ID: 969218832

View in Genome Browser
Species Human (GRCh38)
Location 4:5746208-5746230
Sequence GCTTTGAAGCAGGGGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 279}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969218822_969218832 24 Left 969218822 4:5746161-5746183 CCAGCGAGATGGGAGTGTCTATT 0: 1
1: 0
2: 0
3: 10
4: 116
Right 969218832 4:5746208-5746230 GCTTTGAAGCAGGGGGTGGCTGG 0: 1
1: 0
2: 1
3: 16
4: 279
969218826_969218832 0 Left 969218826 4:5746185-5746207 CCAGCGAGGTGGGAGTCACTGAA 0: 1
1: 0
2: 0
3: 13
4: 150
Right 969218832 4:5746208-5746230 GCTTTGAAGCAGGGGGTGGCTGG 0: 1
1: 0
2: 1
3: 16
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969218832 Original CRISPR GCTTTGAAGCAGGGGGTGGC TGG Intronic
900392855 1:2441235-2441257 GCTTCACAGCAGGGGCTGGCAGG - Intronic
900395961 1:2453363-2453385 ACATTGAAGCTGGGGATGGCAGG + Intronic
900415469 1:2532595-2532617 GCTTTGGAGCGGCAGGTGGCTGG + Intergenic
900655409 1:3754408-3754430 GCAATGAAGCTGGGGGTGGAGGG + Intronic
900686848 1:3954241-3954263 GCTTTGAAGCAGAGACTGGTGGG + Intergenic
900816886 1:4854555-4854577 GCATTGTACCACGGGGTGGCAGG - Intergenic
901987131 1:13084962-13084984 GCTCTGGAGCAGTGGGTGTCTGG - Intergenic
901994681 1:13141805-13141827 GCTCTGGAGCAGTGGGTGTCTGG + Intergenic
903419922 1:23211432-23211454 GCTTTGAAGCTGAGCGTGGGAGG + Intergenic
903794433 1:25918245-25918267 GCTGGGAAGCTGGGGGTGGCTGG + Intergenic
904237904 1:29125720-29125742 GGTTTTAAGCAGGTAGTGGCAGG - Intergenic
904953248 1:34261415-34261437 GATTTGAAGCAGGAGGTTGAAGG + Intergenic
905942191 1:41873092-41873114 GCTTTGCTGAAGGGGCTGGCAGG + Intronic
910763885 1:90761669-90761691 GCTTTGGCGTAGGGGGTGGAAGG + Intergenic
911721108 1:101192159-101192181 AATTTGAAGCAGAGGGTGGGTGG + Intergenic
913059813 1:115194541-115194563 GCCCTGAAGAAAGGGGTGGCAGG - Intergenic
915249081 1:154575962-154575984 ACTGTGCAGCAGAGGGTGGCAGG - Exonic
915954037 1:160208322-160208344 GCTTGGAAGGAGAGGGAGGCAGG + Intronic
917728103 1:177846969-177846991 GATTTTAAGCAGTGTGTGGCTGG - Intergenic
918447619 1:184630746-184630768 GCTTTGTAGAAGGAAGTGGCAGG - Intergenic
919796525 1:201324552-201324574 TCTGTGCAGCAGAGGGTGGCGGG - Exonic
920147134 1:203871807-203871829 TTCTTGAAGCAGGGGGTGGGAGG + Intergenic
920291701 1:204928018-204928040 GCTTTTCAGCAGGTGGAGGCAGG + Intronic
920416881 1:205804773-205804795 GCTTGGAAGCAGGGTGGAGCTGG - Intronic
921079724 1:211729391-211729413 GCTTCTAAGCAGTTGGTGGCAGG + Intergenic
921286682 1:213615695-213615717 GCCTTGCTGCAGGAGGTGGCTGG + Intergenic
922304611 1:224333223-224333245 GCCTTTAAGAAGGAGGTGGCTGG - Intergenic
922798778 1:228354387-228354409 GGTCTGGAGGAGGGGGTGGCAGG + Intronic
