ID: 969218620

View in Genome Browser
Species Human (GRCh38)
Location 4:5744495-5744517
Sequence CAGAATCATTTGAGAGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969218617_969218620 -5 Left 969218617 4:5744477-5744499 CCTTTTCCTTCCTGAGTTCAGAA 0: 1
1: 0
2: 8
3: 42
4: 479
Right 969218620 4:5744495-5744517 CAGAATCATTTGAGAGAGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969218620 Original CRISPR CAGAATCATTTGAGAGAGTC AGG Intronic
904132219 1:28283334-28283356 TAGAGTCATTTGAGAGGGTGTGG + Intergenic
905090904 1:35430713-35430735 AATACTCATTTGAGAAAGTCAGG - Intergenic
913310711 1:117489087-117489109 CACAATCATTAAAGAGAATCAGG - Intronic
916616291 1:166444603-166444625 CAGAATCCTTTGCTAGAATCCGG + Intergenic
916759054 1:167800452-167800474 CAGAAGCATGTGAAAGACTCTGG + Intergenic
1063709905 10:8467509-8467531 CAGAAGCATCTGAGGAAGTCAGG + Intergenic
1065376865 10:25051887-25051909 CAGAATCATTTCAGAGGAACAGG - Intronic
1073654510 10:105398480-105398502 AAGTATCATCTGACAGAGTCAGG - Intergenic
1077339775 11:2021139-2021161 CAGAAGCAATTGGAAGAGTCTGG + Intergenic
1077476086 11:2791279-2791301 CAGCATCAATTGCGGGAGTCCGG + Intronic
1077724040 11:4655847-4655869 ATGATTCATTTGAGAGAGTGAGG - Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1082832937 11:57632928-57632950 CAGCAGCATTTGAGAGAAGCAGG + Intergenic
1088096072 11:106102743-106102765 CAGAAGCAAGTGAGAGAGTGAGG - Intergenic
1088908995 11:114176455-114176477 GAGAATCATTAGCCAGAGTCAGG - Intronic
1089004689 11:115081593-115081615 CAGAGTCCATTGAGAGAGACAGG - Intergenic
1090522076 11:127490156-127490178 TAGAATCATTTAAGAGAGAAAGG + Intergenic
1090988070 11:131790566-131790588 CCTGGTCATTTGAGAGAGTCAGG + Intronic
1091169945 11:133511109-133511131 CAGAATCAGGTGAGAGAGAGTGG - Intronic
1202822760 11_KI270721v1_random:76328-76350 CAGAAGCAATTGGAAGAGTCTGG + Intergenic
1091690653 12:2595070-2595092 CAGAATTGTCTGAGAGAGTTTGG + Intronic
1092076086 12:5674721-5674743 CAGAATCAAGTGACAGAGACAGG - Intronic
1093669382 12:21855099-21855121 AAGAATCATTTGGGATAGTTTGG - Intronic
1093672352 12:21892019-21892041 GAAACTCATTTGAGAGAATCAGG + Intronic
1096658496 12:53106230-53106252 GAGAAGCATTTGAGAGTGGCCGG - Intronic
1096923010 12:55109993-55110015 CAGAATTATTTGACATATTCAGG - Intergenic
1097486653 12:60212053-60212075 CAGAAAGATGTGAGAAAGTCTGG + Intergenic
1098508241 12:71280726-71280748 CAGAATCAAATGGGAAAGTCAGG - Intronic
1098533332 12:71567064-71567086 CAGGATCATGTCAGAGAGCCTGG - Intronic
1101323132 12:103691142-103691164 CAGAATTCTGTGAGGGAGTCTGG + Intronic
1103186053 12:118958438-118958460 CAGAAAGATTTTTGAGAGTCTGG - Intergenic
