ID: 969219735

View in Genome Browser
Species Human (GRCh38)
Location 4:5751934-5751956
Sequence GAGATCAAGTCCAGCACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 137}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969219735_969219740 -5 Left 969219735 4:5751934-5751956 CCTGGGGTGCTGGACTTGATCTC 0: 1
1: 0
2: 0
3: 14
4: 137
Right 969219740 4:5751952-5751974 ATCTCAGGGCAGCAACAGGAGGG 0: 1
1: 0
2: 1
3: 22
4: 274
969219735_969219739 -6 Left 969219735 4:5751934-5751956 CCTGGGGTGCTGGACTTGATCTC 0: 1
1: 0
2: 0
3: 14
4: 137
Right 969219739 4:5751951-5751973 GATCTCAGGGCAGCAACAGGAGG 0: 1
1: 0
2: 2
3: 23
4: 232
969219735_969219744 8 Left 969219735 4:5751934-5751956 CCTGGGGTGCTGGACTTGATCTC 0: 1
1: 0
2: 0
3: 14
4: 137
Right 969219744 4:5751965-5751987 AACAGGAGGGTTTGGGGCCATGG 0: 1
1: 0
2: 1
3: 35
4: 297
969219735_969219738 -9 Left 969219735 4:5751934-5751956 CCTGGGGTGCTGGACTTGATCTC 0: 1
1: 0
2: 0
3: 14
4: 137
Right 969219738 4:5751948-5751970 CTTGATCTCAGGGCAGCAACAGG 0: 1
1: 0
2: 1
3: 17
4: 174
969219735_969219742 1 Left 969219735 4:5751934-5751956 CCTGGGGTGCTGGACTTGATCTC 0: 1
1: 0
2: 0
3: 14
4: 137
Right 969219742 4:5751958-5751980 GGGCAGCAACAGGAGGGTTTGGG 0: 1
1: 0
2: 2
3: 24
4: 267
969219735_969219741 0 Left 969219735 4:5751934-5751956 CCTGGGGTGCTGGACTTGATCTC 0: 1
1: 0
2: 0
3: 14
4: 137
Right 969219741 4:5751957-5751979 AGGGCAGCAACAGGAGGGTTTGG 0: 1
1: 0
2: 3
3: 19
4: 317
969219735_969219743 2 Left 969219735 4:5751934-5751956 CCTGGGGTGCTGGACTTGATCTC 0: 1
1: 0
2: 0
3: 14
4: 137
Right 969219743 4:5751959-5751981 GGCAGCAACAGGAGGGTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969219735 Original CRISPR GAGATCAAGTCCAGCACCCC AGG (reversed) Intronic
900030642 1:370055-370077 CAGCTCACGTCCAGGACCCCAGG + Intergenic
900051248 1:598726-598748 CAGCTCACGTCCAGGACCCCAGG + Intergenic
900379784 1:2378099-2378121 GAGGTCAAATGCAGGACCCCTGG - Intronic
902601125 1:17540543-17540565 TAGATGAAGACCAGCCCCCCTGG + Intronic
903320286 1:22539030-22539052 GTGAACAAGACCAGAACCCCAGG + Intergenic
903389607 1:22954625-22954647 GAGATAAAGTGCACCACCCAAGG + Intronic
904398911 1:30242962-30242984 GAGTCCCAGCCCAGCACCCCTGG - Intergenic
906557448 1:46724812-46724834 GAGCCCAAGGCCAGCACCCCTGG + Intergenic
907303946 1:53503592-53503614 GAGCTCAGGTCCAGCCCCCGGGG + Intergenic
908768428 1:67574344-67574366 GAAGTCAAGTTCAGCACCACTGG - Intergenic
914001681 1:143699775-143699797 GGGAGCAAGTCCAGGACCGCTGG - Intergenic
914514529 1:148362680-148362702 GGGAGCAAGTCCAGGACCGCCGG - Intergenic
921432578 1:215082193-215082215 CAGCTCATGTCCAGCACCGCCGG + Intronic
922139142 1:222864138-222864160 CAGTTCAAATCCAGCACTCCAGG + Intergenic
923547528 1:234933670-234933692 GAGACCATGGCCAGCACCCAAGG + Intergenic
924626088 1:245697681-245697703 GAGGTCATGACAAGCACCCCAGG - Intronic
1063145056 10:3289049-3289071 GAGACCAAGTCCAGCTTTCCTGG - Intergenic
1067146073 10:43694800-43694822 AAGGGCAAGTCCAGGACCCCAGG - Intergenic
1068450032 10:57174302-57174324 GAGTTCAAGGCCAGCAGCCTGGG - Intergenic
1069746408 10:70717596-70717618 GAGAACTGGTCCATCACCCCTGG - Intronic