923351672 1:233113462-233113484 GCTTGGATGCAGGGGTTGGGTGG - Intronic
1062827310 10:582143-582165 TTTTTGTAGCAGGGGGTGGGTGG - Intronic
1063131381 10:3180580-3180602 TCTTTGAAGCTGGCAGTGGCTGG + Intergenic
1064057102 10:12106912-12106934 GTCTTGAAACAGGGGGTGGTGGG - Intronic
1066247101 10:33593986-33594008 GCTTTGGAGCTGGGGTTGGTGGG - Intergenic
1067030240 10:42875004-42875026 GCTTGGTAGCTGGGGGTGGCCGG + Intergenic
1068581824 10:58749767-58749789 ACTTTGAAGCACTGGGTGCCTGG - Intronic
1068942390 10:62692318-62692340 GCTTTGAAGGTGGGGGAGGAGGG + Intergenic
1069926485 10:71854244-71854266 GCTTTGAAACAGGAGGAGGAGGG + Intergenic
1070661636 10:78310728-78310750 CCTTTGACACAGAGGGTGGCTGG + Intergenic
1071618693 10:87098215-87098237 TATTAGAAGCAGGGAGTGGCTGG + Intronic
1072946752 10:99817235-99817257 GGGTTGAAGGACGGGGTGGCTGG - Intronic
1075320174 10:121485154-121485176 GCTTTGGATCAGAGGGTGTCTGG - Intronic
1075656480 10:124165126-124165148 GGTGTGAGGCAGGTGGTGGCAGG - Intergenic
1076571302 10:131434825-131434847 GCTCTGAAGCCGGGGGTCGTTGG + Intergenic
1076659500 10:132046093-132046115 GCGTGGAAGCTGGGGGTGTCAGG - Intergenic
1076698310 10:132257536-132257558 GCTGCGAAGGAGTGGGTGGCAGG + Intronic
1076898738 10:133326803-133326825 GCCTCCAGGCAGGGGGTGGCAGG - Intronic
1077313353 11:1903310-1903332 GCTGTGGAGCGGGGGGTGGGGGG + Intergenic
1081603501 11:44511953-44511975 ACTTAGAAGCTGGGGGTGACAGG - Intergenic
1081962934 11:47151578-47151600 GGCTTGGAGCAGAGGGTGGCGGG + Intronic
1083279040 11:61614091-61614113 GCTTGGCAGATGGGGGTGGCAGG + Intergenic
1084007971 11:66333256-66333278 ACCTGGAAGCAGTGGGTGGCAGG + Exonic
1084155141 11:67309071-67309093 GGTCTGCAGCAGTGGGTGGCAGG - Intronic
1085645235 11:78218384-78218406 GCTTTCAAGGTGGGGCTGGCGGG + Exonic
1085784622 11:79439165-79439187 GCTTTGTAGAAGGCGGTGGTGGG - Intronic
1087161046 11:94948416-94948438 GTTTTGAAGCAGAGGGAGGGAGG - Intergenic
1087380630 11:97400385-97400407 CCTTTGAAGCAGATGGTGGAAGG - Intergenic
1087601831 11:100327181-100327203 GCTTTTAAGCAGGATGAGGCTGG - Intronic
1089603047 11:119626823-119626845 GATTTGAAGCTGGGGATGGTGGG - Intronic
1091168658 11:133501926-133501948 GCTTTGAAGGAGGGAAAGGCAGG - Intronic
1091800835 12:3323528-3323550 AGGTTGGAGCAGGGGGTGGCGGG + Intergenic
1091847342 12:3667507-3667529 ACGTTGAGGCAGGGGGTGGGAGG - Intronic
1094196957 12:27759801-27759823 TATTTGAAGCAGGGAGTGGGGGG - Intergenic
1094491514 12:30963788-30963810 GGGTTAGAGCAGGGGGTGGCGGG - Intronic
1094635905 12:32227068-32227090 ACTGTGAAGGAGGAGGTGGCTGG + Intronic
1095392686 12:41728022-41728044 GCTTTGAAGAACGGGGAGCCAGG + Intergenic
1096524294 12:52201315-52201337 GCTTTGAAGCAGTGTGCGGCAGG - Intergenic