1104908615 12:132228787-132228809 CGGAATCAAGTGTGAGAGTCGGG - Intronic
1105762979 13:23530745-23530767 AAAAATCCTTTGAGAGTGTCTGG - Intergenic
1106132505 13:26951957-26951979 CAGAGTCATCTGGGAGAGACTGG - Intergenic
1106155948 13:27156465-27156487 TATAATCATTTGAGACAATCAGG + Intronic
1106431343 13:29683385-29683407 CAGAATCATTGGGGAGCTTCTGG - Intergenic
1107055174 13:36095499-36095521 CAGAAAGATATGAGAGAGCCGGG - Intronic
1109366104 13:61358185-61358207 CAGAATATTTTGAGAGAAACAGG - Intergenic
1109526058 13:63578223-63578245 TAGAATAATTTGGGAGATTCAGG + Intergenic
1110678603 13:78280836-78280858 CAGAATTAATTTAGAGAGGCGGG - Intergenic
1111112460 13:83731988-83732010 CAGAATCATTTTAGAGATCTTGG - Intergenic
1111673888 13:91363208-91363230 CAGAATCATTTAATAGTGTATGG + Intergenic
1111758929 13:92436846-92436868 CAGAAACATTTAAGTGTGTCAGG - Intronic
1114397608 14:22380975-22380997 CAGGATCATCAGAGAGAATCTGG + Intergenic
1114556820 14:23567032-23567054 CATAAACAGGTGAGAGAGTCTGG + Intronic
1117884471 14:60345551-60345573 CAGAATAAATTGAGAAAGTAGGG - Intergenic
1118698054 14:68404563-68404585 TAGAATCACTTGAGAGAGGGAGG - Intronic
1119208683 14:72813173-72813195 CAGAGGGTTTTGAGAGAGTCAGG + Intronic
1119820578 14:77612404-77612426 CAGAGTTATTTGAGATACTCAGG - Intronic
1120556932 14:85939160-85939182 TTGAATCACTTGAGAGAGTTTGG + Intergenic
1121825855 14:97008776-97008798 AAGAAGCATTTGAAAGATTCAGG - Intergenic
1122132224 14:99611221-99611243 GAGGATCACTTGAGTGAGTCTGG - Intergenic
1123586074 15:21761794-21761816 CAGAATCAAGTGACAGAGACAGG + Intergenic
1123622716 15:22204384-22204406 CAGAATCAAGTGACAGAGACAGG + Intergenic
1128854672 15:70999498-70999520 CAGAACCAATCGATAGAGTCTGG - Intronic
1129750237 15:78057720-78057742 CAGAGCCATTTCAGACAGTCTGG - Intronic
1130011241 15:80154308-80154330 CAGAAACATTTGTGAGAGGCAGG + Intronic
1130081625 15:80738833-80738855 AACAAACATTTTAGAGAGTCTGG + Intronic
1133698226 16:8285228-8285250 CAGAATCTCTTGGGAGAATCTGG + Intergenic
1133760390 16:8794013-8794035 CAGAATCATTTGAGCTGGTGAGG + Intronic
1133844250 16:9439399-9439421 CAGAATCACACAAGAGAGTCAGG - Intergenic
1139287727 16:65830464-65830486 CAGTATCCTTTGAGAGAGAAAGG + Intergenic
1140315075 16:73888782-73888804 CAGAAACAATTCAGAGAGGCTGG + Intergenic
1140569071 16:76081105-76081127 CAAAATCATTTGAGATATACAGG - Intergenic
1141872350 16:86796050-86796072 GAGAATCATTTCAGACAGTTTGG + Intergenic
1147400339 17:40177222-40177244 CAGCATCATTTCAAAGAGTCAGG - Intronic
1151396760 17:73827832-73827854 CAGAACCATTTAAAAGAGTGAGG + Intergenic
1151457353 17:74233849-74233871 CAGACTCACATGAGAGAGCCTGG - Intronic