1072829702 10:98644794-98644816 GAGATGAAATCCAGCAACCTTGG + Intronic
1074871908 10:117583570-117583592 GAGTTCAAGACCACCACCCTGGG - Intergenic
1075728448 10:124622617-124622639 GAGGGCCAGTCCAGCACCCCAGG + Exonic
1077307938 11:1876260-1876282 GGGGTCAAGTCTAGGACCCCAGG + Intronic
1077916030 11:6612050-6612072 GAGAACAAGGCCAGCCCCGCGGG - Exonic
1078366564 11:10711444-10711466 GAGATAAAGTCCAGGAAACCAGG - Intergenic
1079125421 11:17714914-17714936 CAGAACAAGTCCAGCACCTGTGG + Intergenic
1079620625 11:22549956-22549978 GAGATGAAGCCCAGCAAACCTGG + Intergenic
1083710408 11:64544963-64544985 GAGAAAAAGGGCAGCACCCCAGG - Intergenic
1084706594 11:70819538-70819560 GAGTGCAAATCCAGCTCCCCTGG + Intronic
1086054177 11:82627991-82628013 AAGCTCAAGTCCATCAGCCCAGG + Intergenic
1089523682 11:119082665-119082687 GAGTTCAAGACCAGCCACCCAGG + Intergenic
1089639720 11:119839733-119839755 CAGGTCATGTCCACCACCCCGGG - Intergenic
1091407674 12:219474-219496 GAGATTGAGCCCAGCACCCTCGG + Intergenic
1092279412 12:7088564-7088586 GAGAGCCGGCCCAGCACCCCAGG - Intronic
1093642028 12:21538869-21538891 TAGAGTAAGTTCAGCACCCCAGG - Intronic
1094354874 12:29566461-29566483 GAGTTCAAGACCAGCCCCGCTGG - Intronic
1101320520 12:103669326-103669348 TAGAGCCAGTCCAGCACCCAGGG + Intronic
1101753813 12:107605600-107605622 GGGATAAAGTCCAGCTCTCCAGG - Intronic
1102205669 12:111089231-111089253 GAGGCCAAGTCCAGCAGCGCTGG + Intronic
1103693458 12:122794874-122794896 GAGTTCAAGACCAGCAGCCTGGG - Intronic
1103772942 12:123342733-123342755 GGTATCCAGTCCAGAACCCCTGG + Intronic
1106120090 13:26852887-26852909 GAGATCTACTCCAGCCCCCCAGG + Intergenic
1108808892 13:54195766-54195788 GAGATAAATCCCAGCACCTCTGG - Intergenic
1109237778 13:59845540-59845562 GATATGAAGTAGAGCACCCCAGG - Intronic
1111626489 13:90794490-90794512 TAGATCATGCCCATCACCCCAGG + Intergenic
1113130308 13:107029175-107029197 GAGATCAACTCTACCAACCCTGG + Intergenic
1118759597 14:68871937-68871959 GAGATCAAGTCCAGCAGCTAAGG + Intergenic
1119226236 14:72946548-72946570 CAGATCAACTCCTGGACCCCTGG - Intronic
1119537164 14:75411851-75411873 GAGATCAAGACCAGCAACACAGG - Intergenic
1121006086 14:90491536-90491558 GAGGTCAAGGCCAACACCCCAGG - Intergenic
1121955190 14:98207086-98207108 AAGACCAACCCCAGCACCCCTGG + Intergenic
1123045760 14:105513145-105513167 GTGAGCACGTCCAGCACCCAGGG + Intergenic
1123677723 15:22727925-22727947 GAGTTCAAGACCAGGAGCCCAGG - Intergenic
1124329925 15:28802189-28802211 GAGTTCAAGACCAGGAGCCCAGG - Intergenic
1126249298 15:46548946-46548968 GAGATCTTTTCCTGCACCCCAGG + Intergenic
1129542731 15:76364230-76364252 GAGATTAAGTACAGCAGCCTTGG + Intronic
1129964599 15:79722845-79722867 CAGTTCCAGTCCACCACCCCAGG - Intergenic
1130573638 15:85071262-85071284 TAGAGCAACTCCAGCATCCCAGG - Intronic
1132725570 16:1336905-1336927 GACAGCAAGGCCAGGACCCCGGG + Intronic
1133106261 16:3511729-3511751 GAGACCAATTCCAGGACGCCTGG - Intronic
1133110144 16:3543159-3543181 GAGAACAAGATCAGCCCCCCTGG + Intronic
1133194890 16:4162179-4162201 GAGTTCAAGACCAGCATCCTGGG + Intergenic