1096649919 12:53057382-53057404 GCTTTGAGGCAGAGGGGAGCAGG + Intronic
1097440104 12:59597464-59597486 GCCATGAAGCATGGGGTGACAGG - Intronic
1098858134 12:75677348-75677370 TATTTGAAGCAGAGGGTTGCGGG + Intergenic
1100343302 12:93702286-93702308 GCTTTGAATCTGGGCTTGGCAGG + Intronic
1101445148 12:104732136-104732158 GCTCAGAAGCAGGAGGTGGCAGG + Intronic
1103859668 12:124002313-124002335 GGTTGGAAGGAGGCGGTGGCTGG + Intronic
1107531053 13:41282671-41282693 GCTTTCAAGCAATGAGTGGCTGG + Intergenic
1108364785 13:49698892-49698914 GTCTTGAAGCCGAGGGTGGCAGG - Intergenic
1111319976 13:86614516-86614538 GTTTTGAAGGTGGGGGTTGCAGG - Intergenic
1112331209 13:98478281-98478303 GCTTCGAAGCAGGGGAGGACAGG - Intronic
1114549396 14:23524392-23524414 GCAGTGAAGCAGGGGGAGGAGGG - Exonic
1115351603 14:32401363-32401385 ACTCTGTAGCTGGGGGTGGCAGG - Intronic
1117009227 14:51453266-51453288 GCTTTGAGTCGGGGGCTGGCAGG + Intergenic
1122118806 14:99540959-99540981 GCTGTGAGGCAGGGGCTGGGTGG + Intronic
1124122060 15:26895952-26895974 GCATGGAGGCAGGGGGAGGCTGG - Intronic
1124384812 15:29198119-29198141 GACATGGAGCAGGGGGTGGCAGG - Intronic
1125492913 15:40161449-40161471 GCTTTGAAGCTGGATGCGGCAGG - Intronic
1125797036 15:42410669-42410691 GCTGAGAAGGAAGGGGTGGCAGG + Intronic
1126398356 15:48243273-48243295 GCATTCAAGCAGAGGCTGGCAGG + Intronic
1127313214 15:57770614-57770636 GCTCTGAACTTGGGGGTGGCTGG - Intronic
1127640248 15:60909349-60909371 GCTTTGACACATGGGGTGCCAGG - Intronic
1127655171 15:61048747-61048769 GGTTTTAAGTAGGGGCTGGCAGG + Intronic
1128149822 15:65355849-65355871 GCTCTGGGGGAGGGGGTGGCGGG - Intronic
1128616513 15:69114666-69114688 GCATTGGAGCAGGGTGTGGTGGG + Intergenic
1128813512 15:70588396-70588418 GCTTTGAAGCAGAGGTGGGGTGG - Intergenic
1129064382 15:72888977-72888999 GCATTGTAGCAGGGTGTGGATGG + Intergenic
1129169392 15:73798487-73798509 GGTCTGAAGGAAGGGGTGGCAGG - Intergenic
1129324765 15:74794202-74794224 GCTGTGAGGGTGGGGGTGGCGGG - Intronic
1129324826 15:74794367-74794389 GCTGTGAGGGTGGGGGTGGCGGG - Intronic
1129864413 15:78893755-78893777 GCTTTGACACAGGAGTTGGCTGG + Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1130222598 15:82033155-82033177 GCCTTGATCCAGGAGGTGGCTGG - Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1133302812 16:4793169-4793191 GCCTGGAAGCAGAGGGTGGAGGG + Intronic
1134625359 16:15719172-15719194 GCTCTGAAGCAGAGGATGGGGGG - Intronic
1135921112 16:26649766-26649788 GCTATGAAGCAGGAGATGCCAGG + Intergenic
1136133845 16:28242092-28242114 GCTTTGAAGAAGGCTGTGGGTGG + Intergenic
1137578391 16:49618963-49618985 ACTTTGAGGCAGGAGGTGGGTGG - Intronic
1140842776 16:78856298-78856320 GCTTTAAAGCAGGGAGTAACAGG + Intronic
