ID: 969220233

View in Genome Browser
Species Human (GRCh38)
Location 4:5754340-5754362
Sequence GGGAACTCCCTTCCTTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 298}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969220233_969220234 -9 Left 969220233 4:5754340-5754362 CCAGGAGAAGGAAGGGAGTTCCC 0: 1
1: 0
2: 1
3: 29
4: 298
Right 969220234 4:5754354-5754376 GGAGTTCCCAGCCTTGCATGTGG 0: 1
1: 0
2: 1
3: 12
4: 186
969220233_969220244 15 Left 969220233 4:5754340-5754362 CCAGGAGAAGGAAGGGAGTTCCC 0: 1
1: 0
2: 1
3: 29
4: 298
Right 969220244 4:5754378-5754400 GTTGAGTGGTCAGGGCCAGGAGG 0: 1
1: 0
2: 4
3: 29
4: 235
969220233_969220239 1 Left 969220233 4:5754340-5754362 CCAGGAGAAGGAAGGGAGTTCCC 0: 1
1: 0
2: 1
3: 29
4: 298
Right 969220239 4:5754364-5754386 GCCTTGCATGTGGGGTTGAGTGG 0: 1
1: 0
2: 0
3: 15
4: 160
969220233_969220236 -7 Left 969220233 4:5754340-5754362 CCAGGAGAAGGAAGGGAGTTCCC 0: 1
1: 0
2: 1
3: 29
4: 298
Right 969220236 4:5754356-5754378 AGTTCCCAGCCTTGCATGTGGGG No data
969220233_969220241 6 Left 969220233 4:5754340-5754362 CCAGGAGAAGGAAGGGAGTTCCC 0: 1
1: 0
2: 1
3: 29
4: 298
Right 969220241 4:5754369-5754391 GCATGTGGGGTTGAGTGGTCAGG 0: 1
1: 0
2: 2
3: 19
4: 170
969220233_969220235 -8 Left 969220233 4:5754340-5754362 CCAGGAGAAGGAAGGGAGTTCCC 0: 1
1: 0
2: 1
3: 29
4: 298
Right 969220235 4:5754355-5754377 GAGTTCCCAGCCTTGCATGTGGG 0: 1
1: 0
2: 0
3: 10
4: 154
969220233_969220242 7 Left 969220233 4:5754340-5754362 CCAGGAGAAGGAAGGGAGTTCCC 0: 1
1: 0
2: 1
3: 29
4: 298
Right 969220242 4:5754370-5754392 CATGTGGGGTTGAGTGGTCAGGG 0: 1
1: 0
2: 0
3: 11
4: 176
969220233_969220245 18 Left 969220233 4:5754340-5754362 CCAGGAGAAGGAAGGGAGTTCCC 0: 1
1: 0
2: 1
3: 29
4: 298
Right 969220245 4:5754381-5754403 GAGTGGTCAGGGCCAGGAGGTGG 0: 1
1: 0
2: 7
3: 81
4: 585
969220233_969220246 24 Left 969220233 4:5754340-5754362 CCAGGAGAAGGAAGGGAGTTCCC 0: 1
1: 0
2: 1
3: 29
4: 298
Right 969220246 4:5754387-5754409 TCAGGGCCAGGAGGTGGCCAAGG 0: 1
1: 0
2: 2
3: 91
4: 634
969220233_969220243 12 Left 969220233 4:5754340-5754362 CCAGGAGAAGGAAGGGAGTTCCC 0: 1
1: 0
2: 1
3: 29
4: 298
Right 969220243 4:5754375-5754397 GGGGTTGAGTGGTCAGGGCCAGG 0: 1
1: 0
2: 0
3: 44
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969220233 Original CRISPR GGGAACTCCCTTCCTTCTCC TGG (reversed) Intronic
901229220 1:7632732-7632754 GGGATCTCACATCCTTTTCCTGG - Intronic
904670528 1:32161616-32161638 GAGAACACCATTCCTTGTCCTGG + Intronic
905463102 1:38134079-38134101 GGGGACTGCCTATCTTCTCCCGG + Intergenic
905799160 1:40832407-40832429 AGGACCTCCCTTCCCTGTCCTGG + Intronic
906229862 1:44152869-44152891 GGGGCCACCCTGCCTTCTCCAGG + Intergenic
907075959 1:51578566-51578588 GGCAAGTCACTTCCTTCTCTGGG - Intronic
907142886 1:52204800-52204822 GGGAAATCCCCTCATTCTTCTGG - Intronic
909051645 1:70774641-70774663 GGGCAGTCCACTCCTTCTCCTGG + Intergenic
909474106 1:76062838-76062860 GAGAACTCCTTTCCCTTTCCAGG - Intergenic
911407637 1:97462784-97462806 GAGAATCCCCTTCCTTTTCCAGG + Intronic
912493468 1:110076073-110076095 CCAAACTCTCTTCCTTCTCCAGG - Intergenic
913183777 1:116347748-116347770 TGCAACTCCCTGCCTTGTCCTGG + Intergenic