1155455462 18:26007546-26007568 TATTATTATTTGAGAGAGTCTGG + Intergenic
1155755268 18:29486872-29486894 CAGTAGCATTTAAGAGAGTGTGG - Intergenic
1159330107 18:66981995-66982017 CAAAATCATTTGATATTGTCAGG + Intergenic
1159502203 18:69288378-69288400 GAGAATCCTTTGGGAGAGCCAGG + Intergenic
1161942467 19:7414215-7414237 CAGGGTCATTTGGCAGAGTCTGG - Intronic
1162729106 19:12706921-12706943 CAGACTCATTTCACAGAGCCAGG + Intronic
1168675789 19:58277220-58277242 CAGAAGGATCTGAGAGAGTGTGG + Intronic
1168675797 19:58277268-58277290 CAGAAGGATCTGAGAGAGTGTGG + Intronic
927599838 2:24431225-24431247 AAGAAAGATTTGAGAGAGTAGGG - Intergenic
928993365 2:37259548-37259570 CAGAATCATTTAAAAGGTTCTGG + Intronic
929033011 2:37666245-37666267 CAAAACCATTTGAGAAACTCTGG + Intronic
930737498 2:54794462-54794484 CAGAAACATCTGAGGGAGTAGGG + Intronic
931086316 2:58834691-58834713 GAGATTCAGGTGAGAGAGTCTGG + Intergenic
931783031 2:65596272-65596294 CAGAATTATGTGAGAGAATGGGG - Intergenic
933481944 2:82869164-82869186 CTGTATCCTTTGAGAGAGTGTGG - Intergenic
934706486 2:96485135-96485157 CAAGAGCATTTGAGGGAGTCAGG + Intergenic
938598891 2:132817216-132817238 CAGAATCATCTGAAGGAATCAGG + Intronic
938767714 2:134471624-134471646 AAGATTCCTTTCAGAGAGTCAGG + Intronic
939163834 2:138618963-138618985 CAGAATCATTTGAAAGACTAAGG + Intergenic
939535405 2:143421589-143421611 CAGAATCAATTTAGTGAGTTGGG + Intronic
939876962 2:147588452-147588474 CTGACTCATTTGCAAGAGTCAGG + Intergenic
942026368 2:171914562-171914584 CAGAACCATTTGAGAGACTTGGG + Intronic
946170876 2:217894754-217894776 CAGAATCACTTGGGTGAGGCTGG - Intronic
946506635 2:220308606-220308628 CTGAATCAATTGGGAGAATCTGG + Intergenic
947343335 2:229163519-229163541 CATAATCACTTGAGAGACTCTGG - Intronic
1170144845 20:13162011-13162033 CATACTCATTTTAGAGAATCTGG - Intronic
1170796667 20:19553113-19553135 CAGAATAATTTTAGAAAGACAGG - Intronic
1171478616 20:25434743-25434765 CAGAATTAATTGAGACAGGCTGG - Intronic
1172874397 20:38155570-38155592 GAGAATCACTTGAGCGAGCCAGG - Intronic
1176264206 20:64200242-64200264 CAGAAGCACTTGTGAGGGTCCGG - Intronic
1177168606 21:17630527-17630549 CAGAAATATTTTAGACAGTCAGG - Intergenic
1178718773 21:34990259-34990281 CAAACTCATTTTAGAGATTCTGG - Intronic
1179301861 21:40118936-40118958 CAGAATCTTATGACAGATTCTGG + Intronic
1180711328 22:17841615-17841637 CAGACTCAATTCAGAGATTCAGG - Intronic
1181024542 22:20120552-20120574 CAGAGTCGTCTGAGAGAGGCAGG + Intronic
1181166763 22:20988132-20988154 CAGAAACATTTGGGACAGGCTGG + Intronic
1185166280 22:49264338-49264360 CAGAATATTTTGAGAGAATTTGG - Intergenic
951063006 3:18232450-18232472 CATAATCATTTCAGAATGTCTGG - Intronic