1133328193 16:4955110-4955132 GAGTTCATGCCCAGCACCCCTGG + Intronic
1136420465 16:30129210-30129232 CAAATGAAGTCCACCACCCCTGG + Intergenic
1137442523 16:48508878-48508900 GAAATCAAGTGCAGCACCGGTGG - Intergenic
1138527419 16:57617085-57617107 GGGACCTAGCCCAGCACCCCTGG - Intronic
1144403895 17:14933892-14933914 GAGATCAAGTACAGCAGCAGGGG - Intergenic
1145818216 17:27810866-27810888 GAGATCAACTGCAGGTCCCCAGG + Intronic
1147361671 17:39934561-39934583 GGGAGCAAGTCTAGCAGCCCAGG - Intergenic
1147952642 17:44115621-44115643 GAAAGCCAGTCCAGAACCCCAGG + Intronic
1149997926 17:61414609-61414631 GAGCCCAAGTCCAGCAGGCCCGG + Intergenic
1151976687 17:77487531-77487553 GAGATCAAGTCCATCACGCACGG + Exonic
1152751671 17:82065295-82065317 GACATCGAGTCCCGCTCCCCAGG - Exonic
1152948975 17:83215350-83215372 CAGCTCACGTCCAGGACCCCAGG - Intergenic
1157036167 18:43977438-43977460 GAGTTCAAGACTAGCACTCCAGG + Intergenic
1158931221 18:62325991-62326013 AGGGTCAAGTCCAGCATCCCCGG - Intronic
1162319672 19:9963765-9963787 GGGATCAAGTCTTGCACTCCGGG + Intronic
1167201910 19:48071652-48071674 GAGTTCAAGACCAGCAAGCCTGG - Intronic
927558069 2:24049859-24049881 GAGATCGAGACCATCTCCCCCGG + Exonic
928152064 2:28840254-28840276 GAGATGAAGTTCAGCTGCCCCGG + Exonic
931633425 2:64321408-64321430 GAGAGCAAATCCAGGAGCCCTGG - Intergenic
932842186 2:75093873-75093895 GAGATCAATTCTAATACCCCAGG - Intronic
933588328 2:84203810-84203832 GAGGTTAAGTCCCGCATCCCAGG - Intergenic
933840410 2:86281802-86281824 GAGAAAAAGTCCAGCATCGCAGG - Intronic
933884478 2:86705358-86705380 GAGATCAAGACCACCAGCCTGGG - Intronic
936065954 2:109332340-109332362 AGGAGCAAGTGCAGCACCCCTGG - Intronic
936705187 2:115064325-115064347 GAGATCAAGTACAGCAAAGCAGG + Intronic
938792699 2:134690999-134691021 GAGATCAGGTCCCACACTCCAGG + Intronic
949072668 2:242035436-242035458 GAGGTCACGGCCAGCAGCCCCGG + Intergenic
1172584882 20:36076256-36076278 GAGATCAAATCCACAAACCCTGG - Intergenic
1174563515 20:51447917-51447939 GATGTCAAGTCATGCACCCCAGG - Intronic
1175977989 20:62722810-62722832 GAGAGCTAGTCCAGTACCCCTGG + Intronic
1184935537 22:47717646-47717668 TACATCAAGCCCAGGACCCCAGG - Intergenic
951716063 3:25647937-25647959 GTGATAAGTTCCAGCACCCCAGG + Intronic
952723513 3:36557772-36557794 GAGATCAAATCCAAGACCCTGGG + Intergenic
952995045 3:38871784-38871806 GAGATCAAGCCCTGCACATCAGG - Intronic
953902802 3:46852764-46852786 GAGTTCAGCTTCAGCACCCCAGG - Intergenic
960592276 3:119377944-119377966 GAGCTCAAGTCCTGCTGCCCGGG - Intronic
964983141 3:162710681-162710703 GAAATCGAGTGCAGCACCACTGG + Intergenic
967886798 3:194338783-194338805 GAGTTCTAGTCCAGAACCCATGG - Intergenic
968905736 4:3449771-3449793 GAAACCAAGTCCAGGCCCCCAGG + Intergenic
969219735 4:5751934-5751956 GAGATCAAGTCCAGCACCCCAGG - Intronic
969326439 4:6447125-6447147 GAGAGCCAGGCCAGCTCCCCAGG - Intronic
975646178 4:76548266-76548288 GAGGTCAAATCCAGCACGGCAGG + Intronic
976618509 4:87102845-87102867 GAGATGAACTACAGCACACCTGG - Intronic
983128013 4:163978933-163978955 GAGTTCAAGACCAGCATCGCCGG - Intronic
985668361 5:1193442-1193464 TAGATGATGTCCAGCATCCCTGG + Intergenic
