 CTTTGGACACTGACTGGATGTGG + Intronic
1085863698 11:80263035-80263057 CTCTGGAAACTCTGTGGCTGGGG - Intergenic
1093896821 12:24583697-24583719 CTGTGGACACTTGCTCAGTGGGG + Intergenic
1096514938 12:52150540-52150562 CTGGGGACACAGGCTGGCAGGGG - Intergenic
1096671499 12:53201133-53201155 CTGCAGTCACTCACTGGCTGTGG + Exonic
1096975805 12:55698729-55698751 CTTTGGCTACTCACTGGCTGTGG - Exonic
1101199655 12:102421262-102421284 CTGTGGACTCCCAATGGCTGTGG + Intronic
1102298231 12:111753535-111753557 CTGTGGGCTGTGGCTGGCTGTGG + Intronic
1103440529 12:120959513-120959535 CGCTGGACACTGGCTGGCAGTGG + Intergenic
1103743956 12:123109625-123109647 CTCTGGCTACTCGCTGGCTTTGG - Intronic
1104378201 12:128283867-128283889 CAGTGGAGACTCAGTGGCTGAGG - Intronic
1105254141 13:18729486-18729508 CTGAGGACATTTGCTGGATGTGG + Intergenic
1107396613 13:40024706-40024728 CTGTGAAGGCTGGCTGGCTGTGG - Intergenic
1112576720 13:100642789-100642811 CTGTGGACACCAGGTGGCTTAGG + Intronic
1113764950 13:112875278-112875300 CTGTGGGCTCGGGCTGGCTGCGG + Intronic
1118609998 14:67532873-67532895 CGGGGGACCCTCGCGGGCTGCGG - Intronic
1118767962 14:68922602-68922624 CTGTGCACACTGGCTGGAAGGGG + Intronic
1119039451 14:71259663-71259685 CTGTGCTCAATCACTGGCTGGGG + Intergenic
1119879544 14:78089650-78089672 CAGTGGAGACAAGCTGGCTGAGG - Intergenic
1121666759 14:95678118-95678140 CTGTGGAAACTGACTGGCTAGGG + Intergenic
1122363708 14:101182276-101182298 CTCTGGACACTCTCTGGCCTTGG - Intergenic
1122974412 14:105165211-105165233 CAGGGGACACCTGCTGGCTGAGG - Intronic
1123037941 14:105478901-105478923 TTGTGGGCACGCGCGGGCTGGGG + Intronic
1123794945 15:23762043-23762065 CTGTTGCCACTCACTGGCAGGGG + Intergenic
1126921237 15:53527403-53527425 CAGTGGCCACTCTCTTGCTGGGG - Intronic
1129273545 15:74431870-74431892 CTGTTGAGCCCCGCTGGCTGGGG - Intronic
1131472380 15:92708443-92708465 CTGTGGAGACTGGGTGGGTGGGG - Intronic
1132134745 15:99324487-99324509 CTGTGGTCACTAGCTTGGTGTGG + Intronic
1132375518 15:101325936-101325958 CTCTGGACTCTGGCTGGGTGTGG - Intronic
1132533637 16:466599-466621 CTGTGGACTGTGGCTGCCTGTGG + Intronic
1132737993 16:1396960-1396982 GTGGAGAGACTCGCTGGCTGAGG + Intronic
1133125980 16:3646272-3646294 CTGTGTCCAGTGGCTGGCTGTGG + Intronic
1138070215 16:53985420-53985442 CTGTGGCAATTCCCTGGCTGAGG - Intronic
1138154181 16:54687178-54687200 CTGCGAACACTCACTGGCTAAGG + Intergenic
1140574698 16:76153091-76153113 ATGTTGACACTAGCTAGCTGAGG + Intergenic
1140829770 16:78740428-78740450 CTTTGGACCCCGGCTGGCTGCGG + Intronic
1141185804 16:81786181-81786203 CTGTGAGTACTCGCTGGGTGGGG + Exonic
1142014216 16:87735399-87735421 CTGTGTTCCCTCGCTGGTTGGGG - Intronic
1142979458 17:3663316-3663338 GTGTGGACACACGAGGGCTGGGG + Exonic
1145020875 17:19429698-19429720 GTGTGGACACTTGGAGGCTGTGG - Intergenic
1147872432 17:43597047-43597069 CTTTGAACCCTCTCTGGCTGGGG - Intergenic
1149984662 17:61338164-61338186 CTGTGGCCAGTCTCTGGCGGGGG + Intronic
1150984038 17:70175266-70175288 GTGTGGACATTCGCTGGCGGTGG + Exonic
1152561470 17:81080991-81081013 GTGTGGACACTCCGGGGCTGAGG + Intronic
1152600541 17:81260058-81260080 CTGTGCACCATGGCTGGCTGTGG - Intronic
1155597389 18:27503164-27503186 CTGTATACACTCCCTGGCTATGG - Intergenic
1157262927 18:46192281-46192303 ATGTGGACTCTGGCTGGGTGAGG + Intronic
1159958779 18:74539525-74539547 GTGGGGAAACTCCCTGGCTGTGG - Intronic