915074288 1:153296134-153296156 GAGAATTCCCTTCCCTCTCCAGG + Intergenic
915279180 1:154810611-154810633 TTAAAATCCCTTCCTTCTCCTGG - Intronic
915581384 1:156815136-156815158 AGGAACAGGCTTCCTTCTCCAGG + Exonic
915642714 1:157241585-157241607 GAGAACCCCCTTCCCTTTCCAGG + Intergenic
915922136 1:159983937-159983959 AGGCACTGCCTTTCTTCTCCAGG - Intergenic
917666319 1:177229234-177229256 GGGCAATCACTTCCTTCTCTGGG - Intronic
918851362 1:189694524-189694546 GTCAGCTCCCTTCCTGCTCCAGG + Intergenic
919607182 1:199698719-199698741 GGGAAGTCTCTTCCTTTTTCTGG - Intergenic
919801038 1:201354849-201354871 GGGCACTCACTTGCTTCTCTGGG - Intergenic
921708171 1:218347121-218347143 GGGATCGCCCTTCCCTCTCGCGG + Intronic
923682919 1:236133525-236133547 GGGCACTCCCTTTCTCCACCTGG + Intergenic
1063102707 10:2964287-2964309 GAGAACCCCCTTCCCTTTCCAGG + Intergenic
1063368044 10:5503095-5503117 GGAGACTCCCTTTCTCCTCCAGG - Intergenic
1063835707 10:10009381-10009403 GGCAACTCCCTTTTTTCTCATGG + Intergenic
1064520234 10:16193307-16193329 GAGAACACCCTTCCCTTTCCAGG + Intergenic
1066978574 10:42390988-42391010 GGAAACTCCCTCACCTCTCCAGG - Intergenic
1067301584 10:45015436-45015458 GGCAAGTCCCTTTCTTATCCTGG + Intergenic
1068070060 10:52183942-52183964 GGGAAGTCCCTCCTGTCTCCAGG + Intronic
1070150946 10:73804690-73804712 AGGAACTCTCTTCTCTCTCCAGG - Intronic
1070277154 10:75018185-75018207 GGCCACTCCCTGCTTTCTCCTGG + Intronic
1070673032 10:78391524-78391546 GGGATCTCCTTTTGTTCTCCTGG + Intergenic
1070772169 10:79088843-79088865 GGGAACATCCTTCCTGCACCAGG + Intronic
1072221921 10:93333973-93333995 GGGAAGTCCCCTCCTCCGCCAGG + Intronic
1073108469 10:101047019-101047041 GCCCACTCCCCTCCTTCTCCTGG - Intergenic
1076324217 10:129608841-129608863 GGCCACTCCCTTTCATCTCCCGG + Intronic
1077264763 11:1643080-1643102 GGCCCCTCCCCTCCTTCTCCAGG + Intergenic
1079419454 11:20272469-20272491 GAGAGCTCCCTTCCTCCCCCTGG + Intergenic
1081706713 11:45186447-45186469 GGAAATGCCCTCCCTTCTCCGGG - Intronic
1082775511 11:57241520-57241542 GGGAACTTCCCTCTCTCTCCTGG + Intergenic
1083306576 11:61764888-61764910 GGGCAAGCCCTTCCTTCTCTAGG + Intronic
1083664604 11:64267696-64267718 GCTAACTCCCTTCATCCTCCTGG + Intronic
1083889015 11:65586607-65586629 GGGAACTGCCAGCCATCTCCCGG + Intronic
1084003439 11:66311314-66311336 GTCAACTCCCTTCCTCCTCAAGG + Intergenic
1084395169 11:68904524-68904546 GGGAAGGGCCTTCCTCCTCCAGG - Intronic
1084815088 11:71640968-71640990 GAGAACTGTCCTCCTTCTCCCGG - Intergenic
1085120863 11:73966505-73966527 GGCAAGTCCCTTTCTTCTCTGGG - Intronic
1085272416 11:75278195-75278217 GGGGAGGCCCTTCCTTCTGCAGG + Intronic
1085777825 11:79382295-79382317 GTGAACACCCTTCCTTAACCTGG + Intronic
1086450372 11:86909508-86909530 GGCAAGTCACTTCCCTCTCCGGG - Intronic
1086532432 11:87801426-87801448 GGGAACTCCCTCCCCTATGCAGG - Intergenic
1089479631 11:118793508-118793530 GTGAACCCCCTTCCTTTGCCTGG - Intergenic
1092217179 12:6691693-6691715 GGGAGATCCCTCCCTCCTCCTGG + Intergenic
1094012166 12:25820967-25820989 AGGATCTCCCTTCCTTGTCTTGG + Intergenic
1095510810 12:42949798-42949820 GGGTACCTGCTTCCTTCTCCAGG + Intergenic
1096624810 12:52888082-52888104 GGGAAATCCCTGCCTTCTCTGGG - Intergenic
