ID: 969218466

View in Genome Browser
Species Human (GRCh38)
Location 4:5743014-5743036
Sequence GGGCAGTTCATTGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 6, 3: 23, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969218463_969218466 3 Left 969218463 4:5742988-5743010 CCACTTTCAATTACATGCAAATG 0: 2
1: 27
2: 111
3: 235
4: 534
Right 969218466 4:5743014-5743036 GGGCAGTTCATTGCAAATTGAGG 0: 1
1: 0
2: 6
3: 23
4: 117
969218462_969218466 4 Left 969218462 4:5742987-5743009 CCCACTTTCAATTACATGCAAAT 0: 26
1: 115
2: 189
3: 287
4: 465
Right 969218466 4:5743014-5743036 GGGCAGTTCATTGCAAATTGAGG 0: 1
1: 0
2: 6
3: 23
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969218466 Original CRISPR GGGCAGTTCATTGCAAATTG AGG Intronic
901760434 1:11467694-11467716 GGGTAGTTCTTTGGAAATTGAGG + Intergenic
905012324 1:34755728-34755750 AGGCAGCTCATTGAAACTTGAGG + Intronic
906110218 1:43317606-43317628 TGGAAGTTCTGTGCAAATTGGGG + Exonic
906726714 1:48049573-48049595 GGGAAGTTCACTTCAACTTGGGG + Intergenic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
911122332 1:94308981-94309003 AGGCAGTCCAGTGCAAATTCGGG - Intergenic
913017749 1:114757005-114757027 AGGCCGTTCATTGCACAATGTGG + Intronic
919345250 1:196367874-196367896 GGGCAGATTATTGCCAACTGAGG - Intronic
920636741 1:207711584-207711606 GGGCACATCAATGCAAATTGAGG - Intronic
921693031 1:218174791-218174813 GGTAGGTTCATTGCATATTGAGG + Intergenic
922968607 1:229715315-229715337 GGACAGGTTAATGCAAATTGAGG - Intergenic
1064800469 10:19064954-19064976 GAGCAGATTAATGCAAATTGAGG + Intronic
1067811012 10:49427263-49427285 AGGCATGTCATTTCAAATTGTGG - Intergenic
1069036162 10:63648205-63648227 GGGTAGTTCATTTCTAAATGAGG + Intergenic
1072631949 10:97152282-97152304 GGGAAGGTCCCTGCAAATTGAGG + Intronic
1073134974 10:101215448-101215470 GGGCAGTTCCTCGAAACTTGGGG - Intergenic
1074409857 10:113218646-113218668 TGGCTGAGCATTGCAAATTGTGG + Intergenic
1079377622 11:19907864-19907886 GGGCAGCAAGTTGCAAATTGTGG - Intronic
1079481472 11:20885179-20885201 GGGCAGTTCATTGCTCAGAGTGG + Intronic
1080463195 11:32473562-32473584 GGGCAGGTCAATGCAAACTGAGG - Intergenic
1081812004 11:45919387-45919409 GAACAGTTCATAGCAACTTGGGG - Intergenic
1085184589 11:74564817-74564839 GGGCAGTCCCTGGCAGATTGTGG - Intronic
1086113330 11:83221661-83221683 GTGTAGCTCATTCCAAATTGGGG + Intronic
1093807697 12:23454911-23454933 GGGCAGTTCATGGCAAAAAGTGG - Intergenic
1094864865 12:34520490-34520512 GGACATTTGATTGCACATTGAGG - Intergenic
1095048761 12:37538696-37538718 GGACATTTCAGAGCAAATTGAGG - Intergenic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1096709524 12:53444982-53445004 GGGCAGTTAAATGTAAATGGAGG - Intronic
1099264149 12:80423316-80423338 TGGCACTTCATTGGAAAATGGGG - Intronic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1104785327 12:131444875-131444897 GGGGAGCTCACTGCAAGTTGAGG - Intergenic
1105983534 13:25543511-25543533 AGGCAGTTCTTTCCAAATTTAGG - Intronic
1108740568 13:53333351-53333373 GCACAGTGCATTGCACATTGAGG + Intergenic
1109761408 13:66834649-66834671 TGCCAATTCATTGCACATTGGGG + Intronic
1110497055 13:76180350-76180372 GGGCAGATTAATGCAAATTGAGG - Intergenic
1111179599 13:84645781-84645803 GGGTGGATCAATGCAAATTGAGG + Intergenic
1112582487 13:100688435-100688457 GGGCAGATTAATGCACATTGGGG + Intergenic
1114850634 14:26378839-26378861 GAACAGGTCAGTGCAAATTGAGG + Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1117872375 14:60214433-60214455 GGGCAGTGCTTTTCAAACTGTGG + Intergenic