1161001279 19:1912436-1912458 CTGTGGACCCCCGCGGCCTGGGG + Exonic
1161008794 19:1950011-1950033 CTGTGGACACTGGATGCCTCCGG - Intronic
1162137840 19:8567014-8567036 CTTTCAACACACGCTGGCTGAGG + Intronic
1163690777 19:18737085-18737107 CTGTGGACACTTCCTGGGCGGGG + Intronic
1167035429 19:46992571-46992593 CTGTGGACACCAGCTGGACGGGG - Intronic
926246259 2:11124003-11124025 CTGAGCTCACCCGCTGGCTGCGG - Intergenic
928681624 2:33708588-33708610 CTGTGGCCAGTCACTGGATGTGG + Intergenic
930937436 2:56970728-56970750 CTGAGGGCACGTGCTGGCTGGGG - Intergenic
936010303 2:108921223-108921245 CTGTGGGCACTCCTAGGCTGGGG + Intronic
938088185 2:128415417-128415439 CTGTTGAGCCTCCCTGGCTGTGG + Intergenic
938217083 2:129527033-129527055 CTGTAACCACTCCCTGGCTGTGG - Intergenic
939096253 2:137836811-137836833 CTGTGCACACTCCTAGGCTGGGG - Intergenic
942252856 2:174062482-174062504 CTGAGCACACTCGCTGTCTATGG + Intergenic
945252424 2:207775699-207775721 ATGTGCACACTTGCTGGCTCAGG + Intergenic
947527444 2:230887067-230887089 CTGTGGGCACTCGCTCAGTGTGG - Intergenic
947722995 2:232380583-232380605 CTGTGGTGACTGGCAGGCTGGGG - Intronic
947727345 2:232408664-232408686 CTGTGGTGACTGGCAGGCTGGGG - Intronic
948166052 2:235863583-235863605 CAGGGGACAGACGCTGGCTGGGG + Intronic
948180898 2:235979260-235979282 ATGTGCACTCTAGCTGGCTGTGG - Intronic
948668208 2:239549479-239549501 CTGTGGACGCATGCTGGGTGGGG + Intergenic
1172600078 20:36177413-36177435 CTGTGAAACCTCACTGGCTGTGG + Intronic
1173186555 20:40844679-40844701 CTGGGGACATTCGCTTCCTGTGG - Intergenic
1175385387 20:58591674-58591696 CTGTGGACACTAGCAGGGTCTGG - Intergenic
1175944382 20:62551881-62551903 CTGTGGACTCTGGCTGGGTCTGG + Intronic
1178265992 21:31143024-31143046 CAGTGGACACACGCTGCCTCTGG + Intronic
1179522364 21:41953709-41953731 CTCAGGACACGCGCTGGCTGCGG + Exonic
1180005054 21:45016817-45016839 ATGTGGACCCTCCCTGGCTGAGG - Intergenic
1180022432 21:45136770-45136792 CTGTGGACACCAGCTGGGGGCGG - Intronic
1180223643 21:46376043-46376065 GTGTTGGCACTCCCTGGCTGGGG + Intronic
1181235400 22:21445375-21445397 CCGTGGACAGCCGCTGGCTGCGG - Exonic
1183019016 22:35012468-35012490 CTGTGAACACTGGGTGTCTGGGG + Intergenic
1183280885 22:36931794-36931816 CTTTGGCCACTATCTGGCTGGGG + Intronic
950256379 3:11510095-11510117 CTGCAGACACCAGCTGGCTGGGG - Intronic
952840796 3:37643676-37643698 CGGTGGACAGTGTCTGGCTGGGG + Intronic
952990081 3:38824061-38824083 CTGTGGGCACATGCTGCCTGTGG + Intergenic
953909711 3:46885682-46885704 CACTGGACACTCCCTGGCTTCGG + Intronic
954320501 3:49829370-49829392 CTGTTGGCACTGGCAGGCTGGGG + Intronic
955064362 3:55521839-55521861 CTGTTGACACACGCTGGCCTGGG + Intronic
957674547 3:83349819-83349841 ATTTGGACACTCGGAGGCTGTGG - Intergenic
960579229 3:119260183-119260205 CTGTGGTGACTCAGTGGCTGGGG - Intergenic
961107324 3:124253207-124253229 ATGTGGAGAGTCTCTGGCTGTGG - Intronic
961447319 3:126986949-126986971 CTGTGCAAACTGGCTGGCTGAGG + Intergenic
968435108 4:580895-580917 CTCTGAGAACTCGCTGGCTGTGG - Intergenic
969217645 4:5734998-5735020 CTGTGGACACTCGCTGGCTGTGG - Intronic
981042272 4:140234173-140234195 CTCTGACCACTTGCTGGCTGAGG - Intergenic
981818745 4:148861807-148861829 CTGTGGAGGCTCGCTGGTTAGGG + Intergenic
984712622 4:182898280-182898302 TTGTCCACACTCGCTGGCAGAGG - Intronic
985773355 5:1826697-1826719 CTGTGGACACTGGCTCGTGGTGG - Intergenic
989726269 5:44590053-44590075 GTGTAGACAGTCACTGGCTGTGG + Intergenic