1097498369 12:60372897-60372919 GGGAGCTCCCTTCCCCCGCCAGG + Intergenic
1097691171 12:62735898-62735920 GAGAACTACCTTCCATTTCCAGG - Intronic
1098416135 12:70237330-70237352 GGCAATTCCATGCCTTCTCCAGG - Intergenic
1099176021 12:79423089-79423111 CTGAACTCCCTTCCTGCCCCTGG - Intronic
1101740709 12:107497795-107497817 GGGCACATCCTTCCTTCTCCTGG + Intronic
1102258599 12:111430065-111430087 GGGACCTCCGTTCCTACCCCAGG - Intronic
1102404106 12:112657882-112657904 GTCAACTCCCTCCCTTCTTCAGG - Intronic
1103297743 12:119902833-119902855 GGGATCTCCCTTTGTTATCCAGG + Intergenic
1103597798 12:122034806-122034828 GGGTCCTCCCTCCTTTCTCCCGG + Intronic
1104110397 12:125699041-125699063 TAGAACTCCCTTCCTTCTGCTGG - Intergenic
1105630179 13:22156207-22156229 GCATGCTCCCTTCCTTCTCCTGG + Intergenic
1105898914 13:24740562-24740584 CAGAACCCCCTTCCTCCTCCAGG - Intergenic
1108431996 13:50362628-50362650 CAGAACTCCCTTCCTTCTTAAGG + Intronic
1108454581 13:50600103-50600125 GTGAACTACATTCCTTCACCTGG - Intronic
1109342539 13:61079449-61079471 GAGAACCCCCTTCCCTTTCCAGG + Intergenic
1110957976 13:81580864-81580886 GGAAATTCCCTTTCTTGTCCAGG + Intergenic
1117797146 14:59406162-59406184 GGGAACTCCCTCCCCTAGCCAGG - Intergenic
1117969424 14:61237415-61237437 GAGAACTCCTTTCCCTTTCCAGG + Intronic
1118213797 14:63789272-63789294 GGGAACTCCCTTCACTATCCTGG + Intergenic
1121957084 14:98223946-98223968 GGCTCCTCCCTTCCTTCTCCAGG - Intergenic
1122372937 14:101238918-101238940 GGGACCTTCCTGCCTGCTCCAGG - Intergenic
1122964985 14:105119177-105119199 GGGAACTCTATTCCCTCTCTGGG + Intergenic
1123858269 15:24436000-24436022 GGGGACTTCCTCCCTTCCCCGGG + Intergenic
1124577674 15:30924172-30924194 CAGGACTCCGTTCCTTCTCCAGG + Intronic
1126644708 15:50863431-50863453 AGGAACACCCTGCCATCTCCTGG + Intergenic
1127078170 15:55348523-55348545 GAGAACTCACTTACTACTCCAGG - Intronic
1127863571 15:63013836-63013858 GGGAACACTCTTCCCTCTGCTGG + Intergenic
1128109612 15:65068105-65068127 AGGAGCTCCCTCCCTGCTCCAGG - Exonic
1128147519 15:65340216-65340238 GGGAACTCTCTTCCTGGTCCAGG + Intronic
1129342001 15:74892325-74892347 GGTAAATCCCTCCCTTCTCTGGG - Intronic
1129601128 15:76999067-76999089 GGGAGGACCCTTCCTTCTCTGGG - Intronic
1129615964 15:77098880-77098902 GGCAAGTCCTTTCCCTCTCCAGG - Intergenic
1129697109 15:77746970-77746992 GGTAAGTCCCTGCCCTCTCCTGG - Intronic
1130260770 15:82352758-82352780 GGGAAGTCCCCTGCTTCCCCAGG + Intergenic
1130653756 15:85777484-85777506 GGGACCTCCCTTCGCTTTCCAGG - Intronic
1130911660 15:88275104-88275126 GGGACCTCAGGTCCTTCTCCAGG - Intergenic
1132099841 15:99015309-99015331 GGGAAGTCCCTGCCTTCCCAGGG + Intergenic
1132855561 16:2043128-2043150 GGGAACACACTTCCTCCTCTTGG + Intronic
1133154317 16:3861996-3862018 AGTGACTCGCTTCCTTCTCCTGG - Intronic
1133417803 16:5619852-5619874 GGGGGCTCACTTCCTTCTCCTGG + Intergenic
1134001886 16:10789261-10789283 GAGAACCCCCTTCCCTTTCCAGG - Intronic
1134028277 16:10971405-10971427 TGGAAATCCTTGCCTTCTCCAGG + Intronic
1134080758 16:11323459-11323481 GGGGCCTCCCTTCCATCTTCTGG + Intronic
1137044752 16:35644481-35644503 GGGCTATCCCTTCCTTCCCCAGG + Intergenic
1137896686 16:52220127-52220149 CGGAACTCCCTACCTGCACCTGG + Intergenic