1119710031 14:76814896-76814918 GGGCTGTTCAGTGCACAGTGTGG + Intronic
1121513993 14:94536843-94536865 GGGCAGTTTAGTGCAAATTGAGG + Intergenic
1123835205 15:24182977-24182999 GGGCAAGTCAAGGCAAATTGAGG + Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG + Intergenic
1127158710 15:56157032-56157054 GGGCAGTTCCTTGAACATTGTGG - Intronic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1130156615 15:81356310-81356332 GGGCAGTTGTTTCCAAAGTGAGG - Intronic
1134888934 16:17821186-17821208 GGGCAGTTTATAGGAAAATGTGG - Intergenic
1137327790 16:47459823-47459845 TGGCAGTACACTGCAAAATGAGG + Intronic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1139102900 16:63789611-63789633 GGGATGATCAATGCAAATTGTGG + Intergenic
1140751834 16:78031479-78031501 TGTCATTTCATTTCAAATTGCGG - Exonic
1145412208 17:22677769-22677791 GGACATTTCAGAGCAAATTGAGG - Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1147893685 17:43736140-43736162 GGGCAGTGCCTCTCAAATTGTGG - Intergenic
1149024610 17:52012045-52012067 GCTCAGTTCATGGCATATTGGGG - Intronic
1152384823 17:79966108-79966130 GGGCAGTTCCTGGCAATCTGTGG + Intronic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1162358103 19:10199711-10199733 GAGCAATTCATAGCAAATGGAGG - Intronic
1168087174 19:54056714-54056736 GGTCAGTTAATAGAAAATTGGGG - Intronic
926236588 2:11050073-11050095 GTGCTGTTCAGTGCAGATTGTGG - Intergenic
927219774 2:20696241-20696263 GTGCAGTTGTTTGCAGATTGGGG - Intronic
930903092 2:56532038-56532060 GGGCACATCAGTACAAATTGAGG + Intergenic
931087698 2:58851743-58851765 TGACATTTCATTGAAAATTGGGG - Intergenic
931965433 2:67528671-67528693 GTGCAGGTTAATGCAAATTGAGG - Intergenic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
937415355 2:121710340-121710362 GTGCAGTTGATTGCCAAGTGTGG + Intergenic
944293317 2:198033345-198033367 GGGCAATTCTTTGGAAAATGTGG - Intronic
945431498 2:209771260-209771282 TATCAGTTAATTGCAAATTGAGG - Intergenic
946269110 2:218575198-218575220 ATGTAGTTCCTTGCAAATTGAGG + Intronic
1169035415 20:2447151-2447173 GGGCAGGTTGATGCAAATTGAGG - Intergenic
1170676795 20:18489560-18489582 TGGTAGTTCATAGCAATTTGGGG + Exonic
1171325011 20:24283460-24283482 GGGCAGGTCAATACAAATTAAGG + Intergenic
1171543279 20:25982174-25982196 GGACATTTCAGAGCAAATTGAGG - Intergenic
1171846332 20:30278793-30278815 GGACATTTCAGAGCAAATTGAGG - Intergenic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1173308103 20:41871170-41871192 GAACAGGTCAATGCAAATTGAGG - Intergenic
1173775558 20:45703500-45703522 GGGCATTCTATTGCAAATAGAGG - Intronic
1176184566 20:63771287-63771309 GGGCAGCTCATTGCAGCTTGTGG - Intronic
1185015419 22:48339892-48339914 GGGCAGCTCATTGCAGAGCGTGG - Intergenic
949413359 3:3789236-3789258 GGGAAGTACTTTGCAAATGGCGG - Intronic
949484850 3:4528119-4528141 GAGCAGTTCATGGCAGATTCTGG - Intronic
951207519 3:19940044-19940066 GGACAGATCATTCCAAACTGGGG - Intronic
952496194 3:33917802-33917824 GGGCAGCCCACTGTAAATTGTGG - Intergenic
954447373 3:50553925-50553947 GGTCAGTTCATGCCAAATTCAGG + Intergenic
955101917 3:55858960-55858982 GGTCAGTTCTTTGCAAAATTAGG - Intronic
956676281 3:71735486-71735508 GAGCAGTTCTCTGCAAGTTGAGG + Intronic
956722445 3:72130200-72130222 GGGCATTTCACTGCAAATTTGGG + Intergenic
957791240 3:84943673-84943695 ACGCAGTACATTGCAATTTGTGG + Intergenic
959165510 3:102772554-102772576 GAGCATTTCATTGAAAATTCTGG + Intergenic
959770636 3:110090911-110090933 GGGCAAGTCAATGCAAATTGAGG + Intergenic
962020381 3:131493894-131493916 AGGCACTTCATTGGAATTTGGGG - Intronic