1141162075 16:81635961-81635983 GCATGGATTCAGGGGGTGGCGGG + Intronic
1141671835 16:85496232-85496254 CCTTGGAGGCACGGGGTGGCGGG - Intergenic
1142561099 17:809467-809489 GTTTTGAAGCAGGTGGGGGCTGG + Intronic
1142741106 17:1932485-1932507 GCTTGGAAGCAGCAGGTGTCTGG + Intergenic
1142889224 17:2932229-2932251 GCGCTGAAGCAGAGGGTGCCTGG + Intronic
1142891772 17:2948508-2948530 GCTGTGGACCAGGGGGAGGCAGG + Intronic
1142891803 17:2948646-2948668 GCTGTGGACCAGGGGGAGGCAGG + Intronic
1142891833 17:2948784-2948806 GCTGTGGACCAGGGGGAGGCAGG + Intronic
1144440992 17:15281509-15281531 GCTTTGGTGCAGAGGGTGGGGGG - Intergenic
1146017465 17:29245447-29245469 GTTTTGAAGGTGTGGGTGGCAGG + Intergenic
1146673813 17:34759433-34759455 GGTGTGCAGCAGGGGGTGCCAGG + Intergenic
1147378415 17:40036885-40036907 ACCTTGAAACAGGGAGTGGCTGG + Intronic
1147944915 17:44075461-44075483 GCTTTGAAGCCTGGGCAGGCTGG + Intronic
1148158611 17:45437326-45437348 GCTTAGAGGTAGCGGGTGGCTGG - Exonic
1149304707 17:55336271-55336293 CCTGGGGAGCAGGGGGTGGCTGG - Intergenic
1149516355 17:57283845-57283867 GGCTTGGAGCAGAGGGTGGCAGG + Intronic
1150250552 17:63702055-63702077 GGTTTAAAGCAGGGGGAGGAGGG + Intergenic
1150928145 17:69555781-69555803 GCTGGGAAGTAGGGGGTGGGGGG - Intergenic
1151312224 17:73300288-73300310 GCTTGGAGGCTGGGGGTGGTGGG - Intronic
1152237058 17:79144165-79144187 GCTCAGAGGCAGGGGGAGGCAGG - Intronic
1152524985 17:80883494-80883516 GCTCTGGGGCTGGGGGTGGCTGG - Intronic
1153886998 18:9475824-9475846 GGTTTGAAGTTGGGGGTGGGGGG + Intronic
1154214184 18:12403342-12403364 GATTTGAAGGTGAGGGTGGCAGG + Intergenic
1157620475 18:49014421-49014443 GCCTTGAAGCTGGGGGTTGGGGG + Intergenic
1158937686 18:62379772-62379794 GTTTTGCAGCAAGGGGTGGGTGG + Intronic
1160247287 18:77169099-77169121 GATTTGCAGCCAGGGGTGGCTGG + Intergenic
1160400881 18:78610708-78610730 GCTTTGCAGCGGGGGGTGCCTGG - Intergenic
1160871239 19:1278848-1278870 GCGGTGGAGCAGGGGGTTGCTGG - Exonic
1160948303 19:1653474-1653496 GCTTTGAAGGAGGCCGAGGCGGG + Intergenic
1161266434 19:3366727-3366749 GTTTTGAAGCAGGAGGAGGCGGG + Intronic
1161399105 19:4059741-4059763 GCATTGGCGCAGGGCGTGGCCGG - Intronic
1161804247 19:6433352-6433374 ACCTTGAAGCAGGGTGGGGCAGG - Intronic
1162588713 19:11577216-11577238 GCTTTGTAGCCGTGGGTGACTGG - Exonic
1163124830 19:15239191-15239213 GCTGTGGAGGAGGGGGTGGTCGG + Exonic
1163576527 19:18114097-18114119 GCCTGGAAGGAGGGGGTGGTTGG - Intronic
1164146338 19:22514736-22514758 GCTTTGACCCAGGAGGTGGAGGG + Intronic
1164160014 19:22620322-22620344 GCTTTGACCCAGGAGGTGGAGGG - Intergenic
1165101997 19:33444538-33444560 GATTGGATGCAGGGGGTGGAAGG - Intronic
