ID: 969220186

View in Genome Browser
Species Human (GRCh38)
Location 4:5754102-5754124
Sequence GGTCCTAGTGGACTGTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 42}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969220173_969220186 30 Left 969220173 4:5754049-5754071 CCATGTGTCAGCCGAGTGACCGA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 969220186 4:5754102-5754124 GGTCCTAGTGGACTGTAAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 42
969220182_969220186 -10 Left 969220182 4:5754089-5754111 CCTACATCCCTAGGGTCCTAGTG 0: 1
1: 0
2: 1
3: 12
4: 93
Right 969220186 4:5754102-5754124 GGTCCTAGTGGACTGTAAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 42
969220176_969220186 -1 Left 969220176 4:5754080-5754102 CCCTTAGCCCCTACATCCCTAGG 0: 1
1: 0
2: 0
3: 3
4: 127
Right 969220186 4:5754102-5754124 GGTCCTAGTGGACTGTAAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 42
969220174_969220186 19 Left 969220174 4:5754060-5754082 CCGAGTGACCGAATCTCAGTCCC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 969220186 4:5754102-5754124 GGTCCTAGTGGACTGTAAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 42
969220178_969220186 -2 Left 969220178 4:5754081-5754103 CCTTAGCCCCTACATCCCTAGGG 0: 1
1: 0
2: 0
3: 7
4: 115
Right 969220186 4:5754102-5754124 GGTCCTAGTGGACTGTAAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 42
969220175_969220186 11 Left 969220175 4:5754068-5754090 CCGAATCTCAGTCCCTTAGCCCC 0: 1
1: 0
2: 3
3: 17
4: 216
Right 969220186 4:5754102-5754124 GGTCCTAGTGGACTGTAAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 42
969220181_969220186 -9 Left 969220181 4:5754088-5754110 CCCTACATCCCTAGGGTCCTAGT 0: 1
1: 0
2: 0
3: 6
4: 62
Right 969220186 4:5754102-5754124 GGTCCTAGTGGACTGTAAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 42
969220180_969220186 -8 Left 969220180 4:5754087-5754109 CCCCTACATCCCTAGGGTCCTAG 0: 1
1: 0
2: 1
3: 8
4: 96
Right 969220186 4:5754102-5754124 GGTCCTAGTGGACTGTAAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969220186 Original CRISPR GGTCCTAGTGGACTGTAAGC TGG Intronic
903177009 1:21587358-21587380 TGTCCTCCTGGACTGTAAACAGG + Intergenic
903574387 1:24329330-24329352 GGCCCTAGTGGCCTGGCAGCAGG + Intronic
910927120 1:92409100-92409122 GCTACTAGAAGACTGTAAGCAGG + Intergenic
914975971 1:152362668-152362690 GGTCCAAGTGGACAGATAGCAGG + Intergenic
916091359 1:161309988-161310010 GGCCCTAGGGGATTTTAAGCAGG - Intergenic
1064296634 10:14084715-14084737 GGTCCTAGTTGTCTGGTAGCTGG - Intronic
1072615112 10:97043883-97043905 GCTGTTAGTGGACTTTAAGCTGG - Intronic
1074302239 10:112242935-112242957 GGACCTAGTGGGATATAAGCCGG - Intergenic
1078144350 11:8712861-8712883 GGTCCTCCTGCACTGTGAGCTGG - Intronic
1086904601 11:92404310-92404332 TGTACTAGTGGAATGTATGCTGG + Intronic