1139486831 16:67262505-67262527 GGGAACTTCCTGGCTTCACCTGG + Intronic
1139946809 16:70647398-70647420 GGGAACAGGCTGCCTTCTCCAGG - Intronic
1140220433 16:73039858-73039880 GGGATGTCCCCTCCTGCTCCTGG - Intronic
1140686157 16:77435252-77435274 GGGCGCTCCCCTCCTTCTCATGG - Intergenic
1141278937 16:82613293-82613315 GGGCACACTCTTCCTTCCCCAGG + Intergenic
1141489251 16:84360817-84360839 CGAAACTTCCTTCCTTCTCTAGG - Intergenic
1143036776 17:4004066-4004088 GGGCCCTGCCTTCCTCCTCCGGG + Intergenic
1144488572 17:15687692-15687714 GGGAAGTCCCTCCTGTCTCCAGG + Intergenic
1144568809 17:16381997-16382019 GGGGAATGCCTTCCTTATCCTGG - Exonic
1144912439 17:18694613-18694635 GGGAAGTCCCTCCTGTCTCCAGG - Intergenic
1145787802 17:27605363-27605385 GCGACGTCTCTTCCTTCTCCTGG - Intronic
1146529781 17:33598770-33598792 GGGCACATCCTTCCTTGTCCTGG - Intronic
1147163611 17:38581814-38581836 GGGAACCCCCAGCCTTCTCATGG - Intronic
1147562870 17:41519749-41519771 AGGAAGCCCCTGCCTTCTCCAGG + Exonic
1147656943 17:42096470-42096492 GGGCACTCCCTCCCTTGCCCAGG + Intergenic
1147919058 17:43905529-43905551 GGTAACCCCCTGCCCTCTCCTGG - Intronic
1150659187 17:67060760-67060782 CAGAACTCCCTTCCTTTTTCAGG + Intergenic
1150715351 17:67568166-67568188 GGGTACTCCATTCCTTTTTCTGG - Intronic
1150852238 17:68714777-68714799 AAAATCTCCCTTCCTTCTCCAGG - Intergenic
1151635798 17:75347047-75347069 AGTAAGTCCTTTCCTTCTCCAGG + Intronic
1152461847 17:80445785-80445807 GGCAAGTCCCTTCCTTCTGCAGG + Intergenic
1155090544 18:22504904-22504926 GGGAACCACTTCCCTTCTCCAGG - Intergenic
1156470668 18:37375615-37375637 GGGAAGCCTCTTCCTTCTCTGGG - Intronic
1157108568 18:44798352-44798374 GGGAGCCACCTTCCTTCTCTGGG - Intronic
1157386644 18:47263689-47263711 AGGAAATCCCGTCCTTCCCCTGG - Intergenic
1160312347 18:77807513-77807535 GGGAACTCAATTCCTTTGCCTGG - Intergenic
1160365326 18:78319663-78319685 GGGAACTGCCGACCTTCTCACGG - Intergenic
1160780690 19:876784-876806 GGGAACTCCCTCCCTGCTGCTGG + Intronic
1160889820 19:1371341-1371363 GCGAACTCCCTCCCTACTGCGGG + Intronic
1162745683 19:12796761-12796783 TGCAACCCCCTTCCTTCTTCAGG - Intronic
1163158591 19:15452148-15452170 AGGAAGTCCCTTCCAGCTCCTGG + Intronic
1163248134 19:16110097-16110119 GGGATCTCCCTATCTTGTCCGGG + Intergenic
1163439752 19:17316132-17316154 TGGAACGCTCTTCCCTCTCCTGG - Intronic
1163564697 19:18043958-18043980 GAGAAATACCTTCCTGCTCCTGG + Intergenic
1163598065 19:18231947-18231969 GGGACTTCCCTTCCTCCTACAGG + Intronic
1164570726 19:29372475-29372497 GGTCACTTCCTTCTTTCTCCTGG - Intergenic
1166079406 19:40434183-40434205 GGGGACTCGGTTCCTTCTGCAGG + Intergenic
1168136770 19:54357050-54357072 GGGATCTCCCTTCACTCCCCAGG + Intronic
925455420 2:4012450-4012472 TGGAACTACCTTCCACCTCCAGG - Intergenic
925540655 2:4963967-4963989 GGAAACTCTTTTCTTTCTCCAGG - Intergenic
926309330 2:11663284-11663306 GGGAGCTCCCTTCCATCCCTCGG - Intronic
927248957 2:20981182-20981204 GGTGACTCCTTTCCTTGTCCAGG - Intergenic
929069870 2:38019561-38019583 GGGAATTCCCCTCCTCATCCTGG + Intronic
929619335 2:43338684-43338706 TGGAATTTCCTTCCTTTTCCAGG + Intronic
929732243 2:44508419-44508441 GGGAACTCCCTTCCTGTAACTGG - Intronic