952447665 3:33398353-33398375 TAGAGTCATTTTATAGAGTCAGG + Intronic
955837039 3:63067442-63067464 CAAAATCACTTAAGTGAGTCAGG + Intergenic
955837287 3:63070307-63070329 CAGAATCAGGTGACAGAATCAGG + Intergenic
958878637 3:99644147-99644169 CTCAAGCATTTGAGAGGGTCTGG - Intronic
962734819 3:138316515-138316537 CAGCATCATCTGAGATGGTCAGG + Intronic
962854244 3:139329704-139329726 CAAAATCACTTGAGAGAGGAAGG - Intronic
963160667 3:142148677-142148699 CAGACTCCTTTGAGAAAATCTGG - Intronic
963343040 3:144060648-144060670 CAGAAACAATGGAGAGAGGCAGG + Intergenic
963562356 3:146881839-146881861 CAGAAACAGTTGAAAGAGGCTGG + Intergenic
969218620 4:5744495-5744517 CAGAATCATTTGAGAGAGTCAGG + Intronic
970255546 4:14165775-14165797 CAGAAGCATGTGAGAGCTTCAGG + Intergenic
971136034 4:23869466-23869488 CAGAATCAGTCAAGAGAGTTTGG + Intronic
976579206 4:86715379-86715401 CAGATTCATTTGTGAGAATTGGG - Intronic
976634644 4:87275733-87275755 CAGAATTAGTGGAGAGGGTCTGG - Intergenic
976929566 4:90548861-90548883 AAGAATCGTTTGAAAGAGTGAGG + Intronic
977213325 4:94246781-94246803 CTGTATTATTTGAGAGAGCCAGG + Intronic
978247014 4:106585125-106585147 CAGAATCCTTGGAAAGAGTCAGG - Intergenic
979774210 4:124567278-124567300 CAGATTAATTTGAGAGATACAGG + Intergenic
979817695 4:125130123-125130145 CATATTCATTTGAGTAAGTCTGG + Intergenic
982265604 4:153535742-153535764 CAGAACCATTTTGGAGAGTCAGG + Intronic
986346406 5:6839406-6839428 CCAAATGATTTGAAAGAGTCAGG - Intergenic
987203539 5:15601742-15601764 AATGATCATTTGAGAGACTCAGG + Intronic
993086674 5:83371528-83371550 CAGATGCATCTGAGAGAGTGAGG + Intergenic
993742921 5:91562567-91562589 CTGAGTCAATTTAGAGAGTCAGG + Intergenic
997102173 5:130981281-130981303 CAGAAAAATATGAGAAAGTCTGG - Intergenic
998735046 5:145128077-145128099 CAGAATCTTTTGAGAGAAGGAGG + Intergenic
999093797 5:148959891-148959913 CAGAATCATTTGATGCAGACTGG - Intronic
1000085698 5:157886062-157886084 AAAAATCATTTGAGAGTGTGTGG - Intergenic
1001280118 5:170380729-170380751 CAGAGGCATTGGAGAGACTCAGG - Intronic
1001317655 5:170655832-170655854 CTGATTGATTTGAGAGAGGCTGG - Intronic
1001748280 5:174108718-174108740 CTGAAACATTTGTGAGAGGCAGG - Exonic
1003206079 6:4013443-4013465 CAGGATCATTTTAGATATTCTGG - Intergenic
1003716746 6:8655256-8655278 CAGAATCATTTTAGAAAGAAAGG - Intergenic
1004146310 6:13070102-13070124 GATAATCATTTCATAGAGTCAGG - Intronic
1004874101 6:19937908-19937930 CAGAATAATCTGAGAGTGACTGG - Intergenic
1005614788 6:27561893-27561915 CAGAATAATTGGAGAGCTTCCGG - Intergenic
1005646389 6:27843033-27843055 TAGAATTATATGAGAGAATCTGG + Intronic
1010635569 6:78255746-78255768 CTTAATCATTTGAGAAACTCTGG - Intergenic