992067437 5:73120639-73120661 CTGTGGGCACTGGCTGGGCGCGG - Exonic
992151778 5:73911503-73911525 CTGTGGACAGCCGCTGGTTCCGG + Exonic
998461223 5:142311520-142311542 CTGTGGACCCTCCCCGGCTCTGG - Exonic
1001436431 5:171703004-171703026 CTTTGGACACTGGCAGGCTTAGG + Intergenic
1002389687 5:178900293-178900315 ACGAGGACACTGGCTGGCTGGGG - Intronic
1002389709 5:178900387-178900409 ACGAGGACACTGGCTGGCTGGGG - Intronic
1002389721 5:178900434-178900456 ACGAGGACACTGGCTGGCTGGGG - Intronic
1002389744 5:178900528-178900550 ACGAGGACACTGGCTGGCTGGGG - Intronic
1002453166 5:179331171-179331193 CTGGGGACCCTTCCTGGCTGGGG - Intronic
1006365673 6:33613812-33613834 CTGTACACTCTCCCTGGCTGTGG + Intergenic
1006525136 6:34597835-34597857 CTGTGAACACACCCTGCCTGTGG + Intronic
1007174060 6:39884430-39884452 CTGTGGACCCTTGCTGTCTTTGG + Intronic
1008485220 6:52028198-52028220 CTGTGGAGACCAGCTGGCAGTGG + Exonic
1016902723 6:149118014-149118036 CTGTGGATACCAGCTGTCTGGGG - Intergenic
1018215891 6:161527536-161527558 CTGTGGCCTCTCTCTGCCTGAGG + Intronic
1019580281 7:1758545-1758567 GGGTGGAGACTAGCTGGCTGAGG + Intergenic
1019580314 7:1758652-1758674 GGGTGGAGACTGGCTGGCTGAGG + Intergenic
1019666264 7:2253648-2253670 CTGTGCTGACTCGGTGGCTGTGG - Exonic
1019732358 7:2635032-2635054 CTCTCGACAGTCACTGGCTGGGG - Intronic
1021850548 7:24804044-24804066 CTCTGCAAACTCACTGGCTGAGG + Intronic
1023098430 7:36687648-36687670 GAGTGGACACTTGCTGGCAGAGG + Intronic
1027151171 7:75734721-75734743 CAGTGGAGACTCATTGGCTGGGG - Intronic
1030820754 7:114087747-114087769 GTGTGGACCCTCACTTGCTGTGG + Intronic
1034366349 7:150551783-150551805 GTGTGCACACTCTTTGGCTGTGG - Intergenic
1036592918 8:10185182-10185204 CTGTGGACAATTGGTGACTGAGG + Intronic
1036595164 8:10205333-10205355 AGGGGGACAGTCGCTGGCTGTGG + Intronic
1037492485 8:19409251-19409273 CTGTTAACTCTCGCTTGCTGAGG + Intronic
1037756573 8:21713949-21713971 CTGTGGGCTTTCTCTGGCTGTGG - Intronic
1037813259 8:22098834-22098856 CTGTGGAACCTCTGTGGCTGGGG - Intronic
1040960301 8:53024792-53024814 CTTAGGACCCTAGCTGGCTGTGG + Intergenic
1041047743 8:53903460-53903482 CTGTGGAAGGTGGCTGGCTGGGG - Intronic
1045790034 8:105972860-105972882 CTATGTACACTCACTGGCTTAGG + Intergenic
1048251395 8:132869420-132869442 CTGAGGACACTTGGTGGATGTGG + Intronic
1053285703 9:36848333-36848355 GTGTGGACACGCTCTGCCTGTGG - Intronic
1056841239 9:89999584-89999606 CTGTGCACAGGAGCTGGCTGAGG + Intergenic
1056949740 9:91032557-91032579 CTGTGGTCACTTGCAGCCTGGGG + Intergenic
1058703449 9:107619889-107619911 CTGTGGCCAAGCACTGGCTGTGG + Intergenic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1061986481 9:134133000-134133022 AAGTGGACACTGGCTGGTTGGGG + Intergenic
1062276252 9:135732912-135732934 CTTTGGTCACTGTCTGGCTGGGG - Intronic
1062488238 9:136791620-136791642 CTCTGGGCACACCCTGGCTGTGG - Intronic
1062617623 9:137405134-137405156 CTTTGGACACCCGCTGGCAGAGG - Intronic
1185508985 X:648684-648706 CTGTGGACACTGGCTGCCTTTGG + Intronic
1186512355 X:10139277-10139299 CTGTCACCACTCGCTGACTGTGG + Intronic
1192504250 X:71671302-71671324 CTGTGGGCTCACCCTGGCTGGGG + Intergenic
1194475192 X:94349557-94349579 CTGAGGACATTCTCTGGCTTTGG + Intergenic
1195289032 X:103413998-103414020 GTGTGCACAGTCACTGGCTGGGG - Intergenic
1197701212 X:129601311-129601333 CTGTGGCCACTAGATGGCAGAGG + Intergenic