929817913 2:45250331-45250353 GGGATCTTCTTTCCTTTTCCTGG - Intergenic
930001101 2:46862026-46862048 AAGAGCTCCCTGCCTTCTCCTGG + Intergenic
930076373 2:47409009-47409031 GGGATCTCCCTACATTCCCCAGG - Intronic
930439849 2:51391588-51391610 GGGAACTCCTTCCCTTAGCCAGG + Intergenic
932458248 2:71863713-71863735 GGGATCTCCCTTCCCCTTCCAGG - Intergenic
932497295 2:72152440-72152462 GGGTAATGCCTTCATTCTCCTGG - Intergenic
933026268 2:77263207-77263229 TGGAATTCCCTGCCCTCTCCAGG - Intronic
935797509 2:106659101-106659123 GAGAGCTTCCTTCCTTCTGCTGG + Intergenic
937059203 2:118969089-118969111 AGGAAGTCCCTGCCTGCTCCAGG - Intronic
937280870 2:120716416-120716438 GGCAATTCCCTTCTCTCTCCAGG - Intergenic
938128294 2:128690277-128690299 GAGAACTCCCCTCCTACTTCCGG + Intergenic
938251608 2:129820103-129820125 GGGCACTCCCCTCCTTGTCAAGG + Intergenic
938959664 2:136329802-136329824 GGGTAATGCCTTCCTTATCCTGG + Intergenic
939382108 2:141448636-141448658 GGGAACTCCCTCCCCTAGCCAGG - Intronic
939559853 2:143719626-143719648 GGGAATTCCATTCTCTCTCCTGG + Intronic
940548063 2:155115480-155115502 GAAAACTCCTTTCCTTCACCTGG + Intergenic
941085702 2:161115080-161115102 GGGAACTCACTTCCCTCTCTGGG + Intergenic
942125295 2:172818800-172818822 GGGAATTCCTTTTCTTTTCCAGG + Intronic
943408840 2:187520385-187520407 GGGAACTCCCTCCCCTAGCCAGG - Intronic
943650882 2:190456514-190456536 GGGAACTCCCTGGCTGCTCTAGG + Intronic
944291966 2:198018133-198018155 GGGAACTCCCTTCCTATCCAAGG + Intronic
945266153 2:207893301-207893323 AGGAACACCCTTCCTTCTTTGGG + Intronic
945495765 2:210505621-210505643 GGGAATTCCCTTTCTTAGCCAGG + Intronic
946388717 2:219402339-219402361 GGGAACTGACTTCCTCCTCCTGG - Intergenic
947498184 2:230654042-230654064 AGAACCTCCCTTCCTTCCCCAGG + Intergenic
947879118 2:233489698-233489720 GGGAACTCACTTCTTTCTCAAGG - Intronic
1169051253 20:2579813-2579835 TGGATCTCCCTTTCTTTTCCTGG - Intronic
1170998436 20:21389279-21389301 GGGTATTTCCTTCCTTCTCTGGG - Exonic
1171989442 20:31684504-31684526 GGGAGGTCCCATCCTTCCCCTGG - Intronic
1172145995 20:32758964-32758986 GTGTAATCCCTTCCTTCTCTGGG + Intergenic
1173431967 20:42996122-42996144 GGGAACTCTCTTCTTTCACCTGG - Intronic
1173598930 20:44279203-44279225 GGAAACCCCCATCCTTCTTCGGG + Exonic
1174211890 20:48886349-48886371 GGCTTCTCACTTCCTTCTCCTGG + Intergenic
1174511102 20:51053284-51053306 TGGAATTCCCTTCCTTTTCGAGG + Intergenic
1176268435 20:64222792-64222814 AGGAGCTCCTTCCCTTCTCCAGG - Intronic
1177808405 21:25898832-25898854 GGGAATTCACTTCCTGCTCTTGG + Intronic
1178489788 21:33042154-33042176 GGGACCTCCCTTCCTCAGCCTGG - Intergenic
1179465206 21:41567329-41567351 GGAAACTCCCTCCCCTTTCCTGG - Intergenic
1179604536 21:42505395-42505417 GGTAACTCGATGCCTTCTCCAGG + Intronic
1180713460 22:17855822-17855844 GGAAACTCACTGGCTTCTCCAGG + Intronic
1180735471 22:18013148-18013170 GGTAACTGCCTTCTTTCTTCAGG - Intronic
1181076154 22:20378324-20378346 GGTAACTGCCTTCCTTCTTCAGG - Intronic
1181496212 22:23288752-23288774 GGGCAGCCCCTTCCTTCTCTGGG + Intronic
1181620419 22:24087336-24087358 GGAAACTCCCTTCCCACACCAGG - Intronic
1181955727 22:26586780-26586802 GTGAACTACCTACCTTCTCAAGG + Intronic
1182024591 22:27108126-27108148 GGTAAGTCCCTTCCCTCTCTGGG + Intergenic