1165774151 19:38395168-38395190 GCCTTTAAGGAGGAGGTGGCTGG + Intronic
1166129257 19:40736325-40736347 GCTTTGGAGCAGGGTGGAGCTGG - Intronic
1166228762 19:41413457-41413479 GCTTGGTAGCAGAGGGAGGCGGG - Intronic
1166687449 19:44804063-44804085 GATTTGAAGAAAGGCGTGGCTGG + Intergenic
1167492298 19:49799799-49799821 GGTCTGAGGCAGGAGGTGGCTGG + Intronic
1167502667 19:49856571-49856593 GCCCAGAAGCAGGAGGTGGCTGG + Intronic
1167728359 19:51234707-51234729 GCCTGGAAGCAGGGTGGGGCAGG - Intronic
924992386 2:323364-323386 GTTTTTGAGCAGGGTGTGGCAGG + Intergenic
925918577 2:8624296-8624318 GCTTTGCAGCATTGTGTGGCTGG - Intergenic
926337719 2:11876774-11876796 GCTGGGAAGCAGGGGTCGGCAGG - Intergenic
926400208 2:12489127-12489149 GGTGTGAAGCAGGGTGGGGCTGG - Intergenic
927189530 2:20507946-20507968 GCTTTGGAGTAAGGTGTGGCTGG - Intergenic
927460966 2:23297900-23297922 GCTGTGCAGCTGGGGGTGCCTGG - Intergenic
929948727 2:46389833-46389855 GCTGGGAAGGAGGGGGCGGCCGG + Intergenic
930991360 2:57659749-57659771 GCTTTGAGGGAGAGGGTGGGAGG - Intergenic
931872603 2:66477166-66477188 GAATTGGAGCAGGGGGAGGCTGG + Intronic
932572614 2:72945917-72945939 GCGTGGGAGCAGGGGGTGGGTGG - Intronic
933294527 2:80473985-80474007 GCATTGAAGCTGTGTGTGGCTGG - Intronic
934676606 2:96253813-96253835 GTGTGTAAGCAGGGGGTGGCTGG + Exonic
935647219 2:105348936-105348958 TCTTTGAATGAGAGGGTGGCTGG + Exonic
937241632 2:120465860-120465882 GCATTCCAGCAGGGGGTGACTGG - Intergenic
940875494 2:158893444-158893466 GCTGTGAAGCAGAGTGTGACAGG - Intergenic
941448992 2:165635977-165635999 GCTTTGAAGCAGAAGCTGGTGGG - Intronic
942276273 2:174326300-174326322 GATTCGCAGCAGGGGGTGGGCGG - Intergenic
946280475 2:218662488-218662510 GCTATGGAGCATGGGATGGCAGG - Exonic
946372551 2:219289809-219289831 GCTGAGAAGCAGGGGGAGCCGGG + Exonic
1170155261 20:13263336-13263358 GAGTGGAAGCAGGGGGTGGTGGG - Intronic
1170431239 20:16278803-16278825 ACTGAGAAGCAGGGGATGGCGGG - Intronic
1172328740 20:34058898-34058920 GATTTTAAACAGGAGGTGGCAGG + Intronic
1172972176 20:38881551-38881573 GCTTGGAAGCAGGGGCAGGCTGG + Intronic
1173919584 20:46733717-46733739 GCGTGGGATCAGGGGGTGGCAGG - Intronic
1174551781 20:51367394-51367416 GCTTTGGAGCTGGGGGAGGTGGG + Intergenic
1175100189 20:56573916-56573938 CCTCTGAAGCAGAGGGAGGCAGG - Intergenic
1175387407 20:58606064-58606086 GCCTGGAAGCAGGATGTGGCAGG - Intergenic
1175804702 20:61821023-61821045 GCTTTGGGGCGGGGGGTAGCGGG - Intronic
1175961478 20:62639002-62639024 CCTTTGGAGCAGGGTGTGGCTGG - Intergenic
1175986691 20:62767726-62767748 GCTCAGAAGCAGATGGTGGCTGG - Intergenic
1179511260 21:41875278-41875300 GCTTGGGAGTTGGGGGTGGCAGG - Intronic
1180175963 21:46089585-46089607 GCCTTGCAGCAAGGGCTGGCAGG + Intergenic