1011141123 6:84157747-84157769 CACTATCATATGAGGGAGTCTGG - Intronic
1012165892 6:95951351-95951373 CAGAATCTTTTGAGAGAGAAAGG + Intergenic
1013177404 6:107689591-107689613 CAGAAACACCTGAGAGCGTCTGG + Intergenic
1014189680 6:118479870-118479892 CAGAATGATTTTAGAAATTCAGG - Exonic
1016155502 6:140802127-140802149 CAAAATAATTTGAGGGAGTGTGG + Intergenic
1016328410 6:142928942-142928964 AAGAATCATTTGATACAGTTTGG - Intronic
1017351528 6:153448275-153448297 GAGAATCATGTGAAGGAGTCTGG - Intergenic
1017541865 6:155411562-155411584 CAGAGTGAATTCAGAGAGTCAGG + Intronic
1018239176 6:161755244-161755266 GAGAATCATTGCAGAGAGTATGG - Intronic
1027611633 7:80368594-80368616 CAGAACCATTTGGGAGTGGCCGG - Intergenic
1031788972 7:126074960-126074982 AAGAATCATCTGAGAGAACCAGG + Intergenic
1038984839 8:32797279-32797301 CAGAATAATTGGAGAGAATTTGG + Intergenic
1041277161 8:56173794-56173816 CAGAAACAATAGAGAGAGTATGG + Intronic
1042084939 8:65096875-65096897 AAAATTCATTTAAGAGAGTCAGG - Intergenic
1042151418 8:65790031-65790053 CAGGGTCATTTCAGAGATTCTGG - Intronic
1045353640 8:101365099-101365121 CAAAATCATTTGAAAAAGTACGG - Intergenic
1047306164 8:123654714-123654736 CAGAATCACGAGAGAGAGTGAGG + Intergenic
1048612842 8:136042453-136042475 CAGAATAATTTGATGGATTCTGG + Intergenic
1052153930 9:25157829-25157851 CAGAATAATTCCAGAGAGTAGGG + Intergenic
1052791706 9:32881313-32881335 AAGAATGATTTCAGAGAGGCAGG - Intergenic
1055228764 9:74034488-74034510 TAAAATCATTTGATAAAGTCTGG - Intergenic
1059556402 9:115284991-115285013 CAGCATCATTTTAGACAGACTGG - Intronic
1060862889 9:126970059-126970081 AAGAATTATTTGAGTGATTCTGG + Intronic
1186527265 X:10260300-10260322 CAGCATCATCTTAGAGAGGCAGG + Intergenic
1187344255 X:18448650-18448672 CTGAATTATTTCAGAGAGCCAGG + Intronic
1187665393 X:21603216-21603238 CAAAATTATTTCAGAGATTCTGG - Intronic
1193569432 X:83124454-83124476 CAGTGTGATTTGAGAGATTCCGG + Intergenic
1194073173 X:89352635-89352657 CAGTAACGTTTGAGAGAGACTGG + Intergenic
1194407529 X:93515731-93515753 CTCAATCATTGGAGAGAGTGGGG - Intergenic
1194794896 X:98199372-98199394 CAGACTCATATGAGACAGCCAGG + Intergenic
1196167672 X:112553259-112553281 TAGAATGAGTTGAGAGAGGCAGG - Intergenic
1197894508 X:131297231-131297253 CAGAATCAAATGAGAAAGTAAGG + Intronic
1198660769 X:138965611-138965633 CAGAATGATTCAAGAGACTCAGG + Intronic
1200727405 Y:6688381-6688403 CAGTAACGTTTGAGAGAGACTGG + Intergenic
1200728557 Y:6704156-6704178 CAGTAACGTTTGAGAGAGACTGG + Intergenic
1201402927 Y:13622308-13622330 CAGGATAATGTGAGAAAGTCTGG - Intergenic
1201447220 Y:14070703-14070725 GAGAATCATTTGAAAAAGTGAGG - Intergenic