1182350878 22:29698804-29698826 GGGAACTGCCTCCCTCTTCCTGG + Intergenic
1183045247 22:35214278-35214300 GGGAACTCCCTTGTTTTTGCTGG - Intergenic
1183307504 22:37090431-37090453 GGGCACTCCCTTCTCTCTACCGG - Intronic
1183667433 22:39253839-39253861 GGGGGCTGCCTTCCTTCCCCAGG + Intergenic
1184233022 22:43168687-43168709 GGCAGCTGCCTGCCTTCTCCAGG + Intronic
949964200 3:9341455-9341477 GGGAAATATTTTCCTTCTCCTGG - Intronic
950224954 3:11225904-11225926 GTTAATTCACTTCCTTCTCCAGG - Intronic
951310834 3:21124750-21124772 GGGAACTCCCTCCCCTAGCCAGG + Intergenic
953468554 3:43146810-43146832 GGAGACTCCCCTCCTCCTCCTGG + Intergenic
955381492 3:58441969-58441991 GAGAATCCCCTTCCTTTTCCAGG - Intergenic
956123947 3:65993889-65993911 GGGAATTACCTTTCTTCTCTGGG - Intronic
956740192 3:72269655-72269677 GGGAACTCCCTTCCTCCCAAGGG - Intergenic
957072608 3:75578757-75578779 GAGAACTGTCCTCCTTCTCCCGG + Intergenic
959073352 3:101724710-101724732 GGGATCGCCTTACCTTCTCCGGG - Exonic
959074472 3:101735598-101735620 GGGAACTCCCTCCCCTAGCCTGG + Intronic
960303001 3:116026954-116026976 GGCATCTCCCATCCTTCTCCTGG - Intronic
961182210 3:124886494-124886516 CGAGACTCCCTTGCTTCTCCGGG + Intronic
961241621 3:125416516-125416538 GGGAATCCACTTCCTTCTACTGG + Intergenic
961492680 3:127266281-127266303 GGGCCCTGCCTGCCTTCTCCCGG - Intergenic
961872901 3:130001584-130001606 GAGAACTGTCCTCCTTCTCCCGG + Intergenic
962017044 3:131452448-131452470 TGGAAGTCCCTGCCTTTTCCAGG - Intergenic
962797894 3:138864655-138864677 GGGATCTCCCTGTGTTCTCCAGG + Intergenic
963235652 3:142953268-142953290 GGGAATTCCCTTCATTCACATGG + Intronic
966322542 3:178716884-178716906 GGGACACCCCTTCTTTCTCCAGG + Intronic
967298289 3:187986853-187986875 GGGAACTCCCTGCCTACCCAGGG + Intergenic
967853878 3:194101923-194101945 GTGCTCTCCCTTGCTTCTCCAGG - Intergenic
968621770 4:1606683-1606705 AAGAACCCCCTTCCTTATCCTGG + Intergenic
968681643 4:1925010-1925032 GGGGCCTCCCTTCCCTCCCCTGG + Intronic
969016208 4:4106092-4106114 GAGAACTGTCCTCCTTCTCCCGG + Intergenic
969220233 4:5754340-5754362 GGGAACTCCCTTCCTTCTCCTGG - Intronic
969378866 4:6781865-6781887 GTAATCTCCCTTCCTTTTCCAGG + Intronic
969737741 4:9002256-9002278 GAGAACTGTCCTCCTTCTCCCGG - Intergenic
969796944 4:9533817-9533839 GAGAACTGTCCTCCTTCTCCCGG - Intergenic
971146436 4:23981573-23981595 TGAAACTCCTTTCCTCCTCCTGG - Intergenic
973676527 4:53268814-53268836 GGGCTCTCCCTTCCTGCTCCAGG - Intronic
975524181 4:75331201-75331223 GGGAACTCCCTCCCATAGCCAGG + Intergenic
977610119 4:99022282-99022304 GGGAGGCCCCTTCCATCTCCTGG - Intronic
978104903 4:104890085-104890107 GGTAAATCCATTCTTTCTCCAGG + Intergenic
978435252 4:108677022-108677044 GGGAACTTCCTTACCTCTCAAGG + Intergenic
978906703 4:114013409-114013431 GGGAACTCCCTCCTTTAGCCAGG - Intergenic
979966057 4:127077579-127077601 GGGAACTCCCTCCCCTCTCCAGG - Intergenic
980908782 4:138975270-138975292 GAGAATTCCCTTCCCTTTCCAGG + Intergenic
981939306 4:150264889-150264911 GGGCACCCCCTTCCCTCCCCGGG - Exonic
982119350 4:152126360-152126382 GGTAACTTCCTTTCTTCTGCTGG + Intergenic
982370462 4:154627484-154627506 AGGAACTCCCTGCCCTGTCCTGG + Intronic