1181319886 22:21996087-21996109 GCCCTGAAGCAGGGCGTTGCTGG - Intergenic
1181471454 22:23142797-23142819 GGTTTTATGCAGGTGGTGGCTGG - Intronic
1184049926 22:41996938-41996960 GCAGTGGGGCAGGGGGTGGCTGG - Exonic
1185255348 22:49828198-49828220 GCTTTGAAGCAGGGGGGTACCGG + Intergenic
949370563 3:3329855-3329877 GCTGTGAGGCAGGGGGTTTCAGG + Intergenic
950464122 3:13143264-13143286 GCCTCGAAGCTGGGGGTGGTGGG + Intergenic
953701432 3:45198941-45198963 GGGTTGAAGCAGCAGGTGGCCGG + Intergenic
953787508 3:45922110-45922132 GCTCTGAAGCAGCTGGTGGTGGG + Intronic
954822830 3:53346861-53346883 TCTTGGAAGGAGGGGGTGGGTGG - Intronic
954954083 3:54503702-54503724 GTTGAGAAGCAGGGGCTGGCTGG + Intronic
955072165 3:55581041-55581063 GCCTTGAGGCAGGAGGTGCCTGG + Intronic
955864918 3:63372258-63372280 GGTGAGAAGCAGGGGGTGGAAGG - Intronic
956844306 3:73168331-73168353 GCTGTAGAACAGGGGGTGGCAGG - Intergenic
956880931 3:73509905-73509927 GCTTTCAAGGAAAGGGTGGCTGG - Intronic
958629096 3:96665652-96665674 GCTTTGAACCATGGGTAGGCAGG - Intergenic
961017168 3:123477174-123477196 GCTTTGCAGCAGGTGCTGGAGGG + Intergenic
961145071 3:124586515-124586537 GCTGTGATGCAGGGGAGGGCTGG + Intronic
961434780 3:126909350-126909372 GCTTTGGGGCAGGGGCTGCCGGG + Intronic
961822460 3:129582150-129582172 GCTTTGAAGAAGAGCCTGGCAGG - Intronic
962032781 3:131618963-131618985 GCTTTGAAGAACAGTGTGGCAGG + Intronic
962616925 3:137135590-137135612 TTTTTGATGCAGGGGGTGGATGG - Intergenic
963264061 3:143221518-143221540 GCTTTGGGGCAGGGGGCGGAGGG + Intergenic
963602437 3:147390178-147390200 TCTTTTCAGCAGGGGGTGGGTGG - Intronic
964568812 3:158089992-158090014 GCTTTGAAGCTGGAGGAGGCAGG - Intergenic
965916696 3:173857149-173857171 GCTTTGAAGTAGGTGGGGGTTGG + Intronic
965925485 3:173973953-173973975 GCTTTGATGCATGGGCTAGCAGG + Intronic
968136048 3:196220215-196220237 GCTCTGAGGCTGGGAGTGGCTGG + Intronic
969218832 4:5746208-5746230 GCTTTGAAGCAGGGGGTGGCTGG + Intronic
969442947 4:7227946-7227968 GCTGTGAGGCAGGGGGTGGCGGG + Intronic
969548169 4:7845739-7845761 CCTGTGAAGCAGGGGGTGCTTGG - Intronic
970385199 4:15549160-15549182 TCATTGAAGCTGGGGGTGACAGG + Intronic
971857898 4:32065984-32066006 GATTTCAAGTAGGGGGTGGAGGG + Intergenic
973992842 4:56427756-56427778 GATGTGCAGCAGGGGGTGACAGG - Intronic
976115642 4:81722983-81723005 CCTTTGAAGGTGGGGGAGGCAGG - Intronic
977451705 4:97207130-97207152 GCTTTGAATCAGGAGCTGCCTGG + Intronic
978382417 4:108143658-108143680 GCCTTGAAGAAGGCGGGGGCAGG - Intronic
978771782 4:112464845-112464867 GCTTTAAAGCACGAGGTGGGTGG + Intergenic
983583577 4:169333187-169333209 GCATGGGAGCAGGGAGTGGCAGG + Intergenic