985855510 5:2421591-2421613 AAAATCAGGACCAGCACCCCAGG + Intergenic
986330793 5:6714554-6714576 GAGAACAAGGCCAGCACCTACGG + Intergenic
987107150 5:14650875-14650897 GAGTTCAAGACCAGCAGCCTGGG + Intergenic
992152491 5:73918975-73918997 TATATCAAGTCCAGTATCCCAGG - Intronic
995476332 5:112552198-112552220 AAGAGCAAGTGCAGCAGCCCTGG + Intergenic
995484772 5:112629166-112629188 GAGTTGAAGTCCAAGACCCCAGG + Intergenic
999287141 5:150400855-150400877 GAGACCATCTCCAGGACCCCTGG - Intergenic
1002743179 5:181448813-181448835 CAGCTCACGTCCAGGACCCCAGG - Intergenic
1004317412 6:14601774-14601796 GAGAGGCAGACCAGCACCCCAGG + Intergenic
1005968398 6:30742918-30742940 GAGGTCAAGTCCCTCACCCGGGG - Intergenic
1007777510 6:44232070-44232092 GAGGTCAAGTCCAGCATCGCAGG + Exonic
1008816207 6:55569840-55569862 GAGAACAAGGCCAGCATCCCAGG - Intronic
1008940588 6:57041368-57041390 GAGATGATGTCCAGGACCCAGGG - Intergenic
1011541162 6:88431842-88431864 GAGATCAAGTTTAGCAAGCCTGG - Intergenic
1015259198 6:131215351-131215373 CAGATCATGTCCAGCACCCAGGG - Intronic
1016325620 6:142898080-142898102 GAGATCAAGACCTGGAGCCCAGG - Intronic
1018567620 6:165172013-165172035 GACATCATGTCCCTCACCCCTGG - Intergenic
1022179712 7:27907346-27907368 GAGCACAAGGCCAGCACCCATGG - Intronic
1022272827 7:28826812-28826834 GAGATCAAGCAAAGAACCCCAGG - Intergenic
1024554346 7:50590675-50590697 GAGAACAAGTCCCGCAAACCGGG - Exonic
1024995757 7:55272141-55272163 AAGATGAACTCCAGCACTCCAGG - Intergenic
1025000839 7:55313294-55313316 GAGAGAAATTGCAGCACCCCTGG - Intergenic
1028567892 7:92253145-92253167 CAATTCTAGTCCAGCACCCCAGG + Intronic
1029519808 7:101052813-101052835 GAGATGAAGACCAGCATCCCTGG - Intronic
1030619014 7:111769476-111769498 GACATCAACACCATCACCCCAGG + Intronic
1035499816 8:83486-83508 CAGCTCACGTCCAGGACCCCAGG + Intergenic
1037637884 8:20716858-20716880 GAAATCAAGTAGAGGACCCCAGG + Intergenic
1039428302 8:37505284-37505306 AAGATCAAGTCCAGCCACCTTGG - Intergenic
1040015543 8:42696245-42696267 GAGGTCTAGCCCAGGACCCCGGG - Intergenic
1040455532 8:47593994-47594016 GAGGTGAAGTCCAGGCCCCCAGG + Intronic
1040970995 8:53137626-53137648 AAGATCAAGTCCATCAGCGCAGG - Intergenic
1041065405 8:54077871-54077893 GAGAACATTTCCAGCTCCCCAGG - Intronic
1044622101 8:94200694-94200716 CAGAGCAAGCCCAGCAGCCCTGG - Intronic
1047403002 8:124561801-124561823 CAGACCAAGCCAAGCACCCCAGG + Intronic
1059676726 9:116547546-116547568 AAGATGAAGTCCACCACCGCAGG - Intronic
1061315456 9:129792840-129792862 GAGGTCAGCTCCAGCACCCTGGG + Intergenic
1203609062 Un_KI270748v1:79848-79870 CAGCTCACGTCCAGGACCCCAGG - Intergenic
1187075159 X:15927566-15927588 GAGTTCAAGGCCAGCAGCCTAGG + Intergenic
1190096103 X:47482498-47482520 CAGATCAAGTCCAGAAGCGCCGG - Intronic
1195564225 X:106323305-106323327 TAGAACAACTCCAGCAGCCCTGG + Intergenic
1196126887 X:112110470-112110492 GAGCTCAAGTCCATCAGCACAGG - Intergenic
1198145885 X:133857512-133857534 AAGATGAAATCCAGCTCCCCAGG - Intronic
1200231425 X:154445696-154445718 GAGCTCAAGTCCAGCACCGTGGG + Exonic
1201963309 Y:19706390-19706412 GAGATCAGGTCCAGCAGGCAGGG - Intronic