984640318 4:182157759-182157781 TGGAACGCCCTTACCTCTCCTGG - Intronic
986719054 5:10547130-10547152 GGGAATTCCCTTCCCTCCCATGG + Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
989313392 5:40048039-40048061 GGGAACTCCCTACATTGCCCAGG - Intergenic
990582008 5:57174243-57174265 GGGCACTCCCCTCCTCCCCCGGG - Intronic
994370610 5:98963220-98963242 GGGAAACCCTTTCATTCTCCAGG - Intergenic
995301846 5:110594207-110594229 GGGAACTACCTTCCCTAGCCAGG + Intronic
996995966 5:129696980-129697002 GGGAATCCCCTTCCCTTTCCAGG - Intronic
997537241 5:134632442-134632464 GGCAAGCCCCTTCCTTCCCCTGG - Intronic
997590270 5:135067981-135068003 GGGTTCTCTCTTCTTTCTCCAGG + Intronic
998384627 5:141749654-141749676 GGGAACTGACTGCCTTCTCCAGG - Intergenic
999225183 5:150016151-150016173 GGGGTCTCCCTGCCTTGTCCAGG - Intronic
999870128 5:155741335-155741357 GAGAATTCCCTTCTTTTTCCAGG - Intergenic
1000285961 5:159826399-159826421 GGTAAATCCCTTCATTCGCCTGG + Intergenic
1001091030 5:168741088-168741110 AAGACCTCCCTTCCTTCCCCTGG + Intronic
1001574711 5:172755699-172755721 GGTAAGTCCTCTCCTTCTCCAGG + Intergenic
1001700378 5:173702373-173702395 GGCAAGTCCCTTTCTTCTCTGGG + Intergenic
1002505403 5:179675885-179675907 TGGGACTCCCTGCCTTCTGCAGG + Intergenic
1002624829 5:180518690-180518712 GGGAACTCCCTTTGTTGCCCAGG + Intronic
1003214585 6:4097754-4097776 GGGAAATGCCTTCCTTCTTTTGG - Intronic
1004027920 6:11837090-11837112 GGGAACTCCCTCCCCTAGCCAGG + Intergenic
1006027230 6:31154871-31154893 GGGTCCTCTTTTCCTTCTCCTGG - Intronic
1006539387 6:34727196-34727218 GGGTCCTCCCTTCCCTCTCAAGG + Intergenic
1006677335 6:35773886-35773908 GAGAAGTCCCTGCCTTCTCTGGG + Intergenic
1006857381 6:37144486-37144508 GGGAGCTCCCTGGCTTTTCCAGG + Intergenic
1006930914 6:37687916-37687938 GGGACCTCCCTTGGTTCTCTAGG - Intronic
1013368309 6:109450654-109450676 GGGCAGCCCCTTCCTTCTCTGGG - Intronic
1015355986 6:132277547-132277569 TAGAACTCCATTCCTTCCCCTGG + Intergenic
1018906659 6:168079711-168079733 GGACACTTCCTTCCTTGTCCAGG + Intronic
1019789238 7:2999910-2999932 GGGATCTCACTTGCTTGTCCAGG + Intronic
1021219502 7:17959955-17959977 GGGATCTCCCTGCATTTTCCAGG - Intergenic
1021935868 7:25630648-25630670 GGCCACTACCTTCCTTCCCCAGG - Intergenic
1022090024 7:27102058-27102080 TGGGACCCTCTTCCTTCTCCGGG - Intronic
1025005919 7:55354736-55354758 GGGAATCCCCTTCCATTTCCAGG + Intergenic
1025079128 7:55966939-55966961 TGGCACTCCCTCCCTCCTCCTGG - Intronic
1026827521 7:73593765-73593787 GGGCACTCCCTTCCTGCCCCAGG - Exonic
1026918046 7:74134466-74134488 GGGAAATCCCTGCCCTTTCCTGG + Intergenic
1027249472 7:76389997-76390019 GTGACCTCCCTTCCTCCTCCAGG - Exonic
1027582795 7:80020027-80020049 GGGAACTCCCTCCCCTAGCCAGG + Intergenic
1028404549 7:90461415-90461437 TGGGACTACCTTCCTTCTCTGGG + Intronic
1029074875 7:97927737-97927759 GAGAACTGTCCTCCTTCTCCCGG + Intergenic
1029514669 7:101017818-101017840 TGGGACTCCCTTCCTCCCCCTGG + Intronic
1029514879 7:101018228-101018250 CGGGACTCCCTCCCTTCCCCCGG + Intronic
1029514924 7:101018344-101018366 TAGGACTCCCTCCCTTCTCCTGG + Intronic
1030110602 7:106023433-106023455 AGGCTCTCCCTTCCTTCTCCAGG - Intronic
1032705966 7:134421663-134421685 TGGAGCTCTCTTCCTTCTCCCGG + Intergenic