983661449 4:170134008-170134030 GCCTTGATGAAGGTGGTGGCTGG + Intergenic
985058352 4:186055474-186055496 GCTAGGAAGCAGAGGGTAGCAGG - Intergenic
985576242 5:674723-674745 GGTTTCCAGCAGGGGATGGCAGG + Intronic
986164138 5:5258784-5258806 GCTTTTAATCTGGGAGTGGCAGG + Intronic
987115209 5:14721025-14721047 CCTTTGGAGCAGTGGGTGGGGGG + Intronic
992152479 5:73918872-73918894 GATTTGAATCAGGGCTTGGCTGG + Intronic
993070768 5:83160810-83160832 GCTTAAAAGAAGGGGGTGGCGGG - Intronic
997733997 5:136200232-136200254 CGTTTGAAGCAGGGGGTGCTTGG - Intergenic
998236533 5:140402561-140402583 GCTTTGGAGTTGGGGGTGGGGGG + Intronic
999185010 5:149700786-149700808 ACTTTGAAGAAGGGGGCAGCAGG + Intergenic
999401345 5:151266740-151266762 GTTTTGGAGAAGGAGGTGGCTGG + Exonic
999537153 5:152529686-152529708 GCTTGGAGGCAGGAGGTGCCTGG + Intergenic
1002849896 6:984509-984531 GCTTAGGAGCAGGGTGGGGCTGG + Intergenic
1002927672 6:1614369-1614391 TCTGTGGAGTAGGGGGTGGCGGG + Intergenic
1003672049 6:8168542-8168564 GCTTTGAAGGAGTGGGTGGGAGG + Intergenic
1003731534 6:8829990-8830012 ACTTAGAAGCAAGTGGTGGCTGG - Intergenic
1004122972 6:12843396-12843418 GCTTGAAGGCTGGGGGTGGCAGG + Intronic
1005873200 6:29992795-29992817 GCTTTTTGGCAGGGGATGGCAGG + Intergenic
1006068806 6:31482073-31482095 GCTTTTAGGCAGGGTGTTGCTGG - Intergenic
1006075484 6:31529665-31529687 GCTTTGTTGCAGGCTGTGGCTGG - Intronic
1006270374 6:32960867-32960889 TCTCTGAAACAGGAGGTGGCAGG - Intronic
1007040327 6:38715560-38715582 GTTTTGAAGCAGGGGTTCCCTGG - Intronic
1007593876 6:43039590-43039612 GCTTGGTGGCTGGGGGTGGCAGG - Intronic
1008023837 6:46611113-46611135 GCTTGGAAGAAGCTGGTGGCTGG - Intronic
1015638383 6:135303808-135303830 GTTGGGAAGCAGGGGGTGCCAGG - Intronic
1017015747 6:150098260-150098282 GCCTGGAAGCTGGGGGTGGTGGG + Intergenic
1017016100 6:150100702-150100724 GCCTGGAAGCTGGGGGTGGTGGG + Intergenic
1017658030 6:156648810-156648832 GCTCTGAAGAAGGGAGAGGCGGG - Intergenic
1020507887 7:9017230-9017252 GCTTGGAAGAAGGGGGCGGGGGG + Intergenic
1021704105 7:23350032-23350054 GCTTTGAAGCAGGAGATGTTGGG - Intronic
1021704112 7:23350045-23350067 GCTTCAAAGCAGGGGAAGGCAGG + Intronic
1022837485 7:34131571-34131593 CCTTTGAAGCAGGGGGCTGGTGG + Intronic
1024249653 7:47496459-47496481 GCTTGGAAGCAGGCGGGGGGAGG + Intronic
1028984363 7:96998226-96998248 GTTTTCAAGAAGGGGGTGGGGGG + Intergenic
1029520620 7:101059455-101059477 GCTTTGAAGCGGGTGGCGGGTGG - Intergenic
1030684417 7:112469875-112469897 GCATTGAAGCAGAGGCTGGAGGG - Intronic
1031483859 7:122306281-122306303 GCTGTGAGACAGGTGGTGGCGGG + Intronic
1033356156 7:140601871-140601893 GCTTTGAAGGATGGGTCGGCAGG - Exonic
1033550281 7:142440739-142440761 GCTTTCAAGTTGGGGGTGGTGGG + Intergenic