1088501118 11:110483980-110484002 GTTCCTAGTGGAATGAAAACAGG + Intergenic
1091797664 12:3306463-3306485 GGTCCTGGTGGGCAGGAAGCTGG - Intergenic
1093764866 12:22951931-22951953 GGACCAGGTGTACTGTAAGCAGG + Intergenic
1096571464 12:52525773-52525795 GGTCCAAGTGGACAGTGAGCAGG - Intergenic
1098901642 12:76117352-76117374 GATCATAGTGCACTGTAACCTGG - Intergenic
1107402653 13:40084552-40084574 GGTCCCAGTGACCTGTAAGTGGG + Intergenic
1111852031 13:93587932-93587954 GGTTATGGTGGACTGTAGGCTGG - Intronic
1118473813 14:66099115-66099137 GCTCCTCGTGTACTGCAAGCAGG - Intergenic
1127931393 15:63599785-63599807 GGTCCTTCTGGACTGGAAGCAGG + Intronic
1131439065 15:92444938-92444960 GGTCCTACTGGCCTGTAGGGAGG - Intronic
1138615293 16:58160614-58160636 GGTCCCAGTGGACTGAAAGGTGG - Intronic
1156469795 18:37370144-37370166 GGACCTATTGGATTGGAAGCTGG - Intronic
1161289471 19:3485248-3485270 GGTCCTAGTGGAAGGAAAGTAGG + Intergenic
934922854 2:98359798-98359820 GGGCCTAGGGGAGTGCAAGCTGG + Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
1171255497 20:23686507-23686529 GGACCTAGAGGCCTGTTAGCTGG - Intronic
1171262841 20:23748429-23748451 GGACCTAGAGGCCTGTTAGCTGG - Intronic
1171271969 20:23824633-23824655 GGACCTAGAGGCCTGTTAGCTGG - Intronic
1172808556 20:37630962-37630984 GCTTCTAATGGACTGTAAACAGG + Intergenic
1180240605 21:46502199-46502221 GGTCCTAGCTCACTGTAACCTGG + Intronic
969220186 4:5754102-5754124 GGTCCTAGTGGACTGTAAGCTGG + Intronic
970498428 4:16652014-16652036 GATCATAGTGCACTGTAACCTGG + Intronic
978037342 4:104011378-104011400 AGTCCAAGTGGACTGAAAGCAGG + Intergenic
980717431 4:136645190-136645212 GCTCCTAGAGGATTTTAAGCAGG - Intergenic
982468261 4:155758194-155758216 GGGCCTGGTAGAATGTAAGCTGG + Intergenic
986671931 5:10150371-10150393 GCTTCAAGTGGTCTGTAAGCAGG + Intergenic
996895390 5:128475069-128475091 GGTGGTAGTGGTCTGTAAGGAGG + Intronic
998178285 5:139915471-139915493 GGCACCAGTGGAATGTAAGCAGG - Intronic
1000268481 5:159660149-159660171 GCTCCTGGAGGACTGTAAGCAGG + Intergenic
1006625576 6:35395427-35395449 AGTCATAGTGGACTGTAAGCAGG + Intronic
1007037112 6:38685797-38685819 GGTACAAGTTGACAGTAAGCTGG - Intronic
1007229331 6:40337513-40337535 TGTCCAAATGGACTGTAAACTGG - Intergenic
1014303872 6:119716180-119716202 GGTCCTAGTACATTGTAAACAGG - Intergenic
1026077773 7:67188552-67188574 GGTCCTAGTAGACAGTACTCGGG + Intronic
1032093193 7:128922296-128922318 AGTCCTACTGGACTGTGAGGGGG - Intergenic
1035230080 7:157460061-157460083 GGCCCTGGTGGACTGGAAGCTGG + Intergenic
1036788191 8:11701797-11701819 ACTCCTAGTGGACTGAAACCTGG - Intronic
1044848119 8:96401557-96401579 GGTCCTAGTGAACCGAAAACTGG + Intergenic
1051215606 9:14794337-14794359 GCTCCTAATGGACAGGAAGCTGG + Intronic
1192152299 X:68719778-68719800 GGTCCCACTGGTCTGTAAGGTGG - Intronic
1200059474 X:153477852-153477874 GCTCCTACGGGACTGTTAGCTGG + Intronic