1033162305 7:139008552-139008574 GAGAATCCCCTTCCCTCTCCAGG + Intergenic
1034422727 7:150997864-150997886 GGGACCTCCCAGCCTCCTCCTGG + Intronic
1034467117 7:151236449-151236471 CCGAGCTCCCTTCCTTCTCAGGG - Exonic
1034865273 7:154636377-154636399 AGGCCCTTCCTTCCTTCTCCTGG + Intronic
1036242839 8:7093517-7093539 GAGAACTGTCCTCCTTCTCCCGG - Intergenic
1036652753 8:10655478-10655500 GGGAACTGTTTTCCATCTCCCGG + Intronic
1036898984 8:12657919-12657941 GAGAACTGTCCTCCTTCTCCTGG + Intergenic
1036900239 8:12664933-12664955 GAGAACTGTCCTCCTTCTCCCGG + Intergenic
1037837054 8:22220675-22220697 AGGAACTCTCTTTCTTCTCTTGG - Exonic
1039877440 8:41599035-41599057 GGGAACTTGCTTCCTTTCCCTGG + Exonic
1040768166 8:50941551-50941573 GGGTACTTCTTTCCTTCTCCTGG + Intergenic
1044309470 8:90677005-90677027 GAGAATCCCCTTCCCTCTCCAGG - Intronic
1045023504 8:98064481-98064503 GCCAGCTCCCTTCCTCCTCCAGG + Exonic
1045753751 8:105516873-105516895 GGGACCTCACTTTCTTTTCCTGG - Intronic
1046062985 8:109161602-109161624 TGGCAATCTCTTCCTTCTCCTGG - Intergenic
1049568896 8:143359299-143359321 GTGACCTGCCTCCCTTCTCCTGG - Intronic
1050300577 9:4253846-4253868 GGGAACTCCCTCCCCTAGCCAGG - Intronic
1052731211 9:32288590-32288612 GGTAACTTCCTTTCTTCTGCTGG + Intergenic
1053291008 9:36879635-36879657 GGAAATTCCCTGGCTTCTCCGGG + Intronic
1053461716 9:38276669-38276691 GGCAAGTCCCTTCCCTGTCCTGG - Intergenic
1056150904 9:83787257-83787279 GGGATCTCCCTTTCTTGCCCAGG + Intronic
1057077702 9:92147569-92147591 GGGAGCTCCCTTTCTTTTCAGGG - Intergenic
1057801408 9:98193180-98193202 GAGGACGCCCTTCCTTCTCTCGG + Intergenic
1058272190 9:102986309-102986331 TGGTGCTCCCTCCCTTCTCCTGG - Intergenic
1058711325 9:107681927-107681949 GAGAACACCCTTCCTCCTCCCGG + Intergenic
1058719243 9:107748759-107748781 GGCAACTCTCTTCGTTCACCAGG + Intergenic
1059742849 9:117169806-117169828 GGGAACTCCCTCCCTTCACTGGG - Intronic
1059948816 9:119440602-119440624 TGGTACACCCTTTCTTCTCCAGG + Intergenic
1060277602 9:122193749-122193771 GGGACCACCCTTCCTCCTTCAGG - Intronic
1061207164 9:129171376-129171398 GGGAACACCCTCCCTGCTCCTGG - Intergenic
1061630989 9:131872102-131872124 GGGAACCGCCTTCCAGCTCCTGG + Intronic
1062081712 9:134627601-134627623 GGCAACTCCCGTCTCTCTCCTGG - Intergenic
1062624770 9:137437780-137437802 GGGACCTCCCTGCCTGATCCTGG - Intronic
1186182806 X:6989412-6989434 GAGAAATTCCTTCCTTATCCTGG - Intergenic
1190360333 X:49643393-49643415 GAGAATCCCCTTCCTTTTCCAGG + Intergenic
1190929814 X:54937860-54937882 GGCAACTCACTTCCTTCTTAGGG + Intronic
1191994333 X:67074915-67074937 GGGTATTTCCTTTCTTCTCCTGG - Intergenic
1192207509 X:69106152-69106174 GGCAACTTCCTCCCTTCTCTGGG - Intergenic
1194303475 X:92215021-92215043 GGGATCTCCCTTCCGTCGCCGGG - Intronic
1196064146 X:111444159-111444181 GGTAATTCACTTCCTTCTCAGGG + Intergenic
1196613669 X:117742986-117743008 GAGAAGTGCCTTCCTTCACCAGG - Intergenic
1196946665 X:120833299-120833321 GGGAACTCCCTTCCTAGCCAAGG - Intergenic
1196971920 X:121119002-121119024 GGGAACTCTCTTCTTTTCCCTGG - Intergenic
1197653022 X:129086354-129086376 GGGAAGTCCCTTCTGGCTCCAGG - Intergenic
1198219077 X:134583525-134583547 GGTAAGTCCCTTCCCTCTCCTGG + Intronic