1033681211 7:143598464-143598486 AGTTTGTAGCAGAGGGTGGCGGG + Intergenic
1033703680 7:143863349-143863371 AGTTTGTAGCAGAGGGTGGCGGG - Exonic
1034676948 7:152898709-152898731 GCTCTGTAGCCGGGGGTGGGGGG + Intergenic
1035108272 7:156459874-156459896 GGTTTGTGGCAGTGGGTGGCAGG - Intergenic
1035202605 7:157276971-157276993 GCCCTGAAGCAGGGAGTGGATGG - Intergenic
1037587933 8:20290807-20290829 GCTTTGAAGCAGGAGGAAGGAGG + Intronic
1037802683 8:22043988-22044010 CCTTTGAAGCAGTGGGGGGGTGG + Intronic
1038265929 8:26040101-26040123 GCTGTGAAGGAGGTAGTGGCAGG + Exonic
1038523878 8:28256962-28256984 GCTTTGGAGAAGGGTGTGGCTGG - Intergenic
1039553592 8:38460806-38460828 GAGGTGAAGCAGGAGGTGGCAGG - Intronic
1039888871 8:41671252-41671274 CCTTTGAAGGAGGGGCTGGTGGG - Intronic
1040659103 8:49548612-49548634 GCTTTGAGGCAGGAGATAGCAGG + Intronic
1043920951 8:85982779-85982801 GGGTTGAGGCAGTGGGTGGCCGG - Intergenic
1044418011 8:91958094-91958116 GCTTTGGGGCGGGGGGTGGGGGG - Intronic
1046036218 8:108844441-108844463 GCTTTCTGGCAGGGGGTGGATGG + Intergenic
1046918197 8:119699595-119699617 GTTCTGAAGCAGGAGGTGCCTGG - Intergenic
1047862979 8:128989396-128989418 TCCTTGAAGGAGGGGGTGGAAGG - Intergenic
1049466534 8:142753503-142753525 GACTGGGAGCAGGGGGTGGCAGG - Intergenic
1049681685 8:143921542-143921564 GCTGTGAAGGAGGGTGTGGTGGG - Exonic
1050768071 9:9161031-9161053 GATATGGGGCAGGGGGTGGCAGG + Intronic
1052928045 9:34034020-34034042 GATTTGAAGCCGGGCGTGGTGGG - Intronic
1056715151 9:89022327-89022349 GCTTTGAAGAAGGAAGTGGGAGG - Intronic
1060049396 9:120366818-120366840 GCTTTGAAGCAGGAAGAGGCCGG - Intergenic
1060050839 9:120377067-120377089 TCTTTGAAGCAGAGGATGTCGGG + Intergenic
1060639050 9:125223317-125223339 GGATTGCAGCAGAGGGTGGCAGG - Intronic
1061288800 9:129639359-129639381 GCTTTGAAGCAGGGTTGGGCAGG - Intronic
1061417329 9:130454208-130454230 TCTCTGTAGCAGGGGGTGGGAGG + Intronic
1061566612 9:131444883-131444905 CCTTGGAAGCCGAGGGTGGCTGG + Intronic
1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG + Intronic
1191979760 X:66912704-66912726 GCTATGAAGCAGAGGGCTGCAGG + Intergenic
1193204156 X:78727977-78727999 GCTCTGAAGCAGTTAGTGGCAGG + Intergenic
1198728001 X:139697081-139697103 GCCCTGAAGCAGGGGTTTGCTGG - Intronic
1199259869 X:145759879-145759901 GGTCTGAAGCAGGGGCTGCCTGG + Intergenic
1199276410 X:145948681-145948703 GCTTGGAAGTAAGGGGTGGAGGG - Intergenic
1200142429 X:153908772-153908794 GCTTCAGAGCAGGGAGTGGCAGG - Intronic
1200684452 Y:6246398-6246420 GCTGTGCAGGAGGGGGCGGCCGG + Exonic
1200995297 Y:9378251-9378273 GCTGTGCAGGAGGGGGCGGCCGG + Intronic
1201000470 Y:9467130-9467152 GCTGTGCAGGAGGGGGCGGCCGG + Exonic