962070596 3:132029590-132029612 GGGCAATTCATTGCACCTTGAGG - Intronic
963812746 3:149795433-149795455 GTGCAGTACATTGCCATTTGTGG + Intronic
969218466 4:5743014-5743036 GGGCAGTTCATTGCAAATTGAGG + Intronic
970684807 4:18554633-18554655 GAGCAGTACATCGTAAATTGTGG - Intergenic
972441653 4:39099383-39099405 GGGGAGATCAATGCATATTGAGG - Intronic
974836423 4:67256680-67256702 GAGTAGTTCAATGCAAATTTAGG + Intergenic
978702649 4:111667575-111667597 GGGAGGTTCATTGCTAACTGGGG - Intergenic
982394845 4:154905133-154905155 GGGTATTTCAGTTCAAATTGAGG + Intergenic
984312241 4:178076986-178077008 GGACAGTTCATTGGGAAATGAGG + Intergenic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
985284068 4:188316597-188316619 GGACAGTCCAATGCAAACTGAGG - Intergenic
985700465 5:1368840-1368862 GGACAGGTCAATGCAAATTAAGG - Intergenic
990525683 5:56624577-56624599 GGGCAACTGATAGCAAATTGGGG - Intergenic
992779356 5:80114027-80114049 GGGCAGGTCATTGTTAATTGAGG - Intronic
993799158 5:92309440-92309462 AAGCAATTCATTGCAAATTAGGG - Intergenic
996597965 5:125226938-125226960 GGGCAGAGCATTGCAAGTAGAGG + Intergenic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
997212749 5:132087047-132087069 GGGGGGTTCATTGTAACTTGGGG - Intergenic
997212764 5:132087121-132087143 GGGGGGTTCATTGTAACTTGGGG - Intergenic
1000304747 5:159984986-159985008 GGGCAGACCATTGCAAAGTGTGG - Intergenic
1003534946 6:6968771-6968793 GGCCAGCTCCTTGGAAATTGAGG - Intergenic
1010651266 6:78457895-78457917 GGGCTGTTAATTGTAAATAGAGG + Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1011811180 6:91134041-91134063 GGGCAGTTCTCAGCAAATTATGG - Intergenic
1016519575 6:144931464-144931486 AGGCAGGTCAATGCAAATTGAGG + Intergenic
1020522988 7:9218152-9218174 GAGAAGTTCATTGGAATTTGAGG + Intergenic
1021387700 7:20051864-20051886 GGGAAGTTCATTGCAAGTCACGG - Intergenic
1024903563 7:54350544-54350566 GCTCATTTCATTGCAAATAGAGG + Intergenic
1025294676 7:57767271-57767293 GGACATTTCAGAGCAAATTGAGG - Intergenic
1025584657 7:62768125-62768147 GGATATTTCATTGCACATTGAGG - Intergenic
1026586071 7:71657173-71657195 GGGCAGTAGATTCCAAAGTGGGG + Intronic
1028035407 7:85975474-85975496 GGGCAGCTCAATGCAAAGTGAGG + Intergenic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1032657248 7:133944565-133944587 AGGCAGTTCCTTCCAAATTTTGG + Intronic
1038653047 8:29422932-29422954 GGGCAGTTAATTGCATAGAGAGG + Intergenic
1039157654 8:34579691-34579713 TGGCAGATCAATGTAAATTGAGG - Intergenic
1040626692 8:49157887-49157909 GGGTAGTTTATTGAAAAATGAGG + Intergenic
1045013554 8:97979439-97979461 GAGCAGTTCTTTGCAAACTGCGG - Intronic
1045288943 8:100815584-100815606 GGGCAGTTTAATGTAAGTTGGGG - Intergenic
1050250478 9:3738600-3738622 GTGAACTTGATTGCAAATTGAGG - Intergenic
1050587989 9:7133032-7133054 GGGCTGTGCAATGCAAACTGAGG + Intergenic
1059019974 9:110565793-110565815 GTGAAGTTCATTGCAAAGTCAGG - Intronic
1188388221 X:29588119-29588141 GGGCAGTATCTTTCAAATTGAGG - Intronic
1189743626 X:44147037-44147059 GGCCATTTCATTGCTAATTGTGG + Intergenic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1193034888 X:76938692-76938714 TTGGAGTTCATTGCAGATTGTGG + Intergenic
1194152789 X:90345696-90345718 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1197609840 X:128625503-128625525 GACCAGTTCTTTGCAAAATGAGG - Intergenic
1198441367 X:136666612-136666634 GGGAAGGTCACTGGAAATTGAGG - Exonic
1199540887 X:148956705-148956727 TGGCAGTGCATTGCAGATTTTGG + Intronic
1200499133 Y:3922441-3922463 GGGGTGGTCAATGCAAATTGAGG